THANKS MEAT CAT

i never posted the fucked up skinnable walter white crying on the ground cake i made for my brother's birthday did i

These prices are all over the place btw. The conversions don't make any sense

Why is it 165 euros cheaper to buy a PS5 pro in America than in Europe

AND YOU HAVE TO BUY THE DISK DRIVE SEPARATELY

THEY'RE TAKING THE PISS SO HARD

FRASIER — 07.15 - "Out with Dad" (2000)

lol Brent Carver and Rufus Wainwright doing a duet of Every Day A Little Death

this exchange between me and my sister about animal crossing reads like two comrades bleeding out on the battlefield

i literally cannot stop thinking about this post

keysmashes: 

akjsldfahbasdtbfyausdjkfas;klmclk;sdmde

dna:

cgatgtcgatcgatcagctagcgatcgtatcggatagctatgcgatcgatcgtgatcgatcgtact

hm ok so it appears that last night my third eye received a message with no context and i didnt even try to translate it

umm so the screenshot of @oysters-aint-for-me​ was taken a couple hours ago way to be a harbinger of doom what the fuck. 

Flattened is a bizarre little game where you attempt to avoid getting flattened as 500ft men, women and furries stomp around the game world.

Read More & Play The Alpha, Free (Windows)

Don’t like that

Yeah same

the biggest queer mormon power play ever played was when the lead singer of Neon Trees made the band famous and had several hit songs and then in rolling stone was like “oh btw i’m gay and Sleeping With a Friend is about having sex with a male friend” and then looked at his other band mates like “what are you gonna do about it” and the other band members had to be like (cough) yeah. we, uh, we know it goes against our doctrine but we support him. and he was like “that’s what I thought”

The moral of the story is that if you want to come out to your homophobic friends all you gotta do is become the face and frontman of the band that is their sole source of income and sleep w whoever you want

Otherwise just ditch em

We waited two years, and god damn was it worth it. Thank you Vinny.

I’M THE MARIO eat your arms and then again GO ON GOGON GOGA DO THE MARIO I am god and then you know COME ON IT’S TIME TO GO EAT THE DARIO doodle-oo doot doo d-d *vinny vomiting in his mouth* J-JUST LIKE THAT

@buzzfeed what the hell is this? 🤔 These dishes are a part of someone’s culture, they’re not just your trendy food 

And why the fuck are they saying ‘they must go’? Fuck off, they aint yours

I was not kidding. This happened.

what the fuck w hat the actua l fguck ok okay there’s a couple of things i need to point out about this picture because i am so fuckgin confused right now you have no idea: 1. his shirt has his own glasses and moustache on it. ok nbd probs a joke or smthn. ok but BUT both the left and the right pictures seem completely identical and his shirt and head have just been swapped ok but how is it that you can see this man’s buckle and belt loops on the right picture where none are seen on the left????? was the man shirtless when the original photo was taken and someone took the time to both photoshop a shirt onto him and then photoshop his face and his shirt around, thus exposing the top of his pants??? but that doesnt make any sense because clearly the expertise of the photoshop on the right is not great enough to photoshop a shirt onto this guy and make it look realistic?????? even the lighting and the colouring of both the photos match the subject and the background???? so what is the real photo here and most importantly why does it exist