WO2004035088A1

WO2004035088A1 - Therapeutics/diagnostics for brain tumor

Info

Publication number: WO2004035088A1
Application number: PCT/JP2003/013191
Authority: WO
Inventors: Masahiro Toda; Yutaka Kawakami; Takeshi Kawase; Naofumi Okabe; Taketsugu Hamada
Original assignee: Institute Of Gene And Brian Science
Priority date: 2002-10-15
Filing date: 2003-10-15
Publication date: 2004-04-29
Also published as: JP2004137151A

Abstract

It is intended to provide a therapeutic or a diagnostic for tumor, in particular brain tumor, a probe for detecting/diagnosing brain tumor, a diagnostic kit for brain tumor, a method of treating tumor, in particular brain tumor, and a method of screening an anti-brain tumor agent. Among about 11,000 genes from human patients with brain tumor, 16 genes showing remarkably accelerated expression in human brain tumor compared with other non-cancer tissues are selected by Gene Chip analysis. After further narrowing down by EST screening with the use of EST database and analyzing by RT-PCR and real time quantitative PCR, it is found out that an urokinase plasminogen activator receptor-associated protein (uPARAP) is expressed specifically in tumor, in particular brain tumor. Thus, compounds such as peptides and proteins capable of specifically binding to uPARAP (for example, an antibody specifically recognizing the extracellular domain of uPARAP) are usable as therapeutics/diagnostics for brain tumor.

Description

Brain tumor treatment

The present invention relates to a u-type protein such as an antibody that recognizes the extracellular domain of the perokinase-type plasminogen activator receptor-associated protein (u PARAP).

PARAP specific binding peptideDiagnosis of cerebral tumors containing as an active ingredient a compound such as protein or low molecular weight compoundAntisense strand of DNA or RNA encoding a therapeutic drug or uPARAP The present invention relates to a diagnostic and therapeutic agent for brain tumors containing as an active ingredient and a method for treating brain tumors using them. Background art

Recent advances in microarray technology have made it possible to analyze the expression of many genes and proteins at once. In particular, DNA microarray analysis of gene expression in cancer tissues has provided new insights into cancer progression and drug sensitivity. Recently, Gene Chip, available for a wide range of nucleic acid analyzes such as gene discovery monitoring, sequence analysis, and dienotyping, has been marketed by Asymetrix, USA.

On the other hand, the perokinase-type plasminogen activator receptor-related protein (u PARAP) was reported as KI AA 079 Antibodies that specifically recognize are also known. KIAA0709 is a novel cDNA cDNA obtained from human brain that encodes a protein with a molecular weight of 50 kDa or more. Of the KI AA 0709 gene (accession number AB 0 146 09) among the genes (named KI AA 0611 to KI AA 0710 gene) It has been reported (DNA Res. 5 (3), 169-176, 1998). In addition, the complete cDNA of Endo 180 was cloned using an anti-Endol 80 monoclonal antibody and a polyclonal antiserum to produce an endocytosis recycling protein associated with the mannose receptor of macrophages. It has also been reported that certain Endo 180 is expressed in fibroblasts, endothelial cells, and macrophages and functions as a lectin receptor (J. Cell Sci., 113, 6, 1021-1032, 2000). . u PARAP is a type of macrophage 'mannose receptor protein that contains a collagen-binding (fibronectin type II) region in addition to the 8C-eve carbohydrate recognition region and is strongly associated with collagen and collagen V. (J Biol Chem 2000 Jan 21; 275 (3): 1993 · 2002). Perokinase-type plasminogen activator (u PA) and UPA receptor (u PAR) are important elements in the plasminogen activation system and act to promote tissue remodeling and cancer invasion. In addition, there have been reports of uPARAP as an endogenous receptor involved in the clearance of the complex between uPA and uPAR, and anti-uPARAP polyclonal antibodies that specifically recognize uPARAP. (Int J Cancer 1; 98: 656-64, 2002). According to this report, the expression of uPARAP in benign and malignant thoracic disorders was negative in healthy thoracic tissue, but related to all benign disorders and non-invasive ductal carcinomas. In invasive carcinomas, uPARAP immunoreactivity is limited to tumor-associated mesenchymal cells, and uPARAP is associated with myofibroblasts and macrophages. It is said to be localized throughout the area. An object of the present invention is to provide a therapeutic or diagnostic agent for tumors, especially brain tumors, a probe for detecting and diagnosing brain tumors, a diagnostic kit for brain tumors, a method for treating tumors, particularly brain tumors, and a method for screening anti-brain tumor agents. Is to do.

The present inventors have identified 16 genes, of which the expression is significantly enhanced in human brain tumors as compared to non-cancerous brain tissue, from approximately 11, 000 genes of human brain tumor patients. Select by analysis, narrow down by screening using EST database, and find out that UP ARAP is highly expressed in tumors, especially brain tumors, by analysis using RT-PCR and real-time quantitative PCR. The present invention has been completed. Disclosure of the invention

That is, the present invention provides a therapeutic agent for tumors comprising a compound such as a peptide, a protein, or a low-molecular compound that specifically binds to uPARAP as an active ingredient (Claim 1). The therapeutic agent for tumor according to claim 1, wherein the compound such as a peptide, a protein, or a low-molecular compound that specifically binds to ARAP is an antibody that specifically recognizes the extracellular domain of uPARAP. (Claim 2) or a therapeutic agent for tumors, which comprises a compound such as a peptide / protein or a low molecular weight compound which specifically binds to uPAR and / or Pro-uPA as an active ingredient. Claim 3) A therapeutic agent for tumors, comprising, as an active ingredient, all or part of the antisense strand of DNA or RNA encoding uPARAP, uPAR, and Pro-uPA. (Claim 4) or the tumor is a brain tumor Tumor therapeutic agents according to any one of claims 1 to 4, characterized in that regarding (claim 5).

Also, the present invention provides a method for administering a tumor to a tumor patient, which comprises administering a compound such as a peptide / protein, a low molecular weight compound, etc., which specifically binds to uPARAP. The method for treating ulcers (Claim 6) and the fact that the compound such as a peptide-protein or a low-molecular compound that specifically binds to uPARAP is an antibody that specifically recognizes the extracellular domain of uPARAP 7. The method for treating a tumor according to claim 6 (claim 7), and 11 to 81 and / or? A method for treating a tumor, which comprises administering a compound such as a peptide, a protein, or a low-molecular compound that specifically binds to ro-uPA to a tumor patient (Claim 8), and a method for treating uPARAP, uPAR and uPAR. And / or a method for treating a tumor, which comprises administering all or part of the antisense strand of DNA or RNA encoding Pro-u PA to a tumor patient (Claim 9), or wherein the tumor is a brain tumor A method for treating a tumor according to any one of claims 6 to 9 (claim 10).

Further, the present invention provides a diagnostic agent for tumors characterized by having a compound such as a peptide / protein, a low molecular weight compound, etc. that specifically binds to uPARAP (claim 11), The compound according to claim 11, wherein the compound such as a peptide / protein or a low molecular weight compound that specifically binds to ARAP is an antibody that specifically recognizes an extracellular domain of uPARAP. A tumor diagnostic agent (Claim 12) or a tumor characterized by having a compound such as a peptide / protein or a low-molecular compound that specifically binds to uPAR and / or Pro-uPA. A diagnostic agent (Claim 13) or a diagnostic agent for a tumor characterized by having all or a part of the antisense chain of DNA or RNA encoding uPARAP, uPAR and Z or Pro-uPA (Claim 13). (14) The tumor according to any one of (11) to (14), wherein the tumor is a brain tumor. Diagnostic reagent (Claim 15), RNA extract, cDNA and RNA synthase, DNA chip or oligonucleotide chip or protein chip, probe, uPARAP amplification primer, anti-uPARAP antibody Diagnostic kit for brain tumors Claim 16), and a tumor diagnostic kit according to claim 16 (claim 17), wherein the tumor is a brain tumor, or an expression vector containing the uPARAP gene was introduced. A method for screening an antitumor agent, which comprises culturing cells in the presence of a test substance and measuring and evaluating the degree of expression and / or reduction in function of uPARAP (Claim 18). It is necessary to contact Pro-uPA in the presence of a test substance with cells that co-express ARAP and uPAR on the membrane surface, and measure and evaluate the degree of binding of Pro-uPA and uPAR. The method for screening a characteristic antitumor agent (Claim 19) and the method of contacting uPARAP or a part thereof with a test substance and determining the degree of the binding strength of the test substance to uPARAP. A screening method for an antitumor agent characterized by performing measurement and evaluation (Claim 20); and a method wherein the antitumor agent is an anti-brain tumor agent. A method for screening an antitumor agent according to any one of claims 18 to 20 (claim 21). BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 is a diagram showing the results of Gene Chip analysis of a group of genes expressed in human brain tumors.

FIG. 2 shows the results of EST screening of 16 genes highly expressed in human brain tumors.

FIG. 3 shows the results of RT-PCR for detecting the expression of uPARAP.

FIG. 4 is a diagram showing the results of quantitative PCR analysis of u PARAP. FIG. 5 shows the results of quantitative PCR analysis of uPARAP. BEST MODE FOR CARRYING OUT THE INVENTION

Expression levels differ from non-cancerous areas in brain tumor tissues removed from brain tumor patients Can be obtained by comparing brain tumor tissue with non-cancerous brain tissue. First, the average of the expression levels of each gene and protein in non-cancerous brain tissues provided by a plurality of patients is obtained. Next, the average expression level of each gene or protein is compared with the expression level of each gene or protein in the brain tumor tissue of each patient. Select the gene or protein that you have. Also, genes whose expression is enhanced in brain tumor tissue can be ranked according to the degree of difference in expression from normal tissue. Gene expression in brain tumor tissues and non-cancerous tissues can be analyzed by RNA expression levels or protein expression levels.In many cases, RNA and protein expression levels can be analyzed by DNA microarray, RT-PCR, Northern blotting, Rnase protection assay, Western blotting, ELISA, ELISA, protein array, etc. can be measured using well-known methods, such as chemiluminescence with fluorescein perodamine, luminol or ³ This is done by measuring the radiation and optical density of radioactive isotopes such as H ¹⁴ C, ³⁵ S, ³³ P, ³² P, and ¹²⁵ I. The knowledge on genes and proteins whose expression was particularly enhanced in brain tumor tissues obtained by such a method leads to the therapeutic and diagnostic agents for tumors such as brain tumors of the present invention.

The therapeutic agent for tumors such as brain tumors of the present invention is particularly limited as long as it contains as an active ingredient a compound such as a peptide / protein or a low molecular weight compound that specifically binds to uPARAP. However, compounds that specifically bind to uPARAP, such as peptide proteins and low molecular weight compounds, include proteins that specifically recognize the extracellular domain of uPARAP, collagen V, lectin, and N. —Acetyldarcosamine, glycoprotein, matrix meta-oral protease, natural compounds produced by Actinomycetes mold, synthetic compounds, and derivatives thereof. Ma The therapeutic agents for tumors such as brain tumors of the present invention include 11-8 and 7 or? ro-u There is no particular limitation as long as it contains a compound that specifically binds to PA, such as a peptide, protein, or a low molecular weight compound, as an active ingredient. uPAR and / or Pro-u Examples of compounds such as peptide proteins and low molecular weight compounds that specifically bind to PA include antibodies specifically recognizing uPAR and Pro-uPA. Furthermore, the therapeutic agent for tumors such as brain tumors of the present invention includes, as an active ingredient, all or part of the antisense strand of DNA or RNA encoding uPARAP, uPAR and Z or Pro-uPA. There is no particular limitation as long as the antisense strand is entirely or partially incorporated into a vector or the like.

Examples of antibodies specifically recognizing the extracellular domain of uPAR AP, and antibodies specifically recognizing uPAR and Pr0-uPA include monoclonal antibodies, polyclonal antibodies, and single chains. Examples include an antibody, a humanized antibody, a chimeric antibody, and a bifunctional antibody capable of simultaneously recognizing two epitopes. These antibodies express proteins such as uPARAP or fragments, analogs containing utopips, or uPARAP or the like on the membrane surface in animals (preferably other than humans) using a conventional protocol. It is produced by administering cells, for example, the preparation of monoclonal antibodies includes the hybridoma method (Nature 256, 495-497, 1975), the Trio-1 method, which results in antibodies produced by continuous cell line cultures. Method, human B cell hybridoma method (Immunology Today 4, 72, 1983) and EBV—hybridoma method (MONOCLONAL ANTIBODIES AND CANCER THERAPY, pp.77-96, Alan R.Liss, Inc., 1985) ) Can be used.

In order to produce single-chain antibodies, a method for preparing single-chain antibodies (US Patent No. No. 4,946,778, U.S. Pat. No. 5,260,203, U.S. Pat. No. 5,091,513, and U.S. Pat. No. 5,455,030) can be used to prepare a humanized antibody. IB Patent No. 5,585,089, Nature, 321, 522-525, 1986, Protein Engineering, 4, 773-783, 1991) can be used. U.S. Patent No. 4,816,567, Science, 229, 1202-1207, 1985, BioTechniques, 4, 214, 1986, Nature, 312, 643-646, 1984, Nature, 314, 268.270, 1985). it can. Bifunctional antibodies can be produced by hybridizing two monoclonal cell lines that produce two related antibodies, or by chemical conjugation of fragments of two antibodies; ! ? Eight eight? When! ! And bifunctional antibodies capable of binding to Hakushaku at the same time.

Similarly to the above-mentioned antibodies, Fab fragments and F (ab ') ₂ fragments of the above antibodies are exemplified as compounds such as peptides and proteins and low molecular compounds that specifically bind to uPARAP and the like. be able to. For example, an F ab fragment can be prepared by treating an antibody with papain or the like, and an F (ab ') ₂ fragment can be prepared by treating it with vepsin or the like.

The method for treating a tumor such as a brain tumor of the present invention is not particularly limited as long as it is a method for administering a compound such as a peptide, a protein, or a low-molecular compound specifically binding to uPARAP to a patient with a brain tumor. Rather, the above-mentioned antibodies specifically recognizing the extracellular domain of uPARAP are preferably exemplified as compounds such as peptides, proteins, and low molecular weight compounds that specifically bind to uPARAP. Can be. In addition, as a method for treating a tumor such as a brain tumor of the present invention, a compound such as a peptide / protein or a low-molecular compound specifically binding to uPAR and Z or Pro-uPA is administered to a brain tumor patient. The method is not particularly limited. Further, the therapeutic agent for tumors such as brain tumors of the present invention includes uPARAP, uPAR and / or Pr It is not particularly limited as long as it contains, as an active ingredient, all or part of the antisense strand of DNA or RNA encoding o-uPA, and all or one of these antisense strands. The part may be administered as it is, or may be administered in a form incorporated into a vector or the like.

When a therapeutic drug for a tumor such as a brain tumor of the present invention described above or an antitumor agent such as an anti-brain tumor drug obtained by the screening method of the present invention described below is used as a pharmaceutical, a normal pharmaceutically acceptable carrier, Compounding ingredients for various preparations such as binders, stabilizers, excipients, diluents, PH buffers, disintegrants, solubilizers, solubilizers, isotonic agents, etc. can be added. These therapeutic agents and anti-brain tumor agents can be administered orally or parenterally. That is, it can be orally administered in a commonly used dosage form, for example, a powder, granule, capsule, syrup, suspension, or the like, or, for example, a solution, emulsion, suspension, etc. It can be administered parenterally in the form of injections in the form of injections, or it can be administered intranasally in the form of sprays.

Examples of the diagnostic agent for tumors such as brain tumors of the present invention include peptides / proteins and low molecular weight compounds that specifically bind to uPARAP, such as the above-mentioned antibodies that specifically recognize the extracellular domain of uPARAP. Examples of the diagnostic agent for a tumor such as a brain tumor according to the present invention include a peptide 'protein, which specifically binds to uPAR and Z or Pro-uPA. Particularly, those having a compound such as a low molecular weight compound and those having all or a part of the antisense strand of DNA or RNA encoding uPARAP, uPAR and / or Pro-uPA described above. Without being limited thereto, such an antisense strand can be advantageously used as a probe for detecting and diagnosing a tumor such as a brain tumor. It is preferable to use a compound such as the antibody or the antisense strand which is usually labeled. Labeled substances can be detected alone or by reacting with other substances Substances capable of providing a possible signal, for example, enzymes, fluorescent substances, chemiluminescent substances, piotin, avidin or radioisotopes can be mentioned. Specifically, peroxidase (eg, horseradish peroxidase) ^ alkaline phosphatase, / 3-D-galactosidase, glucose oxidase, glucose-6-phosphate dehydrogenase, alcohol dehydrogenase, apple Enzymes such as acid dehydrogenase, benicillinase, ribonuclease, apoglucose oxidase, perease, luciferase or acetylcholinesterase, fluorescein isothiosinate, phycopyriprotein, rare earth metal chelate, Men Rukurorai de or fluorescent substances such as tetramethylrhodamine isothiocyanate Xia sulfonate, ³ H, ¹⁴ C, ¹ radioisotopes such as ^{2 5} I or ^{13 1} I, can be mentioned Pio Chin, avidin, or a chemiluminescent substance . The radioisotopes and fluorescent materials described above alone can provide a detectable signal. On the other hand, enzymes, chemiluminescent substances, biotin and avidin alone cannot produce a detectable signal, and thus can react with one or more other substances to produce a detectable signal. For example, in the case of an enzyme, at least a substrate is required, and various substrates are used depending on the method for measuring the enzyme activity (colorimetric method, fluorescent method, bioluminescent method, chemiluminescent method, etc.). In the case of biotin, the reaction is generally carried out using at least avidin or an enzyme-modified avidin (eg, streptavidin-β-galactosidase) as a substrate.

The diagnostic kit for tumors such as brain tumors of the present invention includes selected genes and proteins such as Northern blot, in situ hybridization, RNase protection assay, ゥ estrange blotting, ELISA, and RT-PCR. RNA extract needed to evaluate expression, c

0 GAPDH (glyceraldehyde) is not particularly limited as long as it has DNA and cRNA synthetase, DNA chip or oligonucleotide chip or protein chip, probe, primer for uPARAP amplification, and anti-uPARAP antibody. It is preferable that the primer also has a primer for amplifying a control gene such as a gene and an antibody against GAPDH or the like. Using such a brain tumor diagnosis kit of the present invention, it is possible to diagnose a brain tumor by examining the expression level of uPARAP gene or uPARAP in brain tissue, blood or other tissues.

As a method for screening a brain tumor agent of the present invention, cells into which an expression vector containing a uPARAP gene has been introduced are cultured in the presence of a test substance, and uPARAP expression and Z For example, a method for measuring and evaluating genes amplified by a uPARAP activation signal such as plasminogen activator, and the like, as well as testing cells that co-express uPARAP and uPAR on the membrane surface In the presence of a substance, Pro-uPA is contacted, and the degree of binding of Pro-uPA and uPAR is amplified by a uPARAP activation signal such as plasminogen activator. A method for measuring and evaluating a gene, a part of the extracellular domain of uPARAP or uPARAP, etc., is brought into contact with a test substance, and the degree of binding of the test substance to uPARAP, for example, Especially when measuring and evaluating the binding strength of a substance to uPARAP Examples of the above cells include, but are not limited to, bacterial prokaryotic cells such as Escherichia coli, Streptomyces, Bacillus subtilis, Streptococcus, and S. phylococcus; eukaryotic cells such as yeast and Aspergillus; Drosophila S2 and Spodoptera S f 9 insect cells, L cells, CHO cells, COS cells, HeLa cells, C127 cells, BAL BZc3T3 cells (deficient in dihydrofolate reductase and thymidine kinase HK21 cells, HEK293 cells, Bowes melanoma cells, oocyte and other animal and plant cells, and the like. The introduction of the resulting expression vector into cells is described in Davis et al. (BASIC METHODS IN MOLECULAR BIOLOGY, 1986) and Sambrook et al. (MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989). Methods described in many standard laboratory manuals, such as calcium phosphate transfection, DEAE-dextran-mediated transfection, transvection, microinjection, cationic lipid-mediated transfection , elect opening Poreshiyon, transduction, scrape Rohde queuing _(scra p _e loading),弹丸introduction (ballistic introduction), infection, etc. Can Shimesuru.

The gene amplified by the u PARAP activation signal can be measured by quantitative PCR. Quantitative PCR is a PCR that enables quantitative determination of the proportion of heterologous individuals in a biological population based on the amounts of amplification products of the target gene and the control gene. For example, PCR can be performed under reaction conditions that allow for quantitative measurement, the amplification product can be subjected to electrophoresis, and quantitative measurement can be achieved based on the intensity of the band corresponding to the amplification product. In order to more easily and accurately perform quantitative measurement, it is preferable to use a device for PCR (real-time (PCR) device) that enables quantitative measurement of an amplification product over time. As such a PCR apparatus, LightCyc1er (manufactured by Roche), ABIseqeuncceDetectorPRISM770 (manufactured by Pachinkin Elmer Biosystems), and the like are commercially available. As a method for performing real time PCR, the TadM an method (Patent No. 282559)

Two No. 6), a method using an inter force such as a hybridization method or Saipa Green I, and the like. Hereinafter, the present invention will be described more specifically with reference to examples, but the technical scope of the present invention is not limited to these examples.

Example 1 (Preparation of human brain tumor specimen)

Human brain tumor tissue and adjacent normal parts were collected from 11 patients who underwent surgical treatment at Keio University Hospital. Prior to surgery, informed consent was obtained from all patients in writing. The research protocol was approved by IRBHU of Keio University School of Medicine. Histological diagnosis of brain tumors in all patients was performed postoperatively, and those with a diagnosis of daloma were used as human brain tumor samples. The collected non-cancerous human brain tissue and brain tumor tissue are frozen in liquid nitrogen or acetone containing dry ice, embedded in an OCT compound if necessary, and used at temperatures between 70 ° C and -80 ° C. And used to identify genes or proteins whose expression was significantly enhanced in human brain tumors compared to non-cancerous brain tissue.

Example 2 (RNA extraction from tissue)

Tissue pieces (approximately 125 m ³ ) were disrupted by polytron in TRIZOL or Sepasol-RNAI (2 x 5 seconds at maximum speed). After addition of black-mouthed form, the mixture was centrifuged at 15,000 X g for 10 minutes to collect an aqueous layer containing RNA. Isopropyl alcohol to precipitate the total RNA using, 70% E evening Bruno - washed once with Le, which was dissolved in DEPC-treated H ₂ 0. DOO one Tal RNA was treated with 1.5 Yunitto of Dnase I, again, after the TRIZOLZ chloroform extracted, ethanol precipitated and suspended in DEPC-treated H ₂ 0. Then, using the neasy Mini Kit, low-molecular-weight nucleic acids were removed. Total RNA quality was determined from agarose gels by comparing the ratio of 28S and 18S ribosomal RNA. Confirmed in. The purified total RNA was stored in 70% ethanol at -80 ° C until use.

Example 3 (synthesis of cDNA and labeled cRNA)

cDNA synthesis was performed using the Superscript Choice System. Using 5 micrograms of purified total RNA and oligo dT primer having a T7 promoter sequence, react with 200 units of SuperScriptll reverse transcriptase at 42 V for 1 hour (1st Strand DN) After the synthesis of A, cDNA of the second strand was synthesized), extracted with phenol Z chloroform, and purified by Phase Lock Gel. Using the synthesized cDNA as a template, cDNA was synthesized using the MEGAscript T7 kit. Enzyme mix containing 2 microliters of T7 polymerase and 7.5 mM ATP, GTP and 5.6 2 51111 ^ , 11? And 1.875 mM Bio-11-CTP, Bio-16-UTP and cDNA were reacted at 37 degrees for 6 hours. Unreacted and short oligonucleotides were removed using CHROMA SPIN. The obtained RNA was recovered by ethanol precipitation. The quality of CRNA was confirmed by electroconductivity. The purified cDNA was stored at -80 degrees in 70% ethanol until use.

Example 4 (Gene expression analysis in cancer and non-cancer part of brain tumor patients)

Gene expression of primary tumors in brain tumor patients was tested using high-density oligonucleotide microarrays. For hybridization to the chip, transfer the cRNA to a solution of 40 mM Tris-acetate buffer (pH 8.1), 100 mM potassium acetate, 30 mM magnesium acetate at 95 ° C, 3 ° C. The reaction was performed for 5 minutes to perform fragmentation. Hybridization is 0.1 M MES pH6.7 (2-(N- Morpholino) ethanesulfonic acid), 1M NaCl, 0.01% Polyoxylene (lO) octylphenyl ether, in 200 i1 20 β g herring Sperm DNA, 100 g acetilui dani bovine serum This was performed at 45 ° C. for 12 hours on a sample containing albumin, 10 g of fragmented cRNA, and a biotinylated control oligonucleotide (biotin-5′-CTGAACGGTAGCATCTTGAC-3 ′). After washing the chip with 0.1 M MES pH 6.7, 0.1 M NaCl, 0.1% Polyoxylene (lO) octylphenyl ether buffer, and chip with biotinylated anti-streptavidin antibody After the reaction, the cells were treated with streptavidin R-phycoerythrin to amplify the signal. The fluorescence intensity of each pixel was measured with a laser scanner (GeneArray Scanner G2500A) manufactured by HP, and the expression intensity and reliability (Present Z Absent Call) were calculated using Affymetrix software Microarray Suite ver. 4.0. In this experiment, the expression of about 11,000 genes in human brain tumor patients was measured.

Example 5 (Gene Chip analysis)

Gene Chip analysis was performed to identify different (expressed) gene groups in tumor tissues and adjacent normal tissues. Considering the sensitivity of the (oligo) DNA chip, those with an average difference (corresponding to the expression level) of 20 or less were raised to 20. The average of the average difference of three human normal brain tissues was determined for each gene, and the average value was compared with the average difference of 11 human brain tumor tissues. In all of the 11 samples of brain tumor tissue, genes were selected whose expression level (ratio of average difference) was at least three times higher than the average of normal brain tissue. As a result, gmtamate pyruvate transamidase (GPT), Homo oapiens Clone 23933 (Human Clone 23933), G protein-coupled receptor (EDG4), Nucleoplasmin-3 (NPM 3), vascular cell adhesion molecule-1 (VCAM1), KIAA 0197 (NUP160), DKFZp5886E0518 (BAZ1A), SWI / SNF complex 1555 Kda subunit (BAF155) (SMARC CI ), BAC Clone RG158017 (CAPRI),

Five Inter-alpha-trypsin inhibitor heavy chain HI (ITIHl), GM2 activator (GM2A), KIAA0709 (uPARAP) wild-type p53 activated fragment-1 (WAF1), NFKB human nuclear factor kappa'B DNA Binding Subunit (NF-kappa-B), death adapter molecule RAIDD

(RAIDD), 16 genes of Tenascin C were selected.

Example 6 (EST screening)

Next, using the EST database, EDG4, GM2A, SMARC Cl, WAF1, uPARAP, Human Clone 23933, NF-kappa-B, NPM3, CAPRL RAIDD NUP160, GPT, ITIHl, VCAM 1 A part of the screening results obtained by performing a homology search based on the sequence information of 16 genes, BAZ1A and Tenascin C, and summing up tissues and cells with homologous ESTs Is shown in FIG. In FIG. 2, since “undifferentiated tissue” can be regarded as a tumor cell, the larger the “undifferentiated tissue / total,” the higher the expression of the gene in the tumor cell, and the more the “undifferentiated tissue”. The larger the “/ Normal brain”, the higher the gene expressed in brain tumors. Table 1 shows the above 16 genes according to the size of “undifferentiated tissue / totalJ” and “undifferentiated tissue / normal brain”.

(Table 1) _ Undifferentiated tissue otal> 0.3> 0.2> 0.1

Undifferentiated tissue / Normal braHT- ~~--One ~~~~~ ——

> 3 3,4,5, 8, 16 7, 11, 13, 15 10

> 2 2 14

> 1 9 1, 6, 12 Example 7 (RT—PCR for detecting uPARAP expression)

Next, the expression specificity of uPARAP (Endo 180) gene in normal tissues, various cell lines, daloma cell lines and tissues, and other tumor cell lines

6 The properties were examined by the RT-PCR method. Brain, heart, lung, stomach, small intestine, colon, liver, spleen, kidney, testis, placenta, muscle Normal RNAs (all purchased from Clonetech), fibroblasts, 1088 EBV-B (Human B cells), 1362 TIL (Human tumor infiltrating T cells), 293 UT (Human kidney cells), RNA from four cell lines, four Dario cell lines (U87 MG, RNAs derived from T98G, GI1, U2251) and four daloma tissues (GB13, GB17, GB16, GB4) and a melanoma cell line (S Km e 123, 624m e 1), renal cell carcinoma cell line (RCC 7, Saito), lung cancer cell line (LU99, EBC 1), 塍 cancer cell line (KU7), prostate cancer cell line (PC 3 ) And leukemia cell lines (HL60, Molt4) were isolated using total RNA from TrizoKGibco BRL. Using 10 g of this total RNA in each case, using avian myeloblast virus reverse transcriptase XL (manufactured by TAKARA) and oligo (dT) as a primer, a total reaction volume of 100 g was used. In steps 1 and 42, a panel of cDNA that becomes the type II RT-PCR was prepared.

u For detection of PARAP, (5,1 GAGCA ACAGCGGGCT ATGG_3 ;; SEQ ID NO: 1) is used as a sense primer and (5′- SEQ ID No. 2) was used as a control primer for detecting GAPDH as a control (5′—TGAACGGGAAGCTCACTGG—3 ′; SEQ ID No. 3) and an antisense primer (5′—TCCACCACCCTGTTGCTGTA—3). SEQ ID NO: 4) 0.5 l of the cDNA template was mixed with 2 l of dNTP (de) in a 25 1 reaction solution obtained by diluting 2.51 of the PCR buffer 10-fold. Amplification was carried out using the following primers: oxyliponucleotide triphosphate), 0.15 EXT aq (TAKARA), and 0.5 H1 primers. (Perkin-Elmer), u PARA P was first heat denatured at 94.0 for 4 minutes, then heat denatured at 94.0 "Ό for 1 minute, and then annealed at 62.2 ° C for 1 minute. The cycle of elongation at 72.0 ° C for 1 minute was repeated for 30 cycles, and GAPDH was first heat denatured at 94.0 ° C for 4 minutes, and then 94.0 ° C. Twenty-five cycles were repeated, with heat denaturation for 1 minute at C, annealing for 1 minute at 58, and extension reaction at 72.0 ° C for 1 minute. After electrophoresis (2.0%), the cells were stained with ethidium bromide (EtBr), and the band was detected by ultraviolet irradiation.The results of RT-PCR are shown in Fig. 3. As shown in Fig. 3, In addition, uPARAP, U87MG, T98G (human darioma cell line), GB13, GB17, GB4 (darioma tissue), renal cell carcinoma cell line ( RCC 7), Lung cancer cell line (LU99), Leukemia cell line (HL60), 1362 TIL (human tumor infiltrating T cells) and expression in testis, fibroblasts, small intestine and lung The expression in the small intestine and lung is thought to be due to mixed fibroblasts and macrophages, suggesting that the uPARAP gene is useful as a diagnostic agent for tumors, especially brain tumors. .

Example 8 (Quantitative PCR analysis of uPARAP)

Analysis using real-time quantitative PCR is a quantitative method based on kinetic analysis in an exponential amplification region where a proportional relationship is established between the amount of target mRNA and the amount of PCR product. The differences in qualitative and reverse transcription efficiencies among samples that occur during RNA preparation are one of the factors in real-time quantitative PCR.Therefore, it is always a constant level to standardize these variations against the relative amount of target mRNA. Expressed GAP DH was used as a standard. Using the synthesized cDNA 11 as a template, a mixture of 51 SYBR Green (a dye that specifically binds and emits light to double-stranded DNA) and 41 dNTP

8 Things, the Mg C l _2, 0.5 l of Amp Ei'ase, 0. 2 5/2 1 of Ampli Taq Gold, PCR with the 0.5 1 of containing primer one 5 0 1 of the reaction system went. As u-PARAP and GAP DH amplification primers, the same primers as in RT-PCR were used. PCR was performed at 50 ° C for 2 minutes, 95 ° C for 10 minutes, and 9515 seconds and 65 ° C for 1 minute under the conditions of 45 cycles. Since the increase in SYBR Green fluorescence is proportional to the DNA concentration, the amount of PCR product was measured and an amplification curve was plotted against the number of cycles.

The relative expression levels of uPARAP in each tissue and cell relative to normal brain are shown in FIGS. u relative expression amount of P AR AP (Fig. 4 and FIG. 5 of the u PARAP R e 1.) can be determined by the ^2- ΔΔ ^{c τ.} △△. _Τ = Δ Ο _ΤΑ -AC _T B ^ A: Comparative sample; B: Reference sample; AC _T = (threshold cycle for uPARAP amplification, uPARAP value in Figs. 4 and 5) 1 (threshold cycle for GAPDH amplification) , GAP DH values in Figures 4 and 5). Further, u P ARAP R e 1 to the brain of the testis example in Figure 4. May be obtained by the following _{_{calculation, AC T. TESTIS = 3 8.}} 2 9- 2 0. 8 5 = 1 7. 4 4 _{_{_{, AC T BRAI n = 4 1}}} 5 6 - 1 8. 6 1 = 2 2 9 5, ΔΔ C Τ = Δ C T TEST;..... S - △ CT bra i n = 1 7 · 44 ~ 2 ^2.95 = ^-5.5 1, 2- ^ΔΔετ = ²⁵ · ^{5 1} = ^45.5 8 Industrial applicability

According to the present invention, it is possible to compare gene expression in non-cancerous part brain tissue and brain tumor tissue, and to select a group of genes whose expression is significantly changed in the cancerous part. It will be possible to search for therapeutic drugs and create diagnostic drugs.

Claims

The scope of the claims

1. A therapeutic agent for tumors, comprising as an active ingredient a compound such as a peptide, protein, or low-molecular compound that specifically binds to uPARAP.

2. The compound according to claim 1, wherein the compound such as a peptide, a protein, or a small molecule that specifically binds to uPARAP is an antibody that specifically recognizes an extracellular domain of uPARAP. Remedies for tumors.

3. A therapeutic agent for tumors, comprising as an active ingredient a compound such as a peptide / protein or a low molecular weight compound which specifically binds to uPAR and Pro-uPA.

4. A therapeutic agent for tumors, comprising as an active ingredient all or part of the antisense strand of DNA or RNA encoding uPARAP, uPAR and / or Pro-uPA.

5. The therapeutic agent for a tumor according to any one of claims 1 to 4, wherein the tumor is a brain tumor.

6. A method for treating tumor characterized by administering a compound such as a peptide, protein, or low-molecular compound that specifically binds to uPARAP to a tumor patient <

7. The compound that specifically binds to uPARAP, such as a peptide, protein, or low molecular weight compound, is an antibody that specifically recognizes the extracellular domain of uPARAP. The method for treating a tumor according to the above.

8. A method for treating a tumor, which comprises administering a compound such as a peptide, a protein, or a low-molecular compound that specifically binds to uPAR and / or Pro-uPA to a tumor patient.

9. Administer all or part of the antisense strand of DNA or RNA encoding uPARAP, uPAR and / or Pro-uPA to tumor patients A method for treating a tumor, comprising:

10. The method for treating a tumor according to any one of claims 6 to 9, wherein the tumor is a brain tumor.

1 1. A diagnostic agent for tumors, characterized by having compounds such as peptides, proteins, and low-molecular compounds that specifically bind to uPARAP.

12. The compound, such as a peptide, protein, or low molecular weight compound, that specifically binds to uPARAP, is an antibody that specifically recognizes the extracellular domain of uPARAP. The diagnostic agent of the tumor according to the above.

1 3. A diagnostic agent for a tumor characterized by having a compound such as a peptide / protein or a low molecular weight compound which specifically binds to uPAR and Z or Pro-uPA.

1 4. A diagnostic agent for a tumor characterized by having all or a part of the antisense strand of DNA or RNA encoding uPARAP, uPAR and Z or Pro_uPA.

1 5. The diagnostic agent for a tumor according to any one of claims 11 to 14, wherein the tumor is a brain tumor.

1 6. Equipped with RNA extract, cDNA and cRNA synthetase, DNA chip or oligonucleotide chip or protein chip, probe, primer for uPARAP amplification, anti-uPARAP antibody A diagnostic kit for brain tumors characterized by

17. The tumor diagnostic kit according to claim 16, wherein the tumor is a brain tumor.

1 8. The cells into which the expression vector containing the uPARAP gene has been introduced are cultured in the presence of the test substance, and the degree of reduction and expression of uPARAP expression and / or function is measured and evaluated. A method for screening an antitumor agent.

1 9. The test substance was added to cells that co-expressed uPARAP and uPAR on the membrane surface.

Two A method for screening an antitumor agent, which comprises contacting Pr0-uPA in the presence of, and measuring and evaluating the degree of binding of Pro_uPA to uPAR.

20. A method for screening an antitumor agent, which comprises contacting uPARAP or a part thereof with a test substance and measuring and evaluating the degree of binding of the test substance to uPARAP.

21. The method for screening an antitumor agent according to any one of claims 18 to 20, wherein the antitumor agent is a brain brain tumor agent.