RU2286385C2 - RECOMBINANT POLYNUCLEOTIDE SEQUENCE CHARACTERIZING UNIQUE TRANSFORMATION ACT BETWEEN GENETIC CONSTRUCT INCLUDING cryIIIa GENE, AND GENOMIC DNA OF GENUS ELIZAVETA POTATO, USES THEREOF, TRANSGENIC PLANT AND GENERATION THEREOF - Google Patents

Abstract

FIELD: gene engineering, in particular production of transgenic potato with Colorado beetle resistance and biological and food safety.

SUBSTANCE: recombinant polynucleotide sequence of general formula X-A, wherein X is part of nucleotide sequence of introduced genetic construct representing in SEQ ID N 1; A is nucleotide sequence of flanking site of genomic DNA of genus Elizaveta potato, representing in SEQ ID N 2 is constructed; plant cell producing of cryIIIa protein and containing recombinant polynucleotide sequence, as well as potato transgenic plant and vegetative generation thereof with Colorado beetle resistance are obtained. Polynucleotide sequence is used in identification of plant cell producing of cryIIIa protein, plant and vegetative generation.

EFFECT: new potato genus with Colorado beetle resistance.

6 cl, 6 dwg, 7 tbl, 7 ex

Description

The present invention relates to the field of genetic engineering and plant biotechnology and is associated with the production and identification of transgenic potato resistant to the Colorado potato beetle based on one of the new promising Russian varieties. The results of the implementation of this invention can be used in agriculture, food industry and many other areas of the economy using potatoes as raw materials.

The damage caused to potato crops by the Colorado potato beetle (Leptinotarsa decemlineata, Say) is estimated at 18% of the potential yield for large state potato producers and from 40% to 90% for private producers, which, according to expert estimates of the Ministry of Agriculture of the Russian Federation, account for 90% of the total harvesting potatoes in the Russian Federation. Various (mechanical, chemical and biological) methods are used to control this pest in crop production, however, most mechanical methods do not give the desired result, and the use of chemical agents, as a rule, has an adverse effect on the environment, since pesticides usually do not have a selective effect and equally affect both harmful and beneficial entomofauna, and are often a source of potential carcinogens and toxins with a wide spectrum of action. The most promising today is the solution to this problem using biological methods of plant protection, especially genetic engineering methods aimed at obtaining transgenic plants, in the cells of which a foreign protein is expressed that ensures plant resistance to the Colorado potato beetle, in particular, the endotoxin Bacillus thuringiensis.

State of the art

Bacillus thuringiensis is a gram-positive spore-forming bacterium found in nature in various habitats: in soil, on the surface of plants, plant debris. B.t. can be distinguished from other species of the genus Bacillus by the presence of protein crystals formed during sporulation, due to which B.t. are effective natural insecticides. Such a crystal may consist of one or more proteins with a molecular weight of approximately 130 kDa.

An important feature of crystalline Bt protein is that its insecticidal effect appears only in the insect organism, where under the action of specific enzymes of the intestinal tract it decomposes with the formation of protoxin, from the N-terminus of which a fragment of 65-70 kDa is then cleaved and forms toxic to the insect polypeptide (δ-endotoxin Bt). The toxin recognizes specific receptors on the cell membrane of epithelial cells and forms pores in it, which leads to osmotic lysis and cell death [1].

δ-endotoxin B.t. is a representative of a large family of homologous proteins (Cry-protein family), which to date have identified more than 130 species [http://epunix.biols.susx.ac.uk/Home/Neil_Crickmore/Bt/index.html].

Moreover, each representative of Cry-proteins is active only against several species of insects. The specificity of the action is due to the fact that each specific protein is able to interact only with a receptor of a certain type, but there is evidence that the solubility of the crystal also plays a significant role [2]. Members of the Cry protein family are grouped into subfamilies according to their specificity for different insect families. Thus, subfamilies of proteins toxic to Diptera (Diptera), Lepidoptera (Lepidoptera), Coleoptera (Coleoptera) have been identified [3]. Some B.t. strains are active against representatives of other groups of insects, as well as representatives of roundworms - nematodes and protozoa [4].

Pt derivatives of Bt protein began to be used as insecticides in the thirties of the last century, but they became widespread only with the beginning of the production of the Thuricide drug in 1950 [5]. Despite the reputation of being environmentally friendly, Bt-protein-based biologics have not been widely used due to a number of disadvantages, which include the following:

low stability;

surface action (impossibility of penetration into plant tissues);

narrow specificity.

Crystalline protein is rapidly destroyed by ultraviolet radiation and loses its activity, therefore, in order to achieve an economically significant effect, several treatments are required. Biological products based on Bt-protein are non-systemic insecticides and act only upon direct contact, and therefore are not active against "mining" insects. Since crops are usually attacked by not just one, but several types of insect pests, using one type of Cry protein may not be enough to control them.

The first two problems can be solved by creating transgenic plants expressing a specific type of Cry protein. In such plants, the amount of toxin is constantly renewed, it is present at a constant level in all tissues, and therefore provides protection from "mining" insects. The problem of narrow specificity can be solved by the simultaneous expression of several Cry proteins with a different spectrum of action.

To date, more than 100 genes encoding proteins toxic to insects, including beetles, have been isolated and characterized from strains of the bacterium Bacillus thuringiensis: cryIII, cryVII, cryIX [6]. By replacing bacterial codons with codons preferred for expression in plants, the sequences of bacterial genes are adapted to be introduced into plant cells and used to transform various types of cultivated plants, such as potatoes [7], rape [8], rice [9], eggplant [10] ].

The result of these works was the receipt of many genetically modified lines of cultivated plants, but only a few of them are officially approved for food use [11].

This is due to the fact that the established practice of commercializing each new transgenic plant provides for the implementation of a number of necessary studies, during which the degree of biological and food safety of a genetically modified organism is revealed. Only transgenic lines (transformational events) that successfully pass such control can be registered as a commercial product.

In addition, when using genetically modified lines of various cultivated plants, there is a problem of clear post-registration monitoring, which suggests the need for unambiguous identification of a specific transformation event both in transgenic plants and in food products obtained from them [12, 13, 14, 15, 16, 17] .

Given the high species and varietal polymorphism of the genome of cultivated plants and the fact that the number of places of incorporation of an exogenous genetic construct into the recipient's genome is estimated to be more than 10,000, the most reliable way to identify a transformation event is to determine the nucleotide sequence of endogenous regions directly adjacent to the genetic construct introduced into the genome (flanking sequences) and subsequent detection of these sequences in the genome plants [18].

Obviously, the success of developments related to the production of transgenic plants is largely determined by the properties of the recipient. In this regard, its ability to regenerate and transform is very important, however, when creating genetically modified lines of cultivated plants, the agrotechnical indicators of the original variety must be taken into account.

The main regions of the Russian Federation cultivating potatoes are characterized by a wide variety of agroclimatic conditions. Currently, the State Register of Breeding Achievements of the Russian Federation contains a wide variety of potato varieties capable of producing stable and high yields in various soil and climatic conditions. Of particular practical importance is the correct selection of varieties, taking into account the length of the growing season, necessary for their full ripening. In the main areas of commodity potato growing in Russia, late varieties (as a rule, foreign breeding) usually do not have time to ripen, as a result of which tubers are severely damaged during harvesting and poorly stored [19].

In this regard, the work of the Center for Bioengineering of the Russian Academy of Sciences aimed at obtaining transgenic potatoes is carried out on the basis of the best varieties of domestic selection, and the present invention, which was carried out within the framework of this direction, is related to the production of a genetically modified potato equipped with a reliable identifier that is resistant to the Colorado potato beetle seems to be very relevant and promising for the development of domestic potato growing.

Disclosure of the invention .

The objective of the present invention was to obtain transgenic potato resistant to the Colorado potato beetle and meeting the conditions of biological and food safety, based on a promising domestic potato variety, as well as the development of a reliable means for identifying the corresponding transformation event in the genome of a transgenic plant and its vegetative offspring.

Given that most commercial potato varieties, including the main Russian varieties, are difficult to transform, and even if the transformation act is carried out, the probability of a transformation event is in which the expression level of the introduced gene is sufficient for the manifestation of the corresponding phenotypic trait, and the expression of endogenous plant genes is not disturbed, it is very small, obtaining a positive result when solving the problem was not an obvious fact.

However, as a result of tests in which eight of the most common cultivars of Russian selection cultivated in Russia were used as recipients, the applicant obtained genetically modified lines of potato resistant to the Colorado potato beetle based on the Elizaveta variety. One of these lines (2904 kgf) is currently undergoing registration with the State Commission for Testing and Protection of Breeding Achievements as the variety Elizabeth plus, breeding number 2904 kgf.

The pPBt12 binary vector including the cryIIIa gene was used as a transforming agent in the preparation of the transgenic potato according to the invention. The vector structure is shown in FIG. one.

Since the transformation process is genotype-dependent, the transformation of the Elizabeth potato cultivar was carried out in accordance with a protocol optimized in advance for this particular cultivar [20]. At the same time, the regeneration efficiency (percentage of the number of regenerants obtained to the total number of explants used in the experiment) was 78.4%, and the transformation efficiency (percentage of primary transformants to the total number of regenerants) according to the results of testing the regenerants DNA in the PCR reaction to the cryIIIa gene content ( transgene) was 9.3%.

When solving the problem of creating a reliable "identifier" obtained within the framework of this invention of transgenic potatoes, the applicants were guided by the idea of the uniqueness of a transformation event (a strictly defined combination of exogenous and genomic DNA) that determined a new plant phenotype. To identify a polynucleotide sequence that could act as an “identifier” of a unique transformational event, which resulted in the production of a genetically modified potato line of 2904 kgf, an inverse PCR protocol was created using specific primers determined based on the analysis of the nucleotide sequence of the transferred genetic construct and allowing to amplify DNA fragments of a transgenic plant related to the region of its incorporation into the gene hydrochloric DNA. After obtaining and isolation of the amplified fragments, their nucleotide sequences were determined. The fragment that is a combination of an exogenous sequence including a segment of the transferred synthetic construct and the adjacent (flanking) sequence of Elizabeth’s potato genomic DNA (Fig. 1) was recognized as optimal for performing the role of an “identifier” of the transgenic potato according to the invention (line 2904 kgf). 3).

The polynucleotide sequence of the "identifying fragment" selected by us can be described by the general formula X - A, where

- X - part of the nucleotide sequence of the introduced genetic constructs with SEQ ID No. 1, and

- A is the nucleotide sequence of the flanking portion of the genomic DNA of potato cultivar Elizabeth with SEQ ID NO.2

Based on the established nucleotide sequences of PCR fragments of transgenic potato genomic DNA, an improved identification reaction protocol is proposed in which obtaining a PCR fragment of 277 nucleotides in length with the sequence corresponding to the sequence SEQ ID No. 1 + SEQ ID No. 2 is possible only if test genomic DNA refers to the transformation event of the invention.

Thus, the present invention is a group of technical solutions, united by a common inventive concept.

The first object of the invention is a recombinant polynucleotide sequence that characterizes a unique transformational act between a genetic construct including the cryIIIa gene and genomic DNA of potato cultivar Elizabeth, which ensures the expression of the gene at a level sufficient for a plant to show resistance to the Colorado potato beetle, with the general formula X- A, where X is the part of the nucleotide sequence of the introduced genetic construct corresponding to SEQ ID No. 1, and A is the nucleotide sequence of the flanking about the plot of genomic DNA of potato cultivar Elizabeth, corresponding to SEQ ID No. 2.

The second object of the invention is a cell of a potato plant producing CryIIIa protein, which contains a recombinant polynucleotide sequence with the general formula X-A, where X is the part of the nucleotide sequence of the introduced genetic construct corresponding to SEQ ID No. 1, and A is the nucleotide sequence of the flanking portion of the potato genomic DNA Elizabeth, corresponding to SEQ ID№2.

The third object of the invention is a plant resistant to Colorado potato beetle transgenic potato containing cells that include a recombinant polynucleotide sequence with the General formula XA, where X is the part of the nucleotide sequence of the introduced genetic constructs corresponding to SEQ ID No. 1, and A is the nucleotide sequence of the flanking site genomic DNA of potato cultivar Elizabeth, corresponding to SEQ ID No. 2.

The fourth object of the invention is the totality of the descendants of a plant resistant to the Colorado potato beetle of transgenic potato that has preserved the geneotypic trait of the parent organism for several generations, controlled by the presence in the genome of a recombinant polynucleotide sequence with the general formula XA, where X is the part of the nucleotide sequence of the introduced genetic construct corresponding to SEQ ID No. 1, and A is the nucleotide sequence of the flanking region of the genomic DNA of potato cultivar Elizabeth, corresponding to SEQ ID No. 2.

The fifth object of the invention is the use of a recombinant polynucleotide sequence with the general formula X-A, where X is the part of the nucleotide sequence of the introduced genetic construct corresponding to SEQ ID No. 1, and A is the nucleotide sequence of the flanking region of the genomic DNA of potato cultivar Elizabeth, corresponding to SEQ ID No. 2, to identify genetically modified plant cells and the totality of its vegetative descendants according to the invention.

The technical result of the present invention is to obtain a derivative from the domestic variety Elizabeth of an industrially applicable line of 2904 kgf transgenic potato resistant to the Colorado potato beetle, provided with a reliable means of its genetic identification.

A brief description of the drawings (list of graphic materials).

FIG. 1 is a diagram of the basic genetic elements of the transformation vector pPBt12.

FIG. 2 is a diagram of the transformation of potatoes.

FIG. 3 - scheme for obtaining a unique PCR - transgenic line identifier.

FIG. 4 - the result of PCR with the primer system pR1-pR2 on DNA of transformed potato lines.

FIG. 5 - the result of inverse PCR on DNA of the transgenic line 2904 kgf.

FIG. 6 - the result of the identification PCR on various lines of potatoes.

The implementation of the invention.

Example 1. Transformation of potato plants of the Elizabeth variety.

The culture of the source plants.

The original plants of the variety Elizabeth, free of viral and viroid infection in the amount of 100 pcs. cultivated under aseptic conditions in an in vitro culture. For this, the stems of the initial plants were cut into cuttings with one axillary bud and cultivated in vegetation vessels on a nutrient medium containing mineral salts and vitamins (MSbase medium, Table 1), at a temperature of +18 - 21 ° С ± 1 ° С in daytime and +15 - 18 ° С ± 1 ° С at night and photoperiodicity 16 hours day / 8 hours night (illumination 120 μE) 3 - 5 weeks.

For plant transformation, we used the Agrobacterium tumefaciens GV strain containing the plasmid pPBt12, the expression cassette of which includes the FMV promoter, HSP70 + CTP enhancer, synthetic analogue of the CP4 gene, the E9 terminator, the SSU1A promoter, the cryIIIa gene and the NOS terminator combined in the genetic construct as shown in FIG. one.

The preparation of the strain.

The preparation of A. tumefaciens GV strain was carried out as follows. A. tumefaciens GV strain was seeded, streaked onto LB growth medium (Table 4), containing selective antibiotics streptomycin, spectinomycin and kanamycin at a concentration of 50 mg / L each, chloramphenicol at a concentration of 25 mg / L, for 3 ± 0.5 days a darkness at + 26 ± 1 ° C.

Two days before the planned transformation, the first (I) nocturnal culture of A. tumefaciens GV strain of 6 ml ± 0.2 volume was seeded with a colony mixture in LB growth medium (Table 4) containing selective antibiotics streptomycin, spectinomycin and kanamycin at a concentration of 50 mg / l of each, chloramphenicol at a concentration of 25 mg / l at + 26 ° C ± 1 ° C, 100-140 ± 10 rpm.

The day before co-cultivation, a second (II) overnight culture of 6 ± 1 ml was seeded. For this, LB was added to the nutrient medium (Table 4) containing selective antibiotics streptomycin, spectinomycin and kanamycin at a concentration of 50 mg / L each, chloramphenicol at a concentration of 25 mg / L, night culture I in an amount of 1/100 of the final volume. Cultured at + 26 ° C ± 1 ° C and 100-140 ± 10 rpm

Recultivation was carried out, for which the stem was cut into segments without axillary buds 5-10 ± 2 mm long. Petri dishes were poured with a small amount (4-5 ± 1 ml) of culture medium (CIM medium, Table 1) and covered with two sterile paper filters on top of them. Explants obtained from 100 source plants, in the amount of 602 pieces, were laid on top of filters for recultivation for 24 ± 4 hours at 18-21 ± 1 ° C.

First day of transformation

The overnight culture of A. tumefaciens strain was diluted 5-7 times with CIM liquid medium. 2. To carry out the co-cultivation step, a diluted suspension of the strain (0.2-0.5 ± 0.05 ml) was applied uniformly over the surface of the agarized nutrient medium, for which filters with explants were carefully removed and then returned over the applied suspension, the explants were laid out on a wet filter for co-cultivation for 48 ± 4 hours at 16-20 ° С ± 1 ° С.

In the control variant, instead of the suspension of A. tumefaciens GV strain, the same amount of liquid nutrient medium was used (CM medium, Table 1).

After the cocultivation phase, the explants were washed according to the following scheme.

Explants were placed in a solution (25 ± 10 ml) containing a liquid medium (SM medium, Table 1) and a solution of the antibiotic carbenicillin (500 mg / L), which suppressed the development of the A. tumefaciens GV strain, and was washed using a rotary shaker (shaker) at 50-70 ± 10 rpm for 30 ± 10 minutes at room temperature (18-20 ° C).

Third day of transformation

After co-cultivation (including the washing step), the explants were placed on a nutrient medium (CIM medium, Table 1) to initiate callus formation.

Used in a nutrient medium to initiate callus formation, zeatin at a concentration of 1.0 ± 0.01 mg / L, BAP at a concentration of 1.0 ± 0.01 mg / L and NAA at a concentration of 0.02 ± 0.005 mg / L.

Eighth Day of Transformation

Explants were transferred onto plates with RM medium for regeneration (RM medium, Table 1) with the addition of a selective glyphosate agent (N-phosphonomethylglycine) at a concentration of 4.23 mg / L. Glyphosate was used as a selective agent, since the genetic construct contains a synthetic analogue of the CP4 EPSPS gene, which encodes the enzyme 5-enolpyruvylshikimate-3-phosphate synthase, the expression of which provides glyphosate resistance.

To test the efficiency of the regeneration process in control variants, a regeneration medium without the addition of a selective agent was used (RM medium, Table 1).

Used in a nutrient medium for the regeneration of zeatin at a concentration of 1.0 ± 0.01 mg / L, BAP at a concentration of 1.0 ± 0.01 mg / L and HA ₃ at a concentration of 0.02 ± 0.01 mg / L.

Every 14 days

The explants were transferred to fresh Petri dishes with medium for regeneration of the same composition.

When regenerants appear

Regenerants were cut off and transferred to test tubes containing rooting medium (RIM medium, Table 1).

Primary regenerants in the amount of 472 pieces, rooted in a selective medium containing glyphosate at a concentration of 4.23 mg / l, were considered to have passed the initial selection. Thus, the regeneration efficiency was 78.4%.

To prepare the media shown in Table 1, a solution of MS salts in deionized water was prepared, adjusting the pH to 5.6–5.8 ± 0.1 using 1N KOH and 1N HCl solutions. Sterilization of the media was carried out in an autoclave at 1 atm, 121 ° C for 20 minutes. After cooling the medium to + 45 ÷ 50 ° C, vitamins were added (Table 3), hormones, antibiotics and selective agents (preparation method and concentration of the initial solutions, see Table 2) according to the composition of the media and 20 Petri dishes (9 cm) were poured in 20 ± 5 ml of medium in each.

Table 1. Composition of culture media for maintaining in vitro culture and the transformation process

Components MSbase environment SM environment CIM environment RM environment RIM environment MS salts ** + + + + + Sucrose 10 mg / l 30 mg / l 30 mg / l 30 mg / l 30 mg / l Agar 8-9 mg / l 8-9 mg / l 8-9 mg / l 8-9 mg / l 8-9 mg / l Vitamins + + + + + IAU / IAA - 0.01 ÷ 0.04 mg / l 0.01 ÷ 0.04 mg / l - - Zeatin 0.5 ÷ 1.5 mg / l 0.5 ÷ 1.5 mg / l 0.5 ÷ 1.5 mg / l BAP 0.5 ÷ 1.5 mg / l 0.5 ÷ 1.5 mg / l 0.5 ÷ 1.5 mg / l GK ₃ - - - 0.01 ÷ 0.04 mg / l - AgNO ₃ silver nitrate - - 10 mg / l 10 mg / l - Glyphosate Selective Agent - - 4.23 mg / l 4.23 mg / l 4.23 mg / l Agrobacterium inhibiting antibiotic (Cb and / or Cf) - - 500 mg / l 500 mg / l 500 mg / l

** [21]

Table 2. Preparation and storage conditions of the components of nutrient media

Stock solutions (drains)
100 ml Cooking technique Storage Kanamycin (Km), 100 mg / ml Dissolve in MQ H ₂ O * - 20 ° C *** Chloramphenicol (Ch),
25 mg / ml Dissolve in ethanol - 20 ° C Spectinomycin (Sp), 50 mg / ml Dissolve in MQ H ₂ O - 20 ° C Streptomycin (St), 50 mg / ml Dissolve in MQ H ₂ O - 20 ° C Carbenicillin (Cb), 100 mg / ml Dissolve in MQ H ₂ O - 20 ° C Cefotaxime (Cf), 100 mg / ml Dissolve in MQ H ₂ O - 20 ° C NAA (NAA), 0.02 mg / ml 20 mg of powder + 1 ml of 1N NaOH to 100 ml of H ₂ O ** 0 ° C BAP (BAP), 1 mg / ml 100 mg + 1 ml 1N NaOH to 100 ml H ₂ O ** 0 ° C GK3 (GA3), 0.02 mg / ml 20 mg of powder + 100 ml of 50% ethanol ** 0 ° C Zeatin Riboside (Zeatin), 1 mg / ml 100 mg of powder + 1 ml of 1N NaOH to 100 ml of H ₂ O ** 0 ° C Glyphosate (Gly), 8.455 mg / ml 84.55 mg powder +1 ml 1N KOH + up to 100 ml MQ H ₂ O - 20 ° C

* - deionized water using a Milli Q installation; ** - sterilize by filtration using membrane filters (Millipore, pore diameter 0.22 μm);

*** - stocks of antibiotics are stored for 1 month at 4 ° C; at -20 ° C, most antibiotics remain stable for several months.

Table 3. The composition of the complex of vitamins

Ingredient Mg / L concentration A nicotinic acid 1,0 Pyridoxine * HCl (Vitammin B6) 1,0 Thiamine (Vitamin B1) 1,0 calcium pantothenate 1,0 Inositol 50,0 Biotin 1,0 Glycine 2.0 Folic acid 0.5

Table 4. The composition of the nutrient medium Luria-Bertani

Components Concentration, g / l Sodium Chloride NaCl 10.0 Tripton 10.0 Yeast extract 5,0 Bacto Agar 15.0

Example 2. Confirmation of the transgenic nature of the obtained regenerants using PCR analysis.

PCR analysis of transgenic lines

  The selected primary regenerants in the amount of 472 pieces were checked for the presence of the transferred genetic construct using PCR analysis with primers specific for the coding region of the transgenic construct. For the PCR analysis of the plant genome for the presence of the cryIIIa gene, the pr1 primer system (SEQ ID No 3) - pr2 (SEQ ID No 4) was used.

Given the inclusion of the cryIIIa gene in the genomic DNA of potatoes, the use of the indicated primer pair during PCR should lead to the formation of a DNA fragment with a length of 673 nucleotides. If necessary, a more detailed analysis of the obtained PCR products could be additionally used restriction analysis. Upon restriction enzyme digestion with Pvu II, the PCR product corresponding to the transgenic insert must break down into two fragments of 278 and 395 nucleotide pairs.

DNA isolation protocol.

To isolate DNA, 25-50 mg of plant tissue (leaf blade) was ground in a homogenizer in 120 μl of buffer I (50 mM Tris HCl, pH8.0; 10 mM EDTA; 50 μg / ml pancreatic RNase) until a homogeneous suspension was obtained. Then, 125 μl of lysis buffer II (0.2 M NaOH; 1% dodecyl sulfate Na) was added to the resulting suspension. The resulting mixture was processed on a swinging platform for 2 minutes at room temperature + 18-21 ° C ± 1 ° C. Next, the tubes were transferred to a thermostat and incubated at 65 ° C for 45 minutes. At the end of the incubation, the tubes were cooled to a temperature of 20-25 ° C and 125 μl of neutralizing solution III (2.5 mM acetate K, pH 4.5) was added to each. The contents of the tubes were thoroughly mixed on a swinging platform and centrifuged at 14,000 rpm for 10 minutes. The supernatant was transferred to new microcentrifuge tubes containing 500 μl of Wizard MaxiPreps resin, and then DNA was isolated according to the Promega recommendations for the Wizard Preps kit. The DNA concentration in the resulting preparations was 15-100 μg / ml. The obtained DNA preparations were of good quality (λ260: λ280> 1.8), were suitable for amplification and, according to the data of electrophoretic analysis, contained RNA in trace amounts (less than 1%).

Protocol for PCR.

The following PCR conditions were selected:

first cycle: 94 ° C - 1 min, 55 ° C - 1 min, 72 ° C - 1 min,

subsequent 35 cycles: 94 ° С - 15 sec, 55 ° С - 15 sec, 72 ° С - 20 sec, final polymerization: - 7 minutes.

The analysis of PCR products was carried out by electrophoresis in 1% agarose gel with an electric field strength of 6 V / cm. Documentation of the results was carried out on the installation of gel - documentation BioDoc II (Biometra, Germany). The appearance of the PCR product with a length of 673 nucleotides (provided that it was not present in the reactions put on the control DNA) indicated the presence of the desired gene in the genomic DNA of the analyzed plant.

The presence of a transgene was confirmed for 44 of 472 analyzed regenerants (Fig. 4). Thus, the transformation efficiency was 9.3%.

Example 3. Determination of the level of expression of the target gene (cryIIIa) in transgenic plants.

An enzyme-linked immunosorbent assay was used to quantitatively determine the level of expression of the target gene in plants of the transgenic line.

 Obtaining dilutions of CryIIIa protein for a standard titration curve.

Before titration of the standard CryIIIa protein, the initial solution with a concentration of 500 μg / ml was diluted 500 times (solution A was obtained - 1 μg / ml). A number of further dilutions to obtain a standard ELISA curve were prepared in accordance with the table below (table. 5).

Table 5. Scheme of dilutions of standard protein

No. of dilutions one 2 3 four 5 6 7 The concentration of cryIIIa, pg / ml 16 8 four 2 one 0.5 0.25 Breeding one 2 four 8 16 32 64 No. of the added solution Buffer one 2 3 four 5 6 Volume added solution, μl twenty 400 400 390 350 300 200 The volume of ELISA buffer, μl 1230 400 400 390 350 300 200 The total volume of the mixture, μl 1250 800 800 780 700 600 400 The volume of the remaining solution, µl 850 400 410 405 400 400 400

Obtaining dilutions of plant tissue homogenate for analysis.

To obtain a homogenate, 25-50 mg of plant tissue (leaf blade) was ground in a microtube on an IKA RW16 basic microhomogenizer of plant tissues in 1x PBS buffer (80 g NaCl, 21.68 g Na ₂ HPO ₄ (x7H ₂ O), 2 g KH ₂ PO ₄ , 2 g of KCL, pH 7.3-7.5; 20 g of BSA per 1 liter of a 10-fold solution) until a homogeneous suspension is obtained in the ratio of 1 mg of tissue to 24 μl of buffer (initial dilution 1:25). Rubbing was carried out until a homogeneous suspension was obtained, without any inhomogeneities visible to the naked eye.

A number of further dilutions of the test drug for ELISA were prepared in accordance with table 6.

Table 6. Scheme of dilutions of the studied drug

№№ one 2 3 four 5 6 7 The concentration of tissue, mg / ml 1,6 0.8 0.4 0.2 0.1 0.05 0,025 Breeding one 2 four 8 16 32 64 No. of the added solution AT one 2 3 four 5 6 Volume added solution, μl 32 400 400 390 350 300 200 The volume of ELISA buffer, μl 768 400 400 390 350 300 200 The total volume of the mixture, μl 800 800 800 780 700 600 400 The volume of the remaining solution, µl 400 400 410 405 400 400 400

Preparation of immunological plates for analysis.

The initial solution (1 mg / ml) of polyclonal antibodies against the target protein was diluted 1000 times before coating the cells. 200 μl of diluted antibodies were applied to each plate well and the plate was incubated at room temperature for 4 hours.

 Block cell dies.

To prevent non-specific protein sorption after incubation with polyclonal antibodies, the plate was washed three times with 1x PBS buffer and 200 μl of a 0.2% BSA solution in 1x PBS with 0.05% was applied to each well. The plate was incubated at room temperature for 4 hours and washed three times with 1x PBS buffer. Next, the prepared plate was stored at 4 ^{° C} until use no more than 3 days.

D. Loading dice with the test drug.

200 μl of dilutions of 2–7 standard and dilutions of 2–7 of the test homogenate were added to the respective plate cells. The application for both the standard and the test sample was carried out twice in independent plate cells. The plate was incubated at room temperature for 4 hours or at + 4 ° C overnight. At the end of the incubation, plate cells were washed three times with 1x PBS buffer.

 Identification of ELISA results.

200 μl of a 1000-fold diluted antibody conjugate solution was added to each plate of the plate and the plate was incubated at room temperature +18 - 21 ° С ± 1 ° С for 4 hours or at + 4 ° С overnight. At the end of the incubation, plate cells were washed three times with 1x PBS buffer. Next, 200 μl of chromagen solution was added to each well and the plate was incubated at room temperature, periodically checking the optical density of the solution in the cells on a spot spectrophotometer at a wavelength of 405 nm. Upon reaching an optical density of 1.0-1.2, incubation was stopped and a final measurement of the optical density of the solution in the cells was carried out.

G. Interpretation of ELISA results.

To identify transgenic potato lines with an expression level of the target gene of more than 10 μg / g of tissue, we compared the optical density of the solution in cells containing the same dilutions of the standard and the test solution. Cases when the optical density of the solution in both dilutions 5 and 6 of the test sample exceeded the optical density of the corresponding dilutions of the standard were interpreted as the expression level of the target protein of more than 10 μg / g of tissue.

56 transgenic lines with a CryIIIa protein expression level of less than or equal to 10 μg / g of tissue and 43 transgenic lines with a CryIIIa protein expression level of more than 10 μg / g of tissue were revealed, which were transferred for further studies.

Example 4. Obtaining a transgenic line.

Field trials.

In 2000, limited field trials were carried out (registered plot No. 09-P / 1999) with the aim of propagating and producing tuberous material from the obtained transgenic potato plants of the Elizabeth variety.

In the period from 2001 to 2003, in the areas registered by the MVK GID, No. 09-P / 1999 (All-Russian Research Institute of Phytopathology of the Russian Academy of Agricultural Sciences, B. Vyazemy settlement, Moscow Region) and No. 07-P / 2002 (Rogachevo agricultural firm, Dmitrovsky district, Moscow region) limited field trials of the obtained transgenic lines of potato cultivar Elizabeth were conducted. The tests were carried out in order to confirm the manifestation of the introduced trait in the field and select the lines corresponding to the original variety according to the assessment of distinctness, uniformity and stability according to the international UPOV system [22].

According to the results of field trials in 2001-2003. 3 lines of potatoes of the Elizabeth variety were selected, which showed pronounced resistance to the Colorado potato beetle and at the same time retained the properties of the original variety. The selected lines were transferred for analysis of the copy number of the cryIIIa gene insert.

Example 5

Southern copy cryIIIa gene copy assay.

Getting labeled probes.

Labeled probes for Southern hybridization were prepared on the basis of PCR fragments obtained on vector DNA used in potato transformation. Moreover, the overlap zone of each of the probes with marker restriction HindIII fragment (length 1800 nucleotides) was not less than 300 pairs of nucleotides.

 PCR on vector DNA was performed as follows:

94 ° Cx1 min, 56 ° Cx30 sec, 72 ° Cx2 min, 25 cycles.

The label was introduced into the probe using a cyclic linear polymerase reaction using one of the primers of each PCR fragment. Thus, the obtained probes were single-stranded, which prevents the probe from self-hybridizing and increases the hybridization sensitivity by about 5-7 times.

The conditions for the linear reaction on the PCR fragments were as follows:

94 ° Cx1 min, 56 ° Cx30 sec, 72 ° Cx4 min, 20 cycles. Under these conditions, the inclusion in the composition of single-stranded probes 45-70% of the label.

Southern Hybridization Protocol.

For analysis, the obtained DNA preparations treated with restriction enzymes HindIII and EcoRV were separated by electrophoresis in 0.7% agarose gel. As a control, standard amounts of DNA (1 ng, 0.1 ng and 0.01 ng) containing the test insert of plasmid pMON38943 treated with the same restrictase enzymes were used. At the end of electrophoresis, DNA was transferred onto a Hybond XL membrane (Amersham) using the capillary transfer method [23]. DNA was fixed on the membrane by irradiation with ultraviolet light for 5 seconds (4 lamps with a power of 8 kW). Hybridization with a labeled probe and subsequent washing from a non-hybridized probe was carried out in accordance with the recommendations of the membrane manufacturer (Hybond XL, Amersham). The resulting membranes were exposed with an x-ray film for 170 hours. Radioautographs were scanned and analyzed using Adobe Photoshop. It was shown that a single insert of the cryIIIa gene is present in the genome of all three analyzed lines.

For further research, a 2904 kgf line was selected.

Example 6. The definition of the polynucleotide sequence that characterizes the transformation event.

To identify a genetically modified line of 2904 kgf of a fragment in the genomic DNA of potatoes that includes a region of combining exogenous and endogenous (flanking an artificial insert) DNA that could be used as an identifier for this transformational act, the method of inverse polymerase chain reaction was used [24], carried out in accordance with the circuit shown in FIG. 3.

For this, 500 ng of potato genomic DNA was cut using the RsaI restriction endonuclease in accordance with the protocol recommended by the manufacturer (Sibenzim, Novosibirsk, Russia). After digestion, the fragmented DNA was reprecipitated with 2.5 volumes of ethanol and dissolved in 50 μl of ligase buffer recommended by the manufacturer (Sibenzim, Novosibirsk, Russia). Next, stepwise PCR was performed using primers F1 (SEQ ID No. 5) -R1 (SEQ ID No. 6) in the first stage and primers F2 (SEQ ID No. 7) -R2 (SEQ ID No. 8) in the second stage.

The first stage of PCR was carried out according to the protocol: 94 ° С - 3 min, then 35 cycles of 94 ° С - 30 sec, 60 ° С - 40 sec, 72 ° С - 5 min, final polymerization at 72 ° С - 7 min. The second stage of PCR was carried out according to the protocol: 35 cycles of 94 ° С - 20 sec, 60 ° С - 30 sec, 72 ° С - 4 min, final polymerization at 72 ° С - 7 min.

PCR products (Fig. 5) were isolated from agarose gel according to the method of [25] and their sequences were determined using the Sanger method on an ABI3730 automated DNA analyzer, manufactured by Applied Biosystems, USA. The identified nucleotide sequences were analyzed using the BLAST program [26] to identify areas related to potato genomic DNA. The data obtained allowed us to establish that one of the fragments (indicated by the arrow) has a nucleotide sequence in which the sequences of exogenous and endogenous DNA are combined and which can be characterized by the general formula X + A, where

X is the part of the nucleotide sequence of the introduced genetic construct, which corresponds to SEQ ID No. 1;

A is the nucleotide sequence of the flanking portion of the genomic DNA of potato cultivar Elizabeth, which corresponds to SEQ ID No. 2.

This recombinant polynucleotide sequence characterizing a unique transformational act leading to the genetically modified 2904 kgf line was chosen as the “identifier” of this transformational event.

Example 7. The PCR protocol for the detection of the proposed identification sequence in the genomic DNA of potatoes.

Based on the analysis of the complete nucleotide sequence X + A (SEQ ID NO: 1 + SEQ ID NO: 2), a new pair of IDf-IDr primers specific for this DNA region was proposed (Fig. 3). Primer IDf is homologous to the nucleotide sequence of SEQ ID No. 1 and is an oligonucleotide with SEQ ID No. 9. Primer IDr is homologous to the nucleotide sequence of SEQ ID NO: 2 and is an oligonucleotide with SEQ ID NO: 10.

The PCR protocol was optimized for this primer pair and the following PCR conditions were proposed: 35 cycles of 94 ° С - 20 sec, 60 ° С - 30 sec, 72 ° С - 60 sec, final polymerization at 72 ° С - 7 min.

As a result of PCR analysis of the genomic DNA of potato plants of the 2904 kgf line, the samples of which were prepared in the same way as in example 6, carried out in accordance with the improved protocol, the presence of a fragment of 351 nucleotide pairs (Fig. 6) with the sequence corresponding to SEQ ID No. 1 + SEQ ID No. 2. The data obtained indicate that PCR with IDf-IDr primers derived from the sequence identified by us in Example 6 that identifies this transformation event identifies a “target” with the formula X + A in the genomic DNA of the transgenic line 2904 kgf highly specific.

Table 7. Names and origin of drugs

Reagent Manufacturing firm Company catalog number Phytoagar / Phytagar Life Technologies, GibcoBRL 10695-039 Bactoagar / Bacto agar Difco 0140-01 Yeast extract / Yeast extract Difco 0127-01-7 Tryptone / Tryptone Difco 0123-01 Sucrose / Sucrose Sigma S-5391 MS-Salt / MS-Salt Mixture Life Technologies, GibcoBRL 11117-074 GK3 / GA3 ICN 100288 NAU / NAA Life Technologies, GibcoBRL 21570-023 BAP / BAP (6-benzylaminopurine) ICN 100912 Zeatin / Zeatin riboside Sigma Z 0626 Carbenicillin / Carbenicillin Sigma C-3416 Kanamycin / Kanamycin Sigma K-4378 Cefotaxime / Cefotaxime Sigma C-7039 Silver nitrate Sigma S-2523 Myo-Inozitol / Myo-Inozitol Sigma I-3011 Pyridoxine / Pyridoxine HCl Sigma P-9755 Thiamine / Thiamine Sigma T-3902 Pantothenate Ca / Pantothenat Calcium Calbiochem 5101 Nicotinic acid Serva 30320 Biotin / d-Biotin Sigma B-3399 Glycine / Glycine Sigma G-6143 Folic Acid / Folic Acid Sigma F-8890 Resin Wizard MaxiPreps Promega A7141 Thermopolymerase BioTaq Dialat LTD, Moscow - Wizard PCR Preps Promega A7170 Wizard minicolumn Promega A7211 Petri dishes mm Medical polymer - Glass culture tubes, 25x150 mm Sigma C 5916 1.5 ml microcentrifuge tubes, type Eppendorf Treff 96.9216.9.01 Vegetation containers Magenta Sigma V 8380 Membrane filter, pore 0.22 μm Millipore SVGS01015

Literature.

one. Knowles B.H. and Dow J.A.T. The crystal delta-endotoxins of Bacillus thuringiensis - models for their mechanism of action on the insect gut // BioEassays, 1993, v. 15, p. 469-476. 2. van Rie J. et al Receptors on the brush border membrane of the insect midgut as determinants of the specificity of Bacillus thuringiensis delta-endotoxin // Appl. Environ. Microbiol. Rev. 1990, v. 56, p. 1378-1385. 3. Hofte H and Whiteley H.R. Insecticidal crystal proteins of Bacillus thuringiensis // Microbiol. Rev., 1989., V. 53, p. 242-255. four. Feitelson J.S., Paine J., Kim L. Bacillus thuringiensis: insects and beyond // Biotechnology, 1992, v. 10, p. 271-275. 5. Beegle C.C. and Yammamoto T. History of Bacillus thuringiensis Berliner research and development // Can. Ent., 1992, v. 124, p. 587-616. 6. Schnepf E, Crickmore N, Van Rie J, Lereclus D, Baum J, Feitelson J, Zeigler DR, Dean DH. Bacillus thuringiensis and Its Pesticidal Crystal Proteins. Microbiol Mol Biol Rev. 1998 Sep; 62 (3): 775-806. 7. Perlak, FJ, Stone TB, Muskopf, YM, Petersen, LJ, Parker, GB, McPherson, SA, Wyman, J., Reed G., Biever, D., Fischhoff DA, 1993. Genetically improved potatoes: protection from damage by Colorado potato beetles. Plant Mol. Biol., 22, 313-321. 8. Stewart CN Jr, Adang MJ, All JN, Boerma HR, Cardineau G, Tucker D, Parrott WA. Genetic transformation, recovery, and characterization of fertile soybean transgenic for a synthetic Bacillus thuringiensis cryIAc gene. Plant Physiol. 1996 Sep; 112 (1): 121-129. 9. Nayak P, Basu D, Das S, Basu A, Ghosh D, Ramakrishnan NA, Ghosh M, Sen SK. Transgenic elite indica rice plants expressing CryIAc-endotoxin of Bacillus thuringiensis are resistant against yellow stem borer (Scirpophaga incertulas). Proc Natl Acad Sci U S A. 1997 Mar 18; 94 (6): 2111-2116. 10. U.S. Patent 6072105, 06/06/00 eleven. . 12. The Federal Law of the Russian Federation "On State Regulation in the Field of Genetic Engineering", 1996 (as amended by the Federal Law of the Russian Federation of July 12, 2000 No. 96-FZ). 13. Federal Law of the Russian Federation "On Quality and Food Safety", 2000 fourteen. Resolution of the Chief State Sanitary Doctor of the Russian Federation dated 06.04.99 No. 7 "On the procedure for hygienic assessment and registration of food products obtained from genetically modified sources." fifteen. Decree of the Chief State Sanitary Doctor of the Russian Federation of September 26, 1999 No. 12 "On improving the control system for the sale of agricultural products and medical products derived from genetically modified sources." 16. Resolution of the Chief State Sanitary Doctor of the Russian Federation of 08.11.2000 No. 13 "On the application of information on consumer packaging of food products obtained from genetically modified sources." 17. Resolution of the Chief State Sanitary Doctor of the Russian Federation of 08.11.2000 No. 14 "On the procedure for the sanitary-epidemiological examination of food products obtained from genetically modified sources". eighteen. National Standard of the Russian Federation No. 53-173. 19. Varietal resources and best practices for seed production of potatoes. B.V. Anisimov - M .: Federal State Budget Institution "Rosinformagroteh", 2000 - 152 p. twenty. Patent for invention No. 2231251 of June 27, 2004. 21. Murashige T. And Skoog F., Plant Phisiology, 1962, v. 15, p. 485. 22. UPOV TG \ 23 \ 5 "Guidelines for the conduct of nests for distinctness, homogeneity and stability". 23. J. Sambrook, E. F. Fritsch, T. Maniatis. Molecular cloning: a laboratory manual 2nd ed. Cold Spring Harbor, N.Y .: Cold Spring Harbor Laboratory Press, 1989. 24. Ochman, H, A.S. Gerber, D. L. Hartl. 1988. Genetic applications of an inverse polymerase chain reaction. Genetics 120: 631-623. 25. Fotadar U, Shapiro LE, Surks MI. Simultaneous use of standard and low-melting agarose for the separation and isolation of DNA by electrophoresis. Biotechniques. 1991 Feb; 10 (2): 171-172. 26. . 27. Barker, R.F., Idler, K.B., Thompson, D.V. and Kemp, J.D. Nucleotide sequence of the T-DNA region from the Agrobacterium tumefaciens octopine Ti plasmid pTi15955. Plant Mol. Biol. 2, 335-350.1983. 28. Richins, R. D., Scholthof, H. B. and Shepherd, R.J. Sequence of figwort mosaic virus DNA (caulimovirus group) Nucleic Acids Res. 15 (20), 8451-8466 (1987). 29. Winter, J., Wright, R., Duck, N., Gasser, C., Fraley, R. and Shah, D. The inhibition of petunia hsp 70 mRNA processing during CdCl (2) stress. Mol. Gen. Genet. 211, 315-319 (1988); Rensing, S.A. and Maier, U.G. Phylogenetic analysis of the stress-70 protein family, J. Mol. Evol. 39 (1), 80-86 (1994). thirty. Klee, H.J., Muskopf, Y.M. and Gasser, C.S. Cloning of an Arabidopsis thaliana gene encoding 5-enolpyruvylshikimate-3-phosphate synthase: sequence analysis and manipulation to obtain glyphosate-tolerant plants. Mol. Gen. Genet. 210 (3), 437-442 (1987). 31. Harrison LA, Bailey MR, Naylor MW, Ream JE, Hammond BG, Nida DL, Burnette BL, Nickson TE, Mitsky TA, Taylor ML, Fuchs RL, Padgette SR. The expressed protein in glyphosate-tolerant soybean, 5-enolpyruvylshikimate-3-phosphate synthase from Agrobacterium sp. strain CP4, is rapidly digested in vitro and is not toxic to acutely gavaged mice. J Nutr. 1996 Mar; 126 (3): 728-40. 32. Coruzzi, G., Broglie, R., Edwards, C. and Chua, N.H. Tissue-specific and light-regulated expression of a pea nuclear gene encoding the small subunit of ribulose-1,5-bisphosphate carboxylase. EMBO J. 3 (8), 1671-1679 (1984). 33. Richins, R. D., Scholthof, H. B. and Shepherd, R.J. Sequence of figwort mosaic virus DNA (caulimovirus group) Nucleic Acids Res. 15 (20), 8451-8466 (1987). 34. Theologis, A., Et al., Sequence and analysis of chromosome 1 of the plant Arabidopsis thaliana. Nature 408 (6814), 816-820 (2000). 35. Perlak, FJ, Stone TB, Muskopf, YM, Petersen, LJ, Parker, GB, McPherson, SA, Wyman, J., Reed G., Biever, D., Fischhoff DA, 1993. Genetically improved potatoes: protection from damage by Colorado potato beetles. Plant Mol. Biol., 22, 313-321. 36. Tumer, N. E., Clark, W. G., Tabor, G. J., Hironaka, C. M., Fraley, R. T. and Shah, D.M. The genes encoding the small subunit of ribulose-1,5-bisphosphate carboxylase are expressed differentially in petunia leaves. Nucleic Acids Res. 14 (8), 3325-3342 (1986). 37. Depicker, A., Stachel, S., Dhaese, P., Zambryski, P. and Goodman, H.M. Nopaline synthase: transcript mapping and DNA sequence. J. Mol. Appl. Genet., 1 (6), 561-573, 1982.

List of sequences .

SEQ ID No. 1 - part of the nucleotide sequence of the introduced genetic constructs:

5'-GCTGCTCGAGTGGAGGCCTCATCTAAGCCCCCATTTGGACGTGAATGTAGACAC

GTCGAAATAAAGATTTCCGAATTAGAATAATTTGTTTATTGCTTTCGCCTATAAATACGACGGATCGTAATTTGTCGTTTTATCAAAATGTACTTTCATTTTATAATAACGCTGCGGACATCTACATTTTTGAATTGAAAAAAAATTGGTAATTACTCTTTCTTTTTCTCCATATTGACCATCATACTCATTGCTGATCCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCC -3 '

SEQ ID No. 2 - nucleotide sequence of the flanking portion of the genomic DNA of potato cultivar Elizabeth:

5 '- AAATCGAAAAACAGTGCGCCAGTAACGACTAATACCATTTGAATTAGTCGTC

SEQ ID No. 3 - oligonucleotide primer pr1:

5 '- CTCGACAGTTCTACCACTAAGGATG - 3'

SEQ ID NO: 4 - pr2 oligonucleotide primer:

5 '- GACTAAACTCCACCTTTGTGACGCC - 3'

SEQ ID No. 5 - oligonucleotide primer F1:

5 '- GCTGCTCGAGTGGAGGCCTCATCTAAGC - 3'

SEQ ID NO: 6 - R1 Oligonucleotide Primer:

5 '-CTCAACAAGGTCAGGGTACAGAGTCTCC - 3'

SEQ ID No. 7 - oligonucleotide primer F2:

5 '- GCTTTCGCCTATAAATACGACGGATCG - 3'

SEQ ID No. 8 - oligonucleotide primer R2:

5 '- GCCAAAAGCTACAGGAGATCAATGAAG - 3'

SEQ ID No. 9 - oligonucleotide primer IDf:

5 '- GCTTTCGCCTATAAATACGACGGATCG - 3'

SEQ ID No. 10 - oligonucleotide primer IDr:

5 '- GACGACTAATTCAAATGGTATTAG - 3'

FIG No. 1 Basic genetic elements of the transformation vector pPBt12

Designations in the figure:

LB is the left flanking sequence of the plasmid Ti A.tumifasciens [27];

FMV - 35S promoter of the Norica mosaic virus [28];

Hsp70 — untranslated leader sequence of petunia heat shock protein hsp 70 [29];

CTP2 - N-terminal chloroplast transit peptide of the EPSPS gene of Arabidopsis thaliana [30]

CP4 EPSPS is the coding region of the marker gene (aroA gene) from the bacterium Agrobacterium sp.ssp.CP4 [31],

T-E9 - 3'-untranslated region of the gene of the small subunit E9 RuBisCo pea - terminator [32]

FMVp is part of the enhancer sequence of the 35S promoter of the noric mosaic virus [33].

pRBSC is the promoter of the 1A RuBisCo small subunit gene from Arabidopsis thaliana [34].

cryIIIA is the coding sequence of the target cryIIIa gene [35].

NOS-T is the 3'-terminal region of the nopaline synthetase (NOS) gene of Arabidopsis thaliana [36].

RB — Right flanking sequence of the plasmid Ti A.tumifasciens [37].

FIG No. 2 Scheme of the transformation of potatoes.

FIG. 3. The scheme for obtaining a unique PCR identifier of the transgenic line.

Designations in the figure:

Rs — restriction enzyme digestion site Rsa I;

F1, R1 - primer pair for the first stage inverse PCR;

F2, R2 - primer pair for the second stage of inverse PCR;

Border - flanking sequence of a vector;

IDf, IDr - primer pair for identification PCR,

A, X - fragments of the transgenic line identifier (according to claim 1 of the formula)

FIGURE 4 Typical electrophoretic analysis of PCR products with the primer system pR1-pR2 for DNA from a collection of modified potato lines.

groupTop0groupRight0groupBottom0fFlipH0fFlipV0posh0posrelh2posv0posrelv2fLayoutInCell0fLayoutInCell0

groupTop0groupRight0groupBottom0fFlipH0fFlipV0posh0posrelh2posv0posrelv2fLayoutInCell0fLayoutInCell0

Designations in the figure:

1 - quality control of the reaction mixture (PCR in the absence of template DNA),

2, 3 - PCR on 2 independent DNA preparations of modified potato,

4 - PCR on the DNA of the control potato,

5 - GeneRuler 100 bp DNA molecular weight marker (Fermentas, # SM0241).

The arrow (673 bp) indicates the position of the desired PCR product. The positions of fragments of the DNA molecular weight marker are indicated on the right.

FIGURE 5. Electrophoretic analysis of inverse PCR products with the F1-R1 primer system on the DNA of the modified potato line 2904 kgf.

Designations in the figure:

M - GeneRuler 100 bp DNA molecular weight marker (Fermentas, # SM0241).

1 - PCR on DNA preparation of unmodified control potato,

2 - PCR on the preparation of DNA modified potato line 2904kg,

3 - quality control of the reaction mixture (PCR in the absence of template DNA),

The arrow to the right (500 bp) indicates the position of the desired PCR product. The positions of fragments of the DNA molecular weight marker

FIGURE 6. Electrophoretic analysis of PCR identification products with the IDf-IDr primer system on the DNA of various potato lines.

Designations in the figure:

M - GeneRuler 100 bp DNA molecular weight marker (Fermentas, # SM0241).

1 - PCR on a DNA preparation of modified potato line 2904kg,

2-10 - PCR on DNA preparations of other lines of modified potato,

11 - PCR on the preparation of DNA control potato cultivar Elizabeth,

12 - quality control of the reaction mixture (PCR in the absence of template DNA).

An arrow (351 bp) indicates the position of the desired PCR product. The positions of fragments of the DNA molecular weight marker

Claims (5)

1. Recombinant polynucleotide sequence that characterizes the product obtained as a result of a unique transformation between a genetic construct including the cryIIIa gene and genomic DNA of potato cultivar Elizabeth, which ensures the expression of the named gene at a level sufficient for a plant to show resistance to the Colorado potato beetle, and having the general formula XA, where X is the part of the nucleotide sequence of the introduced genetic construct corresponding to SEQ ID No. 1, and A is the nucleotide sequence st flanking region of the genomic DNA Elizabeth potato varieties, corresponding to SEQ ID №2. 2. A potato plant cell producing a cryIIIa protein that contains the recombinant polynucleotide sequence of claim 1. 3. Plant transgenic potato resistant to the Colorado potato beetle, containing cells according to claim 2. 4. The vegetative offspring of a plant according to claim 3, which has retained in a series of generations the genotypic trait of the parent organism, controlled by the presence in the genomic DNA of the recombinant polynucleotide sequence according to claim 1. 5. The use of the polynucleotide sequence according to claim 1 for identifying a cell according to claim 2, plants according to claim 3, vegetative offspring according to claim 4.

Images