EA037110B1 - PCSK9 iRNA COMPOSITIONS AND METHODS OF USE THEREOF - Google Patents

Abstract

The invention relates to RNAi agents, e.g., double-stranded RNAi agents, targeting the PCSK9 gene, and methods of using such RNAi agents to inhibit expression of PCSK9 and methods of treating subjects having a lipid disorder, such as a hyperlipidemia.

Description

ELNILAM PHARMACIES, INC. (US) (72) Inventor:

Borodovsky Anna, Callanthottathil Rajiv G., Fitzgerald Kevin, Frank-Kamenetsky Maria, Kuerbs William, Mayer Martin, Harisse Klaus, Kuchimanchi Satiyanarayana, Manoharan Muthiach, Milstein Stewart (74) Representative:

Medvedev V.N. (RU)

037110 B1

037110 Bl (57) The invention relates to RNAi agents, eg, double-stranded RNAi agents targeting the PCSK9 gene, and methods of using such RNAi agents to inhibit PCSK9 expression, and methods of treating subjects with lipid disorders such as hyperlipidemia.

Related applications

This application claims the priority of US Provisional Patent Application No. 61/733518, filed December 5, 2012; US Provisional Patent Application No. 61 / 793,530, filed March 15, 2013; US Provisional Patent Application No. 61 / 886,916, filed October 4, 2013; and US Provisional Application No. 61/892188, filed October 17, 2013. This application is also related to US Provisional Patent Application No. 61/561710, filed November 18, 2011. The entire content of each of the aforementioned provisional patent applications is thus is incorporated herein by reference.

Sequence listing

This application includes a sequence listing that has been filed electronically in ASCII encoded format and is therefore incorporated herein by reference in its entirety. The specified ASCII copy of the file, created on October 29, 2013, is named 121301-00420_SL.txt and is 433512 bytes in size.

State of the art

The proprotein convertase subtilisin / kexin 9 (PCSK9) is a member of the subtilisin serine protease family. The other eight mammalian subtilisin proteases, PCSK1-PCSK8 (also called pC 1/3, PC2, furin, PC4, PC 5/6, PACE4, PC7, and S1P / SKI-1), are proprotein convertases that process a wide range of secretory pathway proteins and play a role in various biological processes (Bergeron F. (2000) J. Mol. Endocrinol. 24, 1-22, Gensberg K., (1998) Semin. Cell Dev. Biol. 9, 11-17, Seidah NG (1999 ) Brain Res 848, 45-62, Taylor NA (2003) FASEB J. 17, 1215-1227 and Zhou A. (1999) J. Biol. Chem. 274, 20745-20748).

It has been suggested that PCSK9 plays a role in cholesterol metabolism. Expression of PCSK9 mRNA was suppressed in mice by dietary cholesterol diet (Maxwell KN (2003) J. Lipid Res. 44, 2109-2119), activated by statins in HepG2 cells (Dubuc G. (2004) Arterioscler. Thromb. Vasc. Biol. 24, 1454-1459) and was activated in transgenic sterol-regulatory element binding protein (SREBP) mice (Horton JD (2003) Proc. Natl. Acad. Sci. USA 100, 12027-12032), as in the case of enzymes involved in cholesterol biosynthesis and low density lipoprotein receptor (LDLR). In addition, missense mutations in PCSK9 have been found to be associated with a form of autosomal dominant hypercholesterolemia (Hchola3) (Abifadel M. et al. (2003) Nat. Genet. 34, 154-156, Timms KM, (2004) Hum. Genet 114, 349-353, Leren TP (2004) Clin Genet 65, 419-422). PCSK9 may also play a role in determining LDL cholesterol levels in the general population, since single nucleotide polymorphisms (SNPs) have been associated with cholesterol levels in the Japanese population (Shioji K. (2004) J. Hum. Genet. 49, 109-114).

Types of autosomal dominant hypercholesterolemia (ADH) are monogenic diseases in which patients present with elevated levels of total and LDL cholesterol, tendon xanthomas, and premature atherosclerosis (Rader D.J. (2003) J. Clin. Invest. 111, 1795-1803). The pathogenesis of ADH types and the recessive form, autosomal recessive hypercholesterolemia (ARH) (Cohen JC (2003) Curr. Opin. Lipidol. 14, 121-127), is attributed to impaired absorption of LDL by the liver. ADH can be caused by mutations in the LDLR that interfere with the uptake of LDL, or by mutations in a protein on LDL, apolipoprotein B, that binds to LDLR. ARH is caused by mutations in the ARH protein, which is required for endocytosis of the LDLR-LDL complex through its interaction with clathrin. Thus, if mutations in PCSK9 are causative in the Hchola3 families, then PCSK9 appears to play a role in receptor-mediated uptake of LDL.

Overexpression studies indicate a role for PCSK9 in regulating LDLR levels and thus uptake of LDL by the liver (Maxwell KN (2004) Proc. Natl. Acad. Sci. USa 101, 7100-7105, Benjannet S. et al. (2004) J. Biol Chem 279, 48865-48875, Park SW (2004) J. Biol Chem 279, 50630-50638). Adenovirus-mediated overexpression of mouse or human PCSK9 for 3 or 4 days in mice resulted in elevated total and LDL cholesterol levels; this effect is not seen in LDLR knockout animals (Maxwell KN (2004) Proc. Natl. Acad. Sci. USA 101, 7100-7105, Benjannet S. et al. (2004) J. Biol. Chem. 279, 48865-48875 , Park SW (2004) J. Biol Chem 279, 50630-50638). In addition, overexpression of PCSK9 resulted in a dramatic reduction in the amount of hepatic LDLR protein without affecting LDLR mRNA levels, SREBP protein levels, or SREBP nuclear to cytoplasmic protein ratio.

Although hypercholesterolemia itself is asymptomatic, prolonged elevations in serum cholesterol can lead to atherosclerosis. Serum cholesterol, consistently elevated for decades, promotes the formation of atherosclerotic plaques in the arteries, which can lead to progressive stenosis or even complete blockage of the affected arteries. In addition, smaller plaques can break off and cause blood clots and block blood flow, leading, for example, to myocardial infarction and / or stroke. If the formation of stenosis or blockage is gradual, then the blood supply to tissues and organs is slowly reduced until the functions of the organ are disrupted.

Accordingly, there is a need in the art for effective treatments for PCSK9-associated diseases such as hyperlipidemia, eg hypercholesterolemia.

Brief description of the invention

As described in more detail below, disclosed herein are compositions comprising RNAi agents, eg, double-stranded mRNA agents, targeting PCSK9. Also disclosed are methods of using the compositions of the present invention to inhibit PCSK9 expression and to treat pathologies associated with PCSK9 expression, such as hypercholesterolemia.

Accordingly, in one aspect, the present invention provides RNAi agents, e.g., double-stranded RNAi agents, capable of inhibiting the expression of proprotein convertase subtilisin / kexin 9 (PCSK9) in a cell, wherein the double-stranded RNAi agent comprises a sense strand, a complementary antisense strand, wherein the antisense strand comprises a region complementary to a portion of mRNA encoding PCSK9, where each strand is from about 14 to about 30 nucleotides in length, where the double-stranded RNAi agent is represented by formula (III) sense: 5 'n _p -N _a - (XXX) iN _b -Υ YY -N _b - (Ζ Ζ Z) j -N _a - n _q 3 'antisense: 3' n _p '-N _a ' - (X'X'X ') _k -N _b '-Y'Y'Y'-N _b ' - (Z'Z'Z ') iN _a ' - n _q '5' (III), where each of i, j, k and l is independently 0 or 1;

each of p, p ', q and q' is independently 0-6;

each Na and Na 'independently represents an oligonucleotide sequence containing 0-25 nucleotides, which are either modified or not modified, or combinations thereof, each sequence containing at least two modified nucleotides in different ways;

each Nb and Nb 'independently represents an oligonucleotide sequence containing 0-10 nucleotides, which are either modified or not modified, or combinations thereof;

each np, np ', n _q and n _q ', each of which may or may not be present, independently represents an overhanging nucleotide;

each of XXX, YYY, ZZZ, X'X'X ', Y'Y'Y' and Z'Z'Z 'independently represents one motif of three identical modifications of three consecutive nucleotides;

the Nb modifications differ from the Y modification, and the Nb 'modifications differ from the Y' modification; and where the sense strand is conjugated to at least one ligand.

In one embodiment, i is 0; j equals 0; i equals 1; j equals 1; both i and j are 0, or both i and j are 1. In another embodiment, k is 0; l equals 0; k equals 1; l equals 1; both k and l are 0; or both k and l are equal to 1.

In one embodiment, XXX is complementary to X'X'X ', YYY is complementary to Y'Y'Y', and ZZZ is complementary to Z'Z'Z '.

In one embodiment, the YYY motif is at or adjacent to the sense strand cleavage site.

In one embodiment, the Y'Y'Y 'motif is located at 11, 12 and 13 positions of the antisense strand from the 5'end.

In one embodiment, Y 'is 2'-O-methyl.

In one embodiment, Formula (III) is represented by Formula (IIIa)

Isense: 5 'n _p -N _a -YYY -N _a - n _q 3' antisense: 3 'n _P ' -N _a '- ΥΎΎ- N _a ' - n _q 5 '(Illa).

In another embodiment, formula (III) is represented by formula (IIIb)

Isense: 5 'n _p -N _a -YYY -N _b -ZZZ -N _a - n _q 3' antisense: 3 'n _P ' -N _a '- Y'Y'Y'-N _b -Z'Z'Z'-N _a '- n _q 5' (IIIb), where each N _b and N _b 'independently represents an oligonucleotide sequence containing 1-5 modified nucleotides.

In yet another embodiment, formula (III) is represented by formula (IIIc): sense: 5 'n _p -N _a -XXX -N _b -YYY -N _a - n _q 3' antisense: 3 'n _P ' -N _a ' - X'X'X'-N _b '- Y'Y'Y'- N _a ' - n _q '5' (IIIc), where each N _b and N _b 'independently represents an oligonucleotide sequence containing 1-5 modified nucleotides.

In one embodiment, formula (III) is represented by formula (IIId) semantic: 5 'n _p -N _a -XX X- N _b -Υ Υ Υ -N _b -ZZZ -N _a - n _q 3' antisense: 3 'n _p -N _a - X'X'X'- N _b -Y'Y'Y'-N _b -Z'Z'Z'- N _a - 5 '(PI), where each N _b and N _b ' independently is an oligonucleotide sequence co- 2 037110 holding 1-5 modified nucleotides, and each N _a and N _a 'independently represents an oligonucleotide sequence comprising 2-10 modified nucleotides.

In one embodiment, the double-stranded region is 15-30 base pairs in length. In another embodiment, the double-stranded region is 17-23 base pairs in length. In yet another embodiment, the double-stranded region is 17-25 base pairs in length. In one embodiment, the double-stranded region is 23-27 base pairs in length. In another embodiment, the double-stranded region is 19-21 base pairs in length. In another embodiment, the double-stranded region is 21-23 base pairs in length. In one embodiment, each strand contains 15-30 nucleotides.

In one embodiment, the nucleotide modifications are selected from the group consisting of LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-αalkyl, 2'-O-αlyl, 2'-C-αlyl, 2'-fluoro, 2 '-deoxy, 2'hydroxyl, and combinations thereof. In another embodiment, the nucleotide modifications are 2'-O-methyl or 2'-fluoro modifications.

In one embodiment, the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker. In another embodiment, the ligand is

In one embodiment, the ligand is attached to the 3 'end of the sense strand.

In one embodiment, the RNAi agent is conjugated to a ligand as shown in the following scheme:

where X is O or S. In a specific embodiment, X is O.

In one embodiment, the agent further comprises at least one phosphorothioate or methylphosphonate internucleotide bond.

In one embodiment, the phosphothioate or methylphosphonate internucleotide bond is at the 3 'end of one strand. In one embodiment, the thread is an antisense thread. In another embodiment, the thread is a sense thread.

In one embodiment, the phosphothioate or methylphosphonate internucleotide bond is at the 5 'end of one strand. In one embodiment, the thread is an antisense thread. In another embodiment, the thread is a sense thread.

In one embodiment, a phosphorothioate or methylphosphonate internucleotide bond is located at both the 5 'and 3' end of a single strand. In one embodiment, the thread is an antisense thread.

In one embodiment, the base pair at the 1 position of the 5 'end of the antisense strand of the duplex is an AU base pair.

In one embodiment, the Y nucleotides have a 2'-fluoro modification.

- 3 037110

In one embodiment, the Y 'nucleotides have a 2'-O-methyl modification.

In one embodiment, p '> 0. In another embodiment, p '= 2.

In one embodiment, q '= 0, p = 0, q = 0, and the overhanging nucleotides p' are complementary to the target mRNA. In another embodiment, q '= 0, p = 0, q = 0, and the overhanging nucleotides p' are not complementary to the target mRNA.

In one embodiment, the sense strand contains a total of 21 nucleotides and the antisense strand contains a total of 23 nucleotides.

In one embodiment, at least one n _p 'is linked to an adjacent nucleotide via a phosphorothioate bond.

In one embodiment, all n _p 'are linked to adjacent nucleotides via phosphorothioate bonds.

In one embodiment, the RNAi agent is selected from the group of RNAi agents listed in Table II. 1, 2, 9, 10, 12 and in FIG. 12.

In one embodiment, the RNAi agent is selected from the group consisting of AD-53815, AD-56663, AD-56658, AD-56676, AD-56666, AD-57928, and AD-60212.

In another aspect, the present invention provides RNAi agents, for example, double-stranded RNAi agents, capable of inhibiting the expression of proprotein convertase subtilisin / kexin 9 (PCSK9) in a cell, wherein the double-stranded RNAi agent comprises a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region, complementary to a portion of mRNA encoding PCSK9, where each strand is from about 14 to about 30 nucleotides in length, where the double-stranded agent for RNAi is represented by formula (III) sense: 5 'n _p -N _a - (XXX) iN _b -Υ YY - N _b - (Ζ Ζ Z) j -N _a - n _q 3 'antisense: 3' n _p '-N _a ' - (X'X'X ') _k -N _b '-Y'Y'Y'- N _b '- (Z'Z'Z') iN _a '- n _q ' 5 '(III), where each of i, j, k and l is independently 0 or 1;

each of p, p ', q and q' is independently 0-6;

each Na and Na 'independently represents an oligonucleotide sequence containing 0-25 nucleotides, which are either modified or not modified, or combinations thereof, each sequence containing at least two modified nucleotides in different ways;

each Nb and Nb 'independently represents an oligonucleotide sequence containing 0-10 nucleotides, which are either modified or not modified, or combinations thereof;

each n _p , n _p ', n _q and n _q ', each of which may be present or absent, is independently a protruding nucleotide;

each of XXX, YYY, ZZZ, X'X'X ', Y'Y'Y' and Z'Z'Z 'independently represents one motif of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-Omethyl- or 2'-fluoro modifications;

modifications N _b are different from modification Y, and modifications N _b 'are different from modification Y'; and where the sense strand is conjugated to at least one ligand.

In yet another aspect, the present invention provides RNAi agents, for example, double-stranded RNAi agents, capable of inhibiting the expression of proprotein convertase subtilisin / kexin 9 (PCSK9) in a cell, wherein the double-stranded RNAi agent comprises a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of mRNA encoding PCSK9, where each strand is about 14 to about 30 nucleotides in length, wherein the double-stranded agent for RNAi is represented by formula (III) sense: 5 'n _p -N _a - (XXX) _r N _b -YYY -N _b - (Ζ ZZ) j -N _a - n _q 3 'antisense: 3' n _p '-N _a ' - (X'XX ') _k -N _b '-Y'Y'Y'-N _b '- (Z'Z'Z') iN _a '- n _q ' 5 '(III), where each of i, j, k and l is independently 0 or 1;

each n _p , n _q and n _q ', each of which may be present or absent, independently represents a protruding nucleotide; each of p, q and q 'is independently 0-6;

n _p '> 0, and at least one n _p ' is linked to an adjacent nucleotide via a phosphorothioate bond;

each N _a and N _a 'independently represents an oligonucleotide sequence containing 0-25 nucleotides, which are either modified or not modified, or combinations thereof, each sequence containing at least two modified nucleotides in different ways;

each N _b and N _b 'independently represents an oligonucleotide sequence containing 0-10 nucleotides, which are either modified or not modified, or combinations thereof;

each of XXX, YYY, ZZZ, X'X'X ', Y'Y'Y' and Z'Z'Z 'independently represents one motif from

- 4037110 of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-Omethyl- or 2'-fluoro-modifications;

Nb modifications differ from Y modification, and Nb 'modifications differ from modification

Y '; and where the sense strand is conjugated to at least one ligand. In a further aspect, the present invention provides RNAi agents, for example, double-stranded RNAi agents, capable of inhibiting the expression of proprotein convertase subtilisin / kexin 9 (PCSK9) in a cell, wherein the double-stranded RNAi agent comprises a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region, complementary to a portion of mRNA encoding PCSK9, where each strand is from about 14 to about 30 nucleotides in length, where the double-stranded agent for RNAi is represented by formula (III) sense: 5 'n _p -N _a - (XXX) _r N _b -YYY - N _b - (Ζ Ζ Z) j -N _a - n _q 3 'antisense: 3' n _p '-N _a ' - (X'X'X ') _k -N _b '-Y'Y'Y'- N _b '- (Z'Z'Z') iN _a '- n _q ' 5 '(ΠΙ), where each of i, j, k and l is independently 0 or 1;

each np, nq and nq ', each of which may or may not be present, independently represents an overhanging nucleotide;

each of p, q and q 'is independently 0-6;

n _p '> 0, and at least one np' is linked to an adjacent nucleotide via a phosphorothioate bond;

each Na and Na 'independently represents an oligonucleotide sequence containing 0-25 nucleotides, which are either modified or not modified, or combinations thereof, each sequence containing at least two modified nucleotides in different ways;

each Nb and Nb 'independently represents an oligonucleotide sequence containing 0-10 nucleotides, which are either modified or not modified, or combinations thereof;

each of XXX, YYY, ZZZ, X'X'X ', Y'Y'Y' and Z'Z'Z 'independently represents one motif of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-Omethyl- or 2'-fluoro modifications;

modifications N _b are different from modification Y, and modifications N _b 'are different from modification Y'; and where the sense strand is conjugated to at least one ligand, wherein the ligand is one or more GalNAc derivatives linked by a divalent or trivalent branched linker.

In another aspect, the present invention provides RNAi agents, for example, double-stranded RNAi agents, capable of inhibiting the expression of proprotein convertase subtilisin / kexin 9 (PCSK9) in a cell, wherein the double-stranded RNAi agent comprises a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region, complementary to a portion of mRNA encoding PCSK9, where each strand is from about 14 to about 30 nucleotides in length, where the double-stranded agent for RNAi is represented by formula (III) sense: 5 'n _p -N _a - (XXX) _r N _b -YYY - N _b - (Ζ ZZ) j -N _a - n _q 3 'antisense: 3' n _p '-N _a ' - (X'X'X ') _k -N _b '-Y'Y'Y'-N _b '- (Z'Z'Z') iN _a '- n _q ' 5 '(Щ), where each of i, j, k and l is independently 0 or 1; each np, nq and nq ', each of which may or may not be present, independently represents an overhanging nucleotide; each of p, q and q 'is independently 0-6;

n _p '> 0, and at least one n _p ' is linked to an adjacent nucleotide via a phosphorothioate bond;

each N _a and N _a 'independently represents an oligonucleotide sequence containing 0-25 nucleotides, which are either modified or not modified, or combinations thereof, each sequence containing at least two modified nucleotides in different ways;

each N _b and N _b 'independently represents an oligonucleotide sequence containing 0-10 nucleotides, which are either modified or not modified, or combinations thereof;

each of XXX, YYY, ZZZ, X'X'X ', Y'Y'Y' and Z'Z'Z 'independently represents one motif of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-Omethyl- or 2'-fluoro modifications;

modifications N _b are different from modification Y, and modifications N _b 'are different from modification Y';

where the semantic thread contains at least one phosphorothioate bond; and where the sense strand is conjugated to at least one ligand, wherein the ligand is one or more GalNAc derivatives linked by a divalent or trivalent branched linker.

In yet another aspect, the present invention provides RNAi agents, for example, double-stranded RNAi agents, capable of inhibiting the expression of proprotein convertase sub-5 037110 tilisin / kexin 9 (PCSK9) in a cell, wherein the double-stranded RNAi agent comprises a sense strand complementary to an antisense strand, where the antisense strand contains a region complementary to a portion of the mRNA encoding PCSK9, where each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded agent for RNAi is represented by formula (III)

Isensory: 5 'n _p -N _a -YYY - N _a - n _q 3' antisense: 3 'n _p ' -N _a '- ΥΎΎ'- N _a ' - n _q '5' (Ша), where each np , nq and nq ', each of which may or may not be present, independently represents an overhanging nucleotide;

each of p, q and q 'is independently 0-6;

n _p '> 0, and at least one np' is linked to an adjacent nucleotide via a phosphorothioate bond;

each Na and Na 'independently represents an oligonucleotide sequence containing 0-25 nucleotides, which are either modified or not modified, or combinations thereof, each sequence containing at least two modified nucleotides in different ways;

each of YYY and Y'Y'Y 'independently represents one motif of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-O-methyl or 2'-fluoromodifications;

where the semantic thread contains at least one phosphorothioate bond; and where the sense strand is conjugated to at least one ligand, wherein the ligand is one or more GalNAc derivatives linked by a divalent or trivalent branched linker.

The present invention also provides cells, vectors, host cells and pharmaceutical compositions containing the double-stranded RNAi agents of the present invention.

In one embodiment, the present invention provides an RNAi agent selected from the group consisting of RNAi agents listed in Table II. 1, 2, 9, 10, 12 and in FIG. 12.

In some embodiments, the RNAi agent is administered using a pharmaceutical composition.

In preferred embodiments, the RNAi agent is administered in solution. In some such embodiments, the siRNA is administered in a non-buffered solution. In one embodiment, the siRNA is administered in water. In other embodiments, the siRNA is administered using a buffer solution such as acetate buffer, citrate buffer, prolamine buffer, carbonate buffer, or phosphate buffer, or any combination thereof. In some embodiments, the buffered saline is phosphate buffered saline (PBS).

In one embodiment, the pharmaceutical compositions further comprise a lipid formulation. In one embodiment, the lipid formulation comprises LNP or XTC. In another embodiment, the lipid formulation comprises MC3.

In one aspect, the present invention provides methods for inhibiting the expression of PCSK9 in a cell. The methods include contacting the cell with an RNAi agent, such as a double-stranded RNAi agent, or a vector according to the present invention and maintaining the cell obtained in step (a) for a time sufficient to cause cleavage of the mRNA transcript of the PCSK9 gene, thereby inhibiting expression of the PCSK9 gene in the cell.

In one embodiment, the cell is in a subject.

In one embodiment, the subject is a human.

In one embodiment, the expression of PCSK9 is inhibited by at least about 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95%.

In another aspect, the present invention provides methods for treating a subject with a PCSK9 expression mediated disorder. The methods include administering to a subject a therapeutically effective amount of an RNAi agent, eg, a double-stranded RNAi agent, or a vector of the present invention, thereby treating the subject.

In one embodiment, the subject is a human.

In one embodiment, the human has hypercholesterolemia.

In one embodiment, an RNAi agent, e.g., a double-stranded RNAi agent, is administered at a dose of about 0.01 mg / kg to about 10 mg / kg, about 0.5 mg / kg to about 50 mg / kg, about 10 mg / kg to about 30 mg / kg, from about 10 mg / kg to about 20 mg / kg, from about 15 mg / kg to about 20 mg / kg, from about 15 mg / kg to about 25 mg / kg, from about 15 mg / kg to about 30 mg / kg, or from about 20 mg / kg to about 30 mg / kg.

In one embodiment, an RNAi agent, eg, a double-stranded RNAi agent, is administered subcutaneously or intravenously.

In one embodiment, the RNAi agent is administered in a dosing regimen that includes a saturation phase followed by a maintenance phase, where the saturation phase includes a dose of 2, 1, or 0.5 mg / kg five times a week, and where the maintenance phase includes a dose of 2, 1 or 0.5 mg / kg

- 6 037110 once, twice or three times a week, once every two weeks, once every three weeks, once a month, once every two months, once every three months, once every four months, once once every five months or once every six months.

In one embodiment, the RNAi agent is administered in two or more doses. In a specific embodiment, the RNAi agent is administered at intervals selected from the group consisting of once about every 12 hours, once about every 24 hours, once about every 48 hours, once about every 72 hours, and once about every 96 hours. h

In yet another aspect, the present invention provides methods for treating hypercholesterolemia in a subject. The methods include administering to a subject a therapeutically effective amount of an RNAi agent, eg, a double-stranded RNAi agent, or a vector of the present invention, thereby treating the subject.

In one embodiment, the subject is a primate or rodent. In another embodiment, the subject is a human.

In one embodiment, an RNAi agent, eg, a double-stranded RNAi agent, is administered at a dose of from about 0.01 mg / kg to about 10 mg / kg, or from about 0.5 mg / kg to about 50 mg / kg. In another embodiment, the double-stranded RNAi agent is administered at a dose of from about 10 mg / kg to about 30 mg / kg.

In one embodiment, an RNAi agent, eg, a double-stranded RNAi agent, is administered subcutaneously or intravenously.

In one embodiment, the RNAi agent is administered in a dosing regimen that includes a saturation phase followed by a maintenance phase, where the saturation phase includes a dose of 2, 1, or 0.5 mg / kg five times a week, and where the maintenance phase includes a dose of 2 , 1 or 0.5 mg / kg once, twice or three times a week, once every two weeks, once every three weeks, once a month, once every two months, once every three months, once once every four months, once every five months, or once every six months.

In one embodiment, the RNAi agent is administered in two or more doses. In a specific embodiment, the RNAi agent is administered at intervals selected from the group consisting of once about every 12 hours, once about every 24 hours, once about every 48 hours, once about every 72 hours, and once about every 96 hours. h

In one embodiment, the methods further comprise determining the LDLR genotype or β-phenotype of the subject.

In one embodiment, administration results in a decrease in serum cholesterol levels in the subject.

In one embodiment, the methods further comprise determining the subject's serum cholesterol level.

The present invention is further illustrated by the following detailed description and drawings.

Brief description of graphic materials

FIG. 1 is a graph showing that a dose-response effect is observed at all three doses tested with the administration of AD-48400 conjugated to GalNAc. AD-48399 conjugated with GalNAc serves as a control;

fig. 2A and 2B are graphs showing the efficacy and duration of in vivo response for indicated siRNAs;

in fig. 3 is a table showing the sequences of sense (SEQ ID NO: 16331642, respectively, in order of occurrence) and antisense (SEQ ID NO: 1643-1652, respectively, in order of occurrence) duplex strands analyzed for in vivo efficacy and for prototype optimization. ;

fig. 4 is a graph showing the results of in vivo efficacy analyzes for prototype optimization;

fig. 5 is a graph showing the results of in vivo dose response analyzes performed on PCSK9 transgenic mice. PCSK9 protein levels were determined by ELISA seventy-two hours after a single dose of 10, 3, 1 and 0.3 mg / kg AD-57928;

fig. 6 is a graph showing the serum levels of PCSK9 protein in PCSK9 transgenic mice after administration of AD-57928 at doses of 5x2 mg / kg during the satiation phase and at doses of 1x2 or 2x2 mg / kg during the maintenance phase;

fig. 7 is a graph showing the serum levels of PCSK9 protein in PCSK9 transgenic mice after administration of AD-57928 at doses of 5x1 mg / kg during the satiation phase and at doses of 1x1 or 2x1 mg / kg during the maintenance phase;

fig. 8 is a graph showing the serum levels of PCSK9 protein in PCSK9 transgenic mice after administration of AD-57928 at doses of 5x0.5 mg / kg during the satiation phase and at doses of 1x0.5 mg / kg or 2x0.5 mg / kg during the phase maintenance;

- 7 037110 fig. 9 is a graph showing the results of in vivo dose response analyzes performed on PCSK9 transgenic mice. PCSK9 protein levels were determined by ELISA seventy-two hours after a single dose of 0.3 mg / kg siRNA;

fig. 10 is a graph showing the number of AD-57928 and AD-58895 per nanogram of mouse liver

C57B6 wild type after administration of a single dose of 1 mg / kg AD-57928 or AD-58895;

fig. 11 is a graph showing the amount of AD-57928 and AD-58895 expressed as% theoretical amount in the liver of wild-type C57B6 mice after administration of a single dose of 1 mg / kg AD-57928 or AD-58895;

in fig. 12A is a table showing mRNA agents of the present invention containing optimized sequences compared to AD-57928 sequences. FIG. 12A discloses sense sequences as SEQ ID NO: 1653-1658, respectively, in order of occurrence and antisense sequences as SEQ ID NO: 1659-1664, respectively, in order of occurrence;

fig. 12B is a graph showing the IC ₅₀ values of the indicated mRNA agents;

fig. 13 is a graph showing the level of said mRNA agent in the liver of wild-type mice after administration of a single dose of 1 mg / kg of said mRNA agent;

fig. 14A is a graph showing the amount of PCSK9 protein in serum of lower primates expressed as a percentage of PCSK9 remaining relative to PCSK9 levels in pre-drawn blood following administration of these mRNA agents at qdx5 + qwx3;

fig. 14B is a graph showing the absolute amount of PCSK9 protein in serum of lower primates following administration of these mRNA agents at qdx5 + qwx3;

fig. 15 is a graph showing the amount of low density lipoprotein cholesterol (LDL or LDLc) in serum of lower primates, expressed as a percentage of remaining LDL in relation to LDL levels in pre-drawn blood, after administration of these mRNA agents at qdx5 + qwx3;

fig. 16A is a graph showing the amount of low density lipoprotein cholesterol (LDL or LDLc) in serum of lower primates, expressed as a percentage of the mean number of LDL levels in pre-sampled blood, after administration of AD-57928 at a dose of 2 mg / kg at q1w and a dose of 1 mg / kg at 2xw;

fig. 16B is a graph showing the amount of PCSK9 protein in serum compared to the amount in pre-sampled blood of lower primates after administration of AD-57928 at a dose of 2 mg / kg at q1w and a dose of 1 mg / kg at 2xw;

fig. 17A is a graph showing the amount of low density lipoprotein cholesterol (LDL or LDLc) in serum of lower primates, expressed as a percentage of the mean number of LDL levels in pre-sampled blood, after administration of AD-57928 at a dose of 2 mg / kg at 2xw and a single dose of 25 mg / kg. The last dose for the 2 mg / kg group at 2xw was administered on day 36;

fig. 17B is a graph showing the amount of PCSK9 protein in serum compared to the amount in pre-sampled blood of lower primates after administration of AD-57928 at a dose of 2 mg / kg at 2xw and a single dose of 25 mg / kg;

fig. 18 is a graph showing the amount of low density lipoprotein cholesterol (LDL or LDLc) in serum of lower primates, expressed as a percentage of remaining LDL relative to LDL levels in pre-drawn blood, after administration of said mRNA agents at qdx5 + qwx3;

fig. 19 is a graph showing the amount of low density lipoprotein cholesterol (LDL or LDLc) in serum of lower primates, expressed as a percentage of remaining LDL relative to LDL levels in pre-drawn blood, after administration of these mRNA agents at qdx5 + qwx3.

Detailed description of the invention

The invention provides compositions containing RNAi agents, eg, double-stranded mRNA agents, targeting PCSK9. Also disclosed are methods of using the compositions of the present invention to inhibit PCSK9 expression and to treat pathologies associated with PCSK9 expression, such as hypercholesterolemia.

I. Definitions.

In order for the present invention to be more easily understood, definitions of the respective terms are first given. In addition, it should be noted that in cases where a value or range of values of a variable is enumerated herein, it is intended that values and ranges in between the enumerated values are also intended to be part of the present invention.

The singular is used herein to denote one or more (ie, at least one) grammatical objects of an article. By way of example, an element means one element or more elements, for example a plurality of elements.

The expression including is used herein to denote the phrase including without limitation and is used interchangeably with it.

An expression is either used herein to denote an expression and / or and is used interchangeably with it, unless the context clearly indicates otherwise.

As used herein, PCSK9 refers to the subtilisin / kexin 9 proprotein convertase gene or the subtilisin / kexin 9 proprotein convertase protein. PCSK9 is also known as FH3, HCHOLA3, NARC-1, or NARC1. The expression PCSK9 includes human PCSK9, the amino acid or nucleotide sequence of which can be found, for example, in GenBank under accession number GI: 299523249; Mouse PCSK9, the amino acid or nucleotide sequence of which can be found, for example, in GenBank under accession number GI: 163644257; Rat PCSK9, the amino acid or nucleotide sequence of which can be found, for example, in GenBank accession number GI: 77020249. Additional examples of PCSK9 mRNA sequences are readily available using, for example, GenBank.

As used herein, the target sequence refers to the contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of the PCSK9 gene, including the mRNA that is the product of the RNA processing of the primary transcription product.

As used herein, the expression “strand containing sequence” refers to an oligonucleotide containing a chain of nucleotides that is characterized by a sequence designated using standard nucleotide nomenclature.

Each of G, C, A and U generally means a nucleotide that contains guanine, cytosine, adenine and uracil as a base, respectively. T and dT are used interchangeably herein and refer to a deoxyribonucleotide where the nucleobase is thymine, for example deoxyribothymine, 2'-deoxythymidine, or thymidine. However, it will be understood that the expression ribonucleotide or nucleotide or deoxyribonucleotide can also mean a modified nucleotide, which is described in more detail below, or a nucleotide mimicking replacement fragment. It is well known to those skilled in the art that guanine, cytosine, adenine, and uracil can be substituted with other moieties without substantially altering the base-pairing properties of the oligonucleotide containing the nucleotide bearing such substitution moiety. For example, without limitation, a nucleotide containing inosine as a base can form a base pair with nucleotides containing adenine, cytosine, or uracil. Therefore, nucleotides containing uracil, guanine or adenine can be substituted in the nucleotide sequences according to the present invention with nucleotides containing, for example, inosine. Sequences containing such replacement fragments are embodiments according to the present invention.

Expressions mRNA, an RNAi agent, an mRNA agent, an RNA interference agent, used interchangeably herein, means an agent that contains RNA in the sense in which that expression is described in this document and which mediates the targeted cleavage of RNA -transcript via the RNA-induced silencing complex (RISC) pathway. mRNA directs sequence-specific destruction of mRNA through a process known as RNA interference (RNAi). mRNA modulates, eg inhibits, the expression of PCSK9 in a cell, eg, a cell of a subject, such as a mammalian subject.

In one embodiment, an RNAi agent of the present invention comprises a single-stranded RNA that interacts with a target RNA sequence, eg, a target PCSK9 mRNA sequence, to direct cleavage of the target RNA. Without wishing to be bound by theory, it is believed that long double-stranded RNA introduced into cells is cut into siRNA by a type III endonuclease known as a diser (Sharp et al. (2001) Genes Dev. 15: 485). Diser, an enzyme similar to type III ribonuclease, is involved in the processing of dsRNA into short interfering RNAs 19-23 bp in length with characteristic two-base overhangs at the 3'-end (Bernstein et al. (2001) Nature 409: 363). The siRNAs are then inserted into an RNA-induced silencing complex (RISC), in which one or more helicases unwind the siRNA duplex, allowing the complementary antisense strand to direct target recognition (Nykanen et al. (2001) Cell 107: 309). After binding to the appropriate target mRNA, one or more endonucleases in the RISC cleave the target to induce silencing (Elbashir et al. (2001) Genes Dev. 15: 188). Thus, in one aspect, the present invention relates to a single-stranded RNA (siRNA) formed within a cell and which facilitates the formation of an RISC complex to effect silencing of a target gene, i. E. gene PCSK9. Accordingly, siRNA expression is also used herein to explain RNAi as described above.

In another embodiment, the RNAi agent can be a single stranded siRNA that is introduced into a cell or organism to inhibit the target mRNA. Single-stranded RNAi agents bind to Argonaute 2, which has edonuclease activity, from RISC, which then cleaves the target mRNA. Single-stranded siRNAs are typically 15-30 nucleotides and chemically

- 9 037110 modified. The design and testing of single stranded siRNAs are described in US Pat. No. 8,101,348 and Lima et al. (2012) Cell 150: 883-894, the entire contents of each of which are hereby incorporated by reference. Any antisense nucleotide sequences described herein can be used as a single stranded siRNA as described herein or which has been chemically modified by methods described in Lima et al. (2012) Cell 150: 883-894.

In another embodiment, the mRNA for use in the compositions, uses and methods of the present invention is double-stranded RNA and is referred to herein as double-stranded RNAi agent, double-stranded RNA molecule (dsRNA), dsRNA agent, or dsRNA agent. The expression dsRNA means a complex of duplex ribonucleic acid molecules containing two counter-parallel and, in fact, complementary nucleic acid strands, considered as having a sense and antisense orientation with respect to the target RNA, i.e. gene PCSK9. In some embodiments of the present invention, double-stranded RNA (dsRNA) triggers the cleavage of a target RNA, eg, mRNA, through a post-transcriptional gene silencing mechanism, referred to herein as RNA interference or RNAi.

In general, most of the nucleotides of each strand of a dsRNA molecule are ribonucleotides, but as described in detail herein, each or both strands can also include one or more non-ribonucleotide nucleotides, such as a deoxyribonucleotide and / or a modified nucleotide. In addition, as used herein, the RNAi agent may include chemically modified ribonucleotides; the RNAi agent can include significant multi-nucleotide modifications. Such modifications may include all types of modifications disclosed herein or known in the art. Any such modifications that are used in a molecule of the siRNA type are encompassed by the expression agent for RNAi in the context of these descriptions and claims.

The two strands forming a duplex structure can be different parts of one larger RNA molecule, or they can be separate RNA molecules. In cases where two strands are part of one larger molecule and, therefore, are connected by an uninterrupted chain of nucleotides from the 3 'end of one strand to the 5' end of the corresponding other strand, forming a duplex structure, connecting the RNA strand is called a hairpin loop. In cases where two strands are covalently connected in a manner other than an uninterrupted chain of nucleotides from the 3'-end of one strand to the 5'-end of the corresponding other strand, forming a duplex structure, the connecting structure is called a linker. RNA strands can have the same or different number of nucleotides. The maximum base pair is the number of nucleotides in the shortest dsRNA strand minus any overhangs that are present in the duplex. In addition to the duplex structure, the RNAi agent may contain one or more nucleotide protrusions.

In one embodiment, the RNAi agent of the present invention is a 24-30 nucleotide dsRNA that interacts with a target RNA sequence, eg, a target PCSK9 mRNA sequence, directing cleavage of the target RNA. Without wishing to be bound by theory, long double-stranded RNA introduced into cells is cut into siRNA by a type III endonuclease known as a diser (Sharp et al. (2001) Genes Dev. 15: 485). Diser, an enzyme similar to type III ribonuclease, is involved in the processing of dsRNA into short interfering RNAs 19-23 bp in length with characteristic two-base overhangs at the 3'-end (Bernstein et al. (2001) Nature 409: 363). The siRNAs are then inserted into an RNA-induced silencing complex (RISC), in which one or more helicases unwind the siRNA duplex, allowing the complementary antisense strand to direct target recognition (Nykanen et al. (2001) Cell 107: 309). After binding to the appropriate target mRNA, one or more endonucleases in the RISC cleave the target to induce silencing (Elbashir et al. (2001) Genes Dev. 15: 188). As used herein, nucleotide overhang means an unpaired nucleotide or nucleotides that protrude from the duplex structure of an RNAi agent when the 3 'end of one strand of an RNAi agent extends beyond the 5' end of another strand, or vice versa. A blunt end or blunt end means that there are no unpaired nucleotides at the end of the double-stranded RNAi agent, i.e. no nucleotide overhang. The tool for blunt-ended RNAi is dsRNA, which is double-stranded along its entire length, i. E. does not have a nucleotide protrusion at either end of the molecule. The RNAi agents of the present invention include RNAi agents with nucleotide overhangs at one end (ie, single-overhang and one blunt-ended means) or with nucleotide overhangs at both ends.

The expression antisense strand means a double-stranded RNAi agent strand that includes a region that is substantially complementary to the target sequence (eg, human PCSK9 mRNA). As used herein, the expression “region complementary to a portion of mRNA encoding transthyretin” refers to a region of an antisense strand that is substantially complementary to a portion of the PCSK9 mRNA sequence. In cases where the complementarity site is not completely complementary to the target sequence, then mismatches are most permissible at the end of 10 037110 sites and, if present, usually occur at the end site or sites, for example, within 6, 5, 4, 3 or 2 nucleotides from the 5'-end and / or 3'-end.

The expression sense strand, as used herein, means a dsRNA strand that includes a region that is essentially complementary to an antisense strand region.

As used herein, the expression cleavage site refers to a site that is adjacent to a cleavage site. Cleavage site is the target site at which cleavage occurs. In some embodiments, the cleavage site contains three bases at either end of the cleavage site and adjacent to it. In some embodiments, the cleavage site contains two bases at either end of the cleavage site and adjacent to it. In some embodiments, the cleavage site is primarily located at a site adjacent to nucleotides 10 and 11 of the antisense strand, and the cleavage site comprises nucleotides 11, 12 and 13.

As used herein, and unless otherwise indicated, the expression complementary when used to describe the first nucleotide sequence with respect to the second nucleotide sequence means the ability of an oligonucleotide or polynucleotide containing the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide containing the second nucleotide sequence, as will be understood by the person skilled in the art. Such conditions, for example, can be stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES, pH 6.4, 1 mM EDTA, 50 or 70 ° C for 12-16 hours, followed by washing. You can apply other conditions, such as physiologically appropriate conditions that may occur in the body. For example, the complementary sequence is satisfactory to allow the proper function of a nucleic acid, eg, RNAi. One skilled in the art will be able to determine the set of conditions most suitable for analyzing the complementarity of two sequences in accordance with the end use of the hybridized nucleotides.

The sequences can be completely complementary to any when there is a base pairing of the first nucleotide sequence with the nucleotides of the second nucleotide sequence along the entire length of the first and second nucleotide sequences. However, when the first sequence is characterized herein as being substantially complementary to the second sequence, then the two sequences may be completely complementary, or they may form one or more, but typically no more than 4, 3, or 2 mismatched base pairs. when hybridizing, while maintaining the ability to hybridize under the conditions most appropriate for their end use. However, when two oligonucleotides are intended to form one or more single-stranded protuberances upon hybridization, such protrusions will not be considered mismatches for purposes of determining complementarity. For example, a dsRNA containing one 21 nucleotide oligonucleotide and another 23 nucleotide oligonucleotide, where the longer oligonucleotide contains a 21 nucleotide sequence that is completely complementary to the shorter oligonucleotide, may be said to be fully complementary for the purposes described herein.

Complementary sequences used herein may also include, or may be formed entirely from non-Watson-Crick base pairs and / or base pairs formed from unnatural and modified nucleotides, to the extent that the above requirements are met. in relation to their ability to hybridize. Such non-Watson-Crick base pairs include, without limitation, ambiguous or Hoogsteen G: U base pairing.

The expressions complementary, fully complementary, and essentially complementary herein can be used to refer to base coincidence between the sense strand and the dsRNA antisense strand, or between the dsRNA antisense strand and the target sequence, as will be understood from the context of their use.

As used herein, a polynucleotide that is substantially complementary to at least a portion of messenger RNA (mRNA) means a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., mRNA encoding PCSK9), including the 5 ' UTR, open reading frame (ORF) or 3'-UTR. For example, a polynucleotide is complementary to at least a portion of the PCSK9 mRNA if the sequence is substantially complementary to a non-interrupting portion of the PCSK9 mRNA.

The expression inhibition as used herein is used interchangeably with contraction, silencing, down-regulation, suppression, and the like, and includes any level of inhibition.

The phrase inhibiting the expression of PCSK9 as used herein includes inhibiting the expression of any PCSK9 gene (such as, for example, the mouse PCSK9 gene, the rat PCSK9 gene, the monkey PCSK9 gene, or the human PCSK9 gene) as well as variants (for example, naturally occurring variants) or mutants of the PCSK9 gene. Thus, the PCSK9 gene can be a wild-type PCSK9 gene,

- 11 037110 mutant PCSK9 gene or transgenic PCSK9 gene in the context of cells, group of cells or organism subjected to genetic manipulation.

Inhibition of the expression of the PCSK9 gene includes any level of inhibition of the PCSK9 gene, for example, at least partial suppression of the expression of the PCSK9 gene, such as, for example, inhibition of at least about 5%, at least about 10%, at least about 15 %, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

Expression of the PCSK9 gene can be assessed based on the level of any variable associated with the expression of the PCSK9 gene, for example, the level of PCSK9 mRNA, the level of the PCSK9 protein, or the levels of blood serum lipids. Inhibition can be assessed by the decrease in the absolute or relative level of one or more of these variables compared to a control level. The control level can be any type of control level that is used in the art, for example, the baseline level before drug administration, or the level determined in a similar subject, cell or sample that has not been treated or treated with a control (such as, for example, a control with only buffer or control with an inactive agent).

The phrase contacting a cell with a double-stranded RNAi agent as used herein includes contacting the cell in any way possible. Contacting the cell with a double-stranded RNAi agent comprises contacting the cell with an RNAi agent in vitro or contacting the cell with an RNAi agent in vivo. Contacting can be done directly or indirectly. Thus, for example, the RNAi agent can be brought into physical contact with the cell by a separate implementation of the method, or, alternatively, the RNAi agent can be placed in an environment that allows the agent to come into contact with the cell or cause it.

In vitro contacting of the cell can be accomplished, for example, by incubating the cell with an RNAi agent. Contacting the cell in vivo can be accomplished, for example, by injecting the RNAi agent into or adjacent to the tissue in which the cell resides, or by injecting the RNAi agent into another area, bloodstream, or subcutaneous space such that the agent will subsequently reach the tissue in which the cell is located, which must be brought into contact with the agent. For example, the RNAi agent may contain and / or be associated with a ligand, eg, a GalNAc3 ligand, which directs the RNAi agent to a site of interest, eg, the liver. Combinations of in vitro and in vivo contacting methods are also possible. With respect to the methods of the invention, the cell can also be contacted with an in vitro RNAi agent and subsequently transplanted into a subject.

The expressions patient or subject as used herein are intended to include either a human or a non-human animal, preferably a mammal, such as a monkey. Most preferably, the subject or patient is a human.

PCSK9-associated disease as used herein is meant to include any disease associated with the PCSK9 gene or protein. Such diseases can be caused, for example, by overproduction of the PCSK9 protein, mutations in the PCSK9 gene, abnormal cleavage of the PCSK9 protein, abnormal interactions between PCSK9 and other proteins, or other endogenous or exogenous substances. Typical PCSK9-associated diseases include types of lipidemia, for example, types of hyperlipidemia and other forms of lipid imbalance such as hypercholesterolemia, hypertriglyceridemia, and pathological conditions associated with these disorders, such as heart disease and circulatory disorders.

A therapeutically effective amount as used herein is meant to include an amount of an RNAi agent that, when administered to a patient to treat a PCSK9-associated disease, is sufficient to effectively treat the disease (e.g., by reducing, ameliorating, or maintaining an existing disease or one or more disease symptoms) ... The therapeutically effective amount may vary depending on the RNAi agent, route of administration, disease and its severity and medical history, age, weight, family history, genetic makeup, stage of pathological processes mediated by PCSK9 expression, types of previous or concomitant treatment, if any. such, and other individual characteristics of the patient to be treated.

A prophylactically effective amount used herein is intended to include

- 12 037110 as including an amount of an RNAi agent that, when administered to a subject who has not yet experienced symptoms of a PCSK9-associated disease, or has not yet developed symptoms, but who may have a predisposition to the disease, is sufficient to prevent or ameliorate the disease or one or several symptoms of the disease. Disease mitigation includes slowing down the course of a disease or reducing the severity of a disease that develops later. The prophylactically effective amount may vary depending on the RNAi agent, the route of administration of the agent, the degree of risk of developing the disease and the history of the disease, age, weight, family history, genetic makeup, types of previous or concomitant treatment, if any, and other individual characteristics of the patient treatment.

A therapeutically effective amount or a prophylactically effective amount also includes an amount of an RNAi agent that induces some desired local or systemic effect with an acceptable benefit / risk ratio adopted with respect to any treatment. The RNAi agents used in the methods of the present invention may be administered in an amount sufficient to obtain an acceptable benefit / risk ratio adopted with respect to such treatment.

The expression sample, as used herein, includes the selection of similar fluids, cells, or tissues isolated from a subject's body, as well as fluids, cells, or tissues present in a subject's body. Examples of body fluids include blood, serum and serous fluids, plasma, cerebrospinal fluid, intraocular fluids, lymph, urine, saliva, and the like. Tissue samples can include tissue, organ, or local tissue samples. For example, samples can be obtained from specific organs, parts of organs, or fluids or cells in those organs. In certain embodiments, samples can be obtained from the liver (eg, the entire liver, or certain segments of the liver, or certain types of liver cells, such as, for example, hepatocytes). In preferred embodiments, the implementation of the sample obtained from the subject means blood or plasma obtained from the subject. In additional embodiments, the implementation of the sample obtained from the subject means liver tissue (or its components) obtained from the subject.

II. mRNA according to the present invention.

This document describes improved double-stranded RNAi agents that inhibit the expression of the PCSK9 gene in a cell, such as a cell of a subject, eg, a mammal, such as a human with lipid disorders, eg hypercholesterolemia, and the use of such double-stranded agents for RNAi.

Double-stranded RNAi agents of the present invention include chemically modified agents as disclosed, for example, in US Provisional Patent Application No. 61/561710, filed November 18, 2011, the entire contents of which are incorporated herein by reference.

As shown in this document and in provisional application No. 61/561710, excellent results can be obtained by introducing one or more motifs of three identical modifications of three consecutive nucleotides into the sense strand and / or antisense strand of the RNAi agent, in particular, into the cleavage site or next to it. In some embodiments, the sense strand and the antisense strand of the RNAi agent can be completely modified in a different way. The introduction of such motifs violates the pattern of modifications, if any, of the semantic and / or antisense thread. An RNAi agent, such as a sense strand, may optionally be conjugated to a GalNAc derivative ligand. The resulting RNAi agents have excellent gene silencing activity.

More specifically, it has surprisingly been found that in cases where the sense strand and the antisense strand of the double-stranded RNAi agent are completely modified to have one or more motifs of three identical modifications of three consecutive nucleotides at the cleavage site of at least one strand of the RNAi agent or near it, then the gene silencing activity of the RNAi agent was best enhanced.

Accordingly, the present invention provides double-stranded RNAi agents capable of inhibiting the expression of a target gene (ie, the subtilisin / kexin 9 (PCSK9) proprotein convertase gene) in vivo. The RNAi agent contains a semantic thread and an antisense thread. Each strand of the RNAi agent can range in length from 12 to 30 nucleotides. For example, each strand can be 14 to 30 nucleotides in length, 17 to 30 nucleotides in length, 25 to 30 nucleotides in length, 27 to 30 nucleotides in length, 17 to 23 nucleotides in length, 17 to 21 nucleotide in length, 17 to 19 nucleotides in length, 19 to 25 nucleotides in length, 19 to 23 nucleotides in length, 19 to 21 nucleotides in length, 21 to 25 nucleotides in length, or 21 to 23 nucleotides in length.

The sense strand and the antisense strand typically form a double-stranded RNA duplex (dsRNA), also referred to herein as the RNAi vehicle. The duplex region of an RNAi agent can be 12-30 base pairs in length. For example, a duplex region can be 14-30 bp in length, 17-30 bp in length, 27-30 bp in length, 17-23 bp in length, 17-21 bp in length, 17-19 pairs nucleotides in length, 19-13,037110 base pairs in length, 19-23 base pairs in length, 19-21 base pairs in length, 21-25 base pairs in length, or 21-23 base pairs in length. In another example, the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 and 27 nucleotides in length.

In one embodiment, the RNAi agent may contain one or more overhangs and / or blocking groups at the 3'-end, 5'-end, or both ends of one or both strands. The protrusion can be 1-6 nucleotides in length, for example 2-6 nucleotides in length, 1-5 nucleotides in length, 2-5 nucleotides in length, 1-4 nucleotides in length, 2-4 nucleotides in length, 1-3 nucleotides in length, 2-3 nucleotides in length or 1-2 nucleotides in length. The protrusions can be the result of one strand being longer than the other, or two strands of the same length staggered. The protrusion can form a mismatch with the target mRNA, or it can be complementary to the gene sequences with which the target interaction occurs, or it can have a different sequence. The first and second strands can also be connected, for example, with additional bases to form a hairpin, or using other linkers that are not bases.

In one embodiment, each of the nucleotides in the overhang of the RNAi agent can independently be a modified or unmodified nucleotide, including, without limitation, with a 2'-modified sugar such as 2-F, 2'-O-methyl, thymidine (T), 2'-O-methoxyethyl5-methyluridine (Teo), 2-O-methoxyethylαdenosine (Ao), 2-O-methoxyethyl-5-methylcytidine (m5Ceo), and any combinations thereof. For example, TT can be a protruding sequence for either end on any strand. The protrusion can form a mismatch with the target mRNA, or it can be complementary to the gene sequences with which the target interaction occurs, or it can have a different sequence.

The 5 'or 3' overhangs of the sense strand, the antisense strand, or both strands of the RNAi agent can be phosphorylated. In some embodiments, the overhang (s) region (s) comprise (contain) two nucleotides with a phosphorothioate between the two nucleotides, and the two nucleotides may be the same or different. In one embodiment, the protrusion is present at the 3 'end of the sense strand, the antisense strand, or both. In one embodiment, this 3 'protrusion is present on the antisense strand. In one embodiment, this 3'-protrusion is present on the sense strand.

The RNAi agent can contain only one protrusion, which can enhance the interfering activity of RNAi without affecting its overall stability. For example, a single-stranded overhang can be located at the 3 'end of the sense strand or, alternatively, at the 3' end of the antisense strand. RNAi can also have a blunt end located at the 5 'end of the antisense strand (or 3' end of the sense strand), or vice versa. Typically, the RNAi antisense strand has a nucleotide overhang at the 3 'end and the 5' end is blunt. While not wishing to be bound by theory, the asymmetric blunt end at the 5 'end of the antisense strand and the protrusion at the 3' end of the antisense strand contribute to the inclusion of the guide strand in the RISC process.

In one embodiment, the RNAi agent is an oligomer with both blunt ends, 19 nucleotides in length, where the sense strand contains at least one motif of three 2'-B modifications of three consecutive nucleotides at positions 7, 8, 9 from 5 'end. The antisense strand contains at least one motif of three 2'-O-methyl modifications of three consecutive nucleotides at positions 11, 12, 13 from the 5'-end.

In another embodiment, the RNAi agent is an oligomer with both blunt ends of 20 nucleotides in length, where the sense strand contains at least one motif of three 2'-B modifications of three consecutive nucleotides at positions 8, 9, 10 from 5 'end. The antisense strand contains at least one motif of three 2'-O-methyl modifications of three consecutive nucleotides at positions 11, 12, 13 from the 5'-end.

In yet another embodiment, the RNAi agent is an oligomer with both blunt ends, 21 nucleotides in length, where the sense strand contains at least one motif of three 2'-B modifications of three consecutive nucleotides at positions 9, 10, 11 from 5'end. The antisense strand contains at least one motif of three 2'-O-methyl modifications of three consecutive nucleotides at positions 11, 12, 13 from the 5'-end.

In one embodiment, the RNAi agent comprises a 21 nucleotide sense strand and a 23 nucleotide antisense strand, wherein the sense strand contains at least one motif of three 2'-B modifications of three consecutive nucleotides at positions 9, 10, 11 from 5 ' -the end; the antisense strand contains at least one motif of three 2'-O-methyl modifications of three consecutive nucleotides at positions 11, 12, 13 from the 5'-end, where one end of the RNAi agent is blunt while the other end contains a protrusion of 2 nucleotides. Preferably, the 2 nucleotide overhang is at the 3 'end of the antisense strand. In cases where an overhang of 2 nucleotides is at the 3 'end of the antisense strand, there may be two phosphorothioate internucleotide bonds between the terminal three nucleotides, with two of the three nucleotides being overhanging nucleotides, and the third nucleotide being a paired nucleotide next to the overhanging nucleotide. In one embodiment, the RNAi agent further comprises two phosphorothioate internucleotide bonds between the terminal three nucleotides at both the 5 'end of the sense strand and the 5' end of the antisense strand. In one embodiment, each nucleotide in the sense strand and antisense strand of the RNAi agent, including nucleotides that are part of motifs, are modified nucleotides. In one embodiment, each residue is independently modified with 2'-O-methyl or 3'-fluoro, for example with an alternating motif. Optionally, the RNAi agent further comprises a ligand (preferably GalNAcs).

In one embodiment, the RNAi agent comprises sense and antisense strands, wherein the RNAi agent comprises a first strand that is at least 25 and at most 29 nucleotides in length, and a second strand that is at most 30 nucleotides in length, at least at least one motif of three 2'-O-methyl modifications of three consecutive nucleotides at positions 11, 12, 13 from the 5'-end; where the 3'-end of the first strand and the 5'-end of the second strand form a blunt end, and the second strand is 1-4 nucleotides longer at the 3'-end than the first strand, where the duplex region is at least 25 nucleotides in length, and the second strand is sufficiently complementary to the target mRNA for at least 19 nucleotides in length of the second strand to reduce the expression of the target gene, where the RNAi agent is introduced into mammalian cells, and where cleavage of the RNAi agent with a dicer preferably results in a siRNA comprising The 3 'end of the second strand, thus reducing the expression of the target gene in a mammal. Optionally, the RNAi agent further comprises a ligand.

In one embodiment, the sense strand of the RNAi agent comprises at least one motif of three identical modifications of three consecutive nucleotides, where one of the motifs is at a cleavage site in the sense strand.

In one embodiment, the antisense strand of the RNAi agent may also contain at least one motif of three identical modifications of three consecutive nucleotides, where one of the motifs is at or near a cleavage site in the sense strand.

For an RNAi agent with a duplex region of 17-23 nucleotides in length, the antisense strand cleavage site is typically about 10, 11 and 12 positions from the 5 'end. Thus, motives of three identical modifications can be in 9, 10, 11 positions; 10, 11, 12 positions; 11, 12, 13 positions; 12, 13, 14 positions or 13, 14, 15 positions of the antisense strand, with the counting starting from the 1st nucleotide from the 5'-end of the antisense strand or the counting starting from the 1st paired nucleotide in the duplex region from the 5'-end of the antisense strand threads. The cleavage site in the antisense strand can also vary according to the length of the RNAi duplex region from the 5 'end.

The sense strand of an RNAi agent may contain at least one motif of three identical modifications of three consecutive nucleotides at the strand cleavage site; and the antisense strand can be characterized by at least one motif of three identical modifications of three consecutive nucleotides at or near the strand cleavage site. Where the sense strand and the antisense strand form a dsRNA duplex, the sense strand and the antisense strand can be aligned such that one of the three nucleotides in the sense strand and one of the three nucleotides in the antisense strand have at least one nucleotide overlap. , i.e. at least one of the three nucleotides of the motif in the sense strand forms a base pair with at least one of the three nucleotides of the motif in the antisense strand. Alternatively, at least two nucleotides may overlap, or all three nucleotides may overlap.

In one embodiment, the sense strand of the RNAi agent may contain multiple motifs of three identical modifications of three consecutive nucleotides. The first motif can be located at or near the thread cleavage site, and the other motifs can be a flanking modification. The expression flanking modification in this document means a motif occurring in another part of the thread, which is separated from the motif at a cleavage site of the same thread or near it. The flanking modification is either adjacent to the first motif or is separated by at least one or more nucleotides. In cases where the motives are directly adjacent to each other, then the chemical structure of the motives is different from each other, and when the motives are separated by one or more nucleotides, then the chemical structures can be the same or different. Two or more flanking modifications may be present. For example, when there are two flanking modifications, then each flanking modification can be at one end with respect to the first motif, which is at or near the cleavage site, or on both sides of the leading motif.

Like a sense strand, an antisense strand of an RNAi agent can contain multiple motifs of three identical modifications of three consecutive nucleotides, with at least one of the motifs located at or near the strand cleavage site. A given antisense strand may also contain one or more flanking modifications in alignment, similar to the flanking modifications that may be present in the sense strand.

In one embodiment, the flanking modification in the sense strand or antisense strand of the RNAi agent typically does not include the first one or first two terminal nucleotides on

3'-end, 5'-end, or both ends of the thread.

In another embodiment, the flanking modification in the sense strand or antisense strand of the RNAi agent typically does not include the first one or first two paired nucleotides in a duplex region at the 3 'end, 5' end, or at both ends of the strand.

In cases where each of the sense strand and the antisense strand of the RNAi agent contains at least one flanking modification, the flanking modifications may occur at the same end of the duplex region and have one, two, or three nucleotide overlaps.

In cases where each of the sense strand and the antisense strand of the RNAi agent contains at least two flanking modifications, the sense strand and the antisense strand can be aligned such that the two modifications, each from one strand, fall on one end of the overlapping duplex region. one, two or three nucleotides; two modifications, each from one strand, fall on the other end of the duplex region with an overlap of one, two or three nucleotides; two modifications of one strand fall on either side of the leading motif with one, two, or three nucleotide overlap in the duplex region.

In one embodiment, each nucleotide in the sense strand and antisense strand of the RNAi agent, including nucleotides that are part of the motifs, can be modified. Each nucleotide can be modified with the same or different modification, which can include one or more changes in one or both unbonded phosphate oxygen atoms and / or one or more linked phosphate oxygen atoms; altering the ribose sugar component, for example the 2'-hydroxyl in the ribose sugar; complete replacement of the phosphate moiety with dephosphorized linkers; modification or substitution of a naturally occurring base; and substitution or modification of the ribose phosphate backbone.

Since nucleic acids are polymers of subunits, many of the modifications occur at a position that is repeated in the nucleic acid, for example, a base modification, or a phosphate moiety, or an unbound O phosphate moiety. In some cases, the modification will occur at all contemplated positions in the nucleic acid, but in many cases it will not. By way of example, the modification can occur only at the 3 'or 5' end position, can occur only at the end region, for example, at the position of the terminal nucleotide or in the last 2, 3, 4, 5 or 10 nucleotides of a strand. The modification can occur in a double-stranded region, in a single-stranded region, or both. The modification can occur only in the double-stranded region of RNA or can occur only in the single-stranded region of RNA. For example, a phosphorothioate modification in the unbound O position can occur only at one or both ends, can occur only at the terminal region, for example, at the position of the terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand, or can occur in a double-stranded and single-stranded sections, in particular at the end. The 5'-end or ends can be phosphorylated.

This may be possible, for example, to improve stability, to incorporate specific bases into the overhangs, or to incorporate modified nucleotides or nucleotide substituents into single-stranded overhangs, such as a 5 'or 3' overhang, or both. For example, it may be desirable to include purine nucleotides in the overhangs. In some embodiments, all or some of the bases in the 3'- or 5'-protrusion can be modified, for example, using the modifications described herein. Modifications may include, for example, the use of modifications at the 2'-position of the ribose sugar by modifications that are known in the art, for example, the use of deoxyribonucleotides, 2'-deoxy-2'-fluoro- (2'-E) or 2'- O-methyl modified in place of the ribose sugar nucleic base, and modifications of the phosphate group, such as modifications of phosphorothioate. The protrusions may not be homologous to the target sequence.

In one embodiment, each sense strand and antisense strand residue is independently modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-deoxy, 2'-hydroxyl or 2'-fluorine. Threads can contain several modifications. In one embodiment, each sense strand and antisense strand residue is independently modified with 2'-O-methyl or 2'-fluorine.

At least two different modifications are typically present in the sense strand and the antisense strand. These two modifications can be 2'-O-methyl or 2'-fluoro modifications or others.

In one embodiment, N _a and / or N _b has alternating pattern modifications. The expression alternating motif, as used herein, means a motif with one or more modifications, with each modification occurring on alternating nucleotides on the same strand. The expression alternating nucleotide can mean one for every two nucleotides, or one for every three nucleotides, or a similar pattern. For example, if each of A, B, and C represents one type of nucleotide modification, then the alternating motif may represent

- 16 037110

The type of modifications contained in an alternating motif can be the same or different. For example, if each of A, B, C, D represents one type of nucleotide modification, then an alternating pattern, i.e. modifications of every second nucleotide may be the same, but each of the sense strand or antisense strand can be selected from several possible modifications in the alternating motif, such as ABABAB ..., ACACAC ..., BDBDBD ... or CDCDCD .. . etc.

In one embodiment, the RNAi agent of the present invention comprises a modification pattern for an alternating sense strand motif shifted relative to a modification pattern for an alternating antisense strand motif. The shift may be such that the modified group of nucleotides of the sense strand corresponds to the otherwise modified group of nucleotides of the antisense strand, and vice versa. For example, when a sense strand is paired with an antisense strand in a dsRNA duplex, an alternating motif in a sense strand may start with ABABAB from the 5'- to 3'-end of the strand, and an alternating motif in an antisense strand may start with BABABA from 5 'to 3'- end of the thread in the duplex section. As another example, an alternating motif in a semantic strand may start with AABBAABB from the 5 'to the 3' end of the strand, and an alternating motif in an antisense strand may start with BBAABBAA from the 5 'to 3' end of the strand in the duplex section, so that there is a complete or partial shift in modification patterns between the semantic thread and the antisense thread.

In one embodiment, the agent for RNAi initially contains an alternating 2'-O-methyl modification and 2'-P modification pattern in the sense strand and initially has a shift in relation to an alternating 2'-O-methyl modification and 2 ' -F modifications in the antisense strand, i.e. A 2'-O-methyl-modified nucleotide in base pairs of a sense strand with a 2'-F-modified nucleotide in an antisense strand and vice versa. Position 1 in the sense strand may start with a 2'-F modification, and position 1 in the antisense strand may start with a 2'-Omethyl modification.

The introduction of one or more motifs of three identical modifications of three consecutive nucleotides into the sense strand and / or antisense strand violates the original pattern of modifications present in the sense strand and / or antisense strand. This disruption in the pattern of modifications of the sense and / or antisense strand by introducing one or more motifs of three identical modifications of three consecutive nucleotides into the sense and / or antisense strand unexpectedly increases gene silencing activity against the target gene.

In one embodiment, in cases where a motif of three identical modifications of three consecutive nucleotides is introduced into any of the strands, the modification of the nucleotide following the motif is a modification other than the modification of the motif. For example, the part of the sequence containing the motif is ... NaYYYNb ..., where Y is a modification of a motif of three identical modifications of three consecutive nucleotides, and N _a and Nb are a modification of the nucleotide following the YYY motif, which is different from modifications Y, and where N _a and N _b may be the same or different modifications. Alternatively, N _a and / or N _b may or may not be present when a flanking modification is present.

The RNAi agent may further comprise at least one phosphorothioate or methylphosphonate internucleotide bond. Modification of a phosphorothioate or methylphosphonate internucleotide bond can occur at any nucleotide of a sense strand, or an antisense strand, or both strands at any position in the strand. For example, modification of internucleotide linkage can occur at each nucleotide of the sense strand and / or antisense strand; each modification of the internucleotide bond can occur in an alternating pattern in the sense strand and / or antisense strand; or the sense strand or antisense strand may contain both modifications of the internucleotide bond in an alternating pattern. The alternating pattern of modification of the internucleotide bond of the sense strand may be the same or different from the antisense strand, and the alternating pattern of modification of the internucleotide bond of the sense strand may be characterized by a shift relative to the alternating pattern of modification of the internucleotide bond of the antisense strand.

In one embodiment, the RNAi has a modification of a phosphorothioate or methylphosphonate internucleotide bond in the overhang. For example, the overhang may contain two nucleotides with a phosphorothioate or methylphosphonate internucleotide bond between the two nucleotides.

Internucleotide linkage modifications can also be performed to link the overhanging nucleotides to the terminal paired nucleotides in the duplex region. For example, at least 2, 3, 4, or all of the overhanging nucleotides may be linked via a phosphorothioate or methylphosphonate internucleotide bond and, optionally, additional phospho

- 17 037110 thioate or methylphosphonate internucleotide bonds connecting the overhanging nucleotide to the paired nucleotide that follows the overhanging nucleotide. For example, there can be at least two phosphorothioate internucleotide bonds between the terminal three nucleotides, where two of the three nucleotides are overhanging nucleotides and the third is a paired nucleotide adjacent to the overhanging nucleotide. These terminal three nucleotides can be at the 3 'end of the antisense strand, the 3' end of the sense strand, the 5 'end of the antisense strand, and / or the 5' end of the antisense strand.

In one embodiment, a 2 nucleotide overhang is at the 3 'end of the antisense strand, and two phosphorothioate internucleotide bonds are present between the terminal three nucleotides, with two of the three nucleotides being overhanging nucleotides and the third nucleotide being a paired nucleotide adjacent to the overlying nucleotide. Optionally, the RNAi agent may further have two phosphorothioate internucleotide bonds between the terminal three nucleotides at both the 5 'end of the sense strand and the 5' end of the antisense strand.

In one embodiment, the RNAi agent comprises a mismatch (s) with a target in a duplex, or a combination thereof. The mismatch can occur in a raised section or a duplex section. Base pairs can be aligned based on their tendency to promote dissociation or melting (for example, based on the free energy of association or dissociation of a particular pairing, the simplest approach is to study the pairs on individual base pairs, although analysis of the next adjacent pair or similar can also be performed). In terms of promoting dissociation: A: U is preferred over G: C; G: U is preferred over G: C; a!: C is preferred over G: C (1 = inosine). Mismatches, such as non-canonical or non-canonical pairing types (which are described elsewhere in this document) are preferred over canonical pairing types (A: T, A: U, G: C); and pairing types that include universal bases are preferred over canonical pairing types.

In one embodiment, the RNAi agent comprises at least one of the first 1, 2, 3, 4, or 5 base pairs in duplex regions from the 5 'end of the antisense strand independently selected from the group consisting of A: U, G: U , X: C and mismatched pairs, such as non-canonical or non-canonical pairing types, or pairing types that include universal bases, to facilitate dissociation of the antisense strand at the 5 'end of the duplex.

In one embodiment, the nucleotide at position 1 in the duplex region from the 5 'end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first 1, 2, or 3 base pairs in the duplex region from the 5 'end of the antisense strand is an AU base pair. For example, the first base pair in the duplex region from the 5 'end of the antisense strand is the AU base pair.

In one embodiment, the sequence of the sense strand can be represented by the formula (I)

where each of i and j is independently 0 or 1;

each of p and q is independently 0-6;

each Na independently represents an oligonucleotide sequence containing 025 modified nucleotides, each sequence containing at least two modified nucleotides in different ways;

each Nb is independently an oligonucleotide sequence containing 010 modified nucleotides;

each np and n _q independently represents an overhanging nucleotide;

where Nb and Y have different modifications; and each of XXX, YYY and ZZZ independently represents one motif of three identical modifications of three consecutive nucleotides. Preferably, in YYY, all nucleotides 2'-F are modified.

In one embodiment, N _a and / or N _b has alternating pattern modifications.

In one embodiment, the YYY motif is at or adjacent to the sense strand cleavage site. For example, if the agent for RNAi contains a duplex region that is 17-23 nucleotides in length, then the YYY motif can be located at or near the cleavage site (for example, it can be located at positions 6, 7, 8, 7, 8, 9, 8, 9, 10, 9, 10, 11, 10, 11, 12 or 11, 12, 13) in a sense strand, with the counting starting from the 1st nucleotide from the 5'-end or, optionally, starting from the ^1st paired nucleotide in the duplex region from the 5'-end.

In one embodiment, i equals 1, a j equals 0, or i equals 0, a j equals 1, or both i and j equals 1. The sense thread can thus be represented by the following formulas:

- 18 037110

5 'Pr-Na-YYY-Nb-ZZZ-N _a -n _q 3'(lb);

5 'n _p -Na-XXX-Nb-YYY-N _a -n _q 3'(Ic); or

5 'Pr-Na-XXX-Nb-YYY-Nb-ZZZ-N _a -n _q 3' (Id).

Where the sense strand is represented by formula (Ib), N _b is an oligonucleotide sequence containing 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. Each N _a can independently be an oligonucleotide sequence containing 2-20, 2-15, or 2-10 modified nucleotides.

Where the sense strand is represented by formula (Ic), N _b is an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. Each Na can independently be an oligonucleotide sequence containing 2-20, 2-15, or 2-10 modified nucleotides.

Where the sense strand is represented by formula (Id), each N _{b is} independently an oligonucleotide sequence containing 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. Preferably, N _b is 0, 1, 2, 3, 4, 5, or 6. Each N _a can independently be an oligonucleotide sequence containing 2-20, 2-15, or 2-10 modified nucleotides.

Each of X, Y and Z can be the same or different from the others.

In other embodiments, i equals 0, a j equals 0, and the sense thread can be represented by the formula

5 'Pr-Na-YYY-Na-n _q 3' (la).

In cases where the sense strand is represented by formula (Ia), N _a, each independently may represent an oligonucleotide sequence having 2-20, 2-15 or 2-10 nucleotides modified.

In one embodiment, the RNAi antisense strand sequence can be represented by formula (II)

5 'n _q ' -Na '- (Z'Z'Z') _k -N _b '-Y'Y'Y'-N _b ' - (X'X'X ') i-N'a-n _p '3' (II), where each of k and l is independently 0 or 1;

each of p 'and q' is independently 0-6;

each N _a 'independently represents an oligonucleotide sequence containing 0-25 modified nucleotides, each sequence containing at least two modified nucleotides in different ways;

each N _b 'is independently an oligonucleotide sequence containing 0-10 modified nucleotides;

each n _p 'and n _q ' independently represents a protruding nucleotide;

where N _b 'and Y' have an unequal modification; and each of X'X'X ', Y'Y'Y' and Z'Z'Z 'independently represents one motif of three identical modifications of three consecutive nucleotides.

In one embodiment, N _a 'and / or N _b ' have alternating pattern modifications.

The Y'Y'Y 'motif is located at or near the antisense strand cleavage site. For example, if the RNAi agent contains a duplex region that is 17-23 nucleotides in length, then the Y'Y'Y 'motif may be at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14 or 13, 14, 15 of the antisense strand, where the counting starts from the 1st nucleotide from the 5'-end, or, optionally, the counting starts from the 1st paired nucleotide in the duplex region from the 5'-end. Preferably, the Y'Y'Y 'motif is located at positions 11, 12, 13.

In one embodiment, in the Y'Y'Y 'motif, all nucleotides of the 2'-OMe are modified.

In one embodiment, k equals 1 and l equals 0, or k equals 0 and l equals 1, or both k and l equals 1.

The antisense thread can thus be represented by the following formulas:

5'nq'-Na'-Z'Z'Z'-Nb'-Y'Y'Y'-Na'-np'3 '(Ub);

5 'n _q '-Na'-Y'Y'Y'-N _b '-X'X'X'-n _P ' 3 '(Ps); or

5 'n _q , -N _a ' - Z'Z'Z'-N _b '-Y'Y'Y'-N _b ' - X'X'X'-N _a '-n _p >3' (lid ).

Where the antisense strand is represented by formula (IIb), N _b is an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. Each N _a 'is independently an oligonucleotide sequence containing 2-20, 2-15, or 2-10 modified nucleotides.

Where the antisense strand is represented by formula (IIc), Nb 'is an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. Each N _a 'is independently an oligonucleotide sequence containing 2-20, 2-15, or 2-10 modified nucleotides.

- 19 037110

Where the antisense strand is represented by formula (IId), each Nb 'is independently an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 02, or 0 modified nucleotides. Each N _a 'is independently an oligonucleotide sequence containing 2-20, 2-15, or 2-10 modified nucleotides. Preferably, N _b is 0, 1, 2, 3, 4, 5, or 6.

In other embodiments, k is 0 and l is 0 and the antisense thread can be represented by the formula

5'np'-Na'-ΥΎΎ'-Na'-n _q '3' (la).

Where the antisense strand is represented by formula (IIa), each N _a 'is independently an oligonucleotide sequence containing 2-20, 2-15, or 2-10 modified nucleotides.

Each of X ', Y' and Z 'can be the same or different from the others.

Each nucleotide of the sense strand and antisense strand can independently be modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-hydroxyl, or 2 ' fluorine. For example, each nucleotide of the sense strand and antisense strand is independently modified with 2'-O-methyl or 2'-fluorine. Each X, Y, Z, X ', Y' and Z ', in particular, can be a 2'-Omethyl modification or a 2'-fluoro modification.

In one embodiment, the sense strand of the RNAi agent may comprise a YYY motif at the 9, 10, and 11 positions of the strand, in cases where the duplex region is 21 nucleotides, wherein the count starts from 1 nucleotide from the 5 'end, or optionally, the count starts from the 1st paired nucleotide in the duplex region from the 5'-end; and Y is a 2'-F modification. The sense strand may further comprise the XXX motif or ZZZ motifs as flanking modifications at the opposite end of the duplex region; and each of XXX and ZZZ is independently a 2'-OMe modification or a 2'-F modification.

In one embodiment, the antisense strand may contain a Y'Y'Y 'motif located at positions 11, 12, 13 of the strand, with the counting starting from the 1st nucleotide from the 5'end, or, optionally, starting from the 1st a paired nucleotide in a duplex region from the 5'-end; and Y 'is the 2'-O-methyl modification. The antisense strand may further comprise an X'X'X 'motif or Z'Z'Z' motifs as flanking modifications at the opposite end of the duplex region; and each of X'X'X 'and Z'Z'Z' is independently a 2'-OMe modification or a 2'-F modification.

The sense strand represented by any of the above formulas (Ia), (Ib), (Ic) and (Id) forms a duplex with the antisense strand represented by any of the formulas (IIa), (IIb), (IIc) and (IId), respectively ...

Accordingly, agents for RNAi for use in the methods of the present invention may contain a sense strand and an antisense strand, each strand containing from 14 to 30 nucleotides, the duplex for RNAi represented by formula (III) is a sense:

antisense:

5 'n _p -N _a - (XXX). -N _b - YYY -N _b - (Ζ Ζ Z) _r N _a -n _q 3 '

3 'n _p X4x'X'XVN _b -YYY'-Nb ^ Z'ZZVN _a -n _q 5', (ΠΙ), where each of i, j, k and l is independently 0 or 1;

each of p, p ', q and q' is independently 0-6;

each N _a and N _a independently represent an oligonucleotide sequence containing 0-25 modified nucleotides, each sequence containing at least two modified nucleotides in different ways;

each N _b and N _b 'independently represents an oligonucleotide sequence containing 0-10 modified nucleotides;

where each n _p ', n _p , n _q ' and n _q , each of which may or may not be present, independently represents a protruding nucleotide; and each of XXX, YYY, ZZZ, X'X'X ', Y'Y'Y' and Z'Z'Z 'independently represents one motif of three identical modifications of three consecutive nucleotides.

In one embodiment, i is 0 and j is 0; or i equals 1 and j equals 0; or i equals 0 and j equals 1; or both i and j are 0; or both i and j are 1. In another embodiment, k is 0 and l is 0; or k equals 1 and l equals 0; k equals 0 and l equals 1; or both k and l are 0; or both k and l are equal to 1.

Exemplary combinations of sense strand and antisense strand duplexing for RNAi include the formulas below

- 20 037110

5'n _p - N _a -YY YN _a -n _q 3 '3' n _p -N _a '-YYY -N _a n _q 5' (Ша),

5 'n _p -N _a -Υ YY -N _b -Ζ Ζ Ζ -N _a -n _q 3'

3 'η _ρ -N _a -ΥΎΎ'-Nb-Z'Z'Z'-N _a n _q 5' (Illb),

5 'n _p -N _a - XXX -N _b -Υ YY - N _a -n _q 3'

3 'n _p -N _a -X'X'X'-N _b -Y'Y'Y'-N _a -n _q 5' (Shs),

5 'n _p -N _a -XXX -N _b -YYY -N _b - Ζ Ζ Z -N _a -n _q 3' 3 'n _p ' -N _a '-X'X'X'-Nb'-Y 'Y'Y'-Nb'-Z'Z'Z'-N _a -n _q ' 5 '(Hid).

In those cases where the means for RNAi represented by the formula (IIIa), N _a each independently represents an oligonucleotide sequence comprising 2-20, 2-15 or 2-10 nucleotides modified.

Where the RNAi agent is represented by formula (IIIb), each N _{b is} independently an oligonucleotide sequence containing 1-10, 1-7, 1-5, or 1-4 modified nucleotides. Each N _{a is} independently an oligonucleotide sequence containing 2-20, 2-15, or 2-10 modified nucleotides.

Where the agent for RNAi is represented by formula (IIIc), each Nb, Nb 'is independently an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4 , 02 or 0 modified nucleotides. Each N _{a is} independently an oligonucleotide sequence containing 2-20, 2-15, or 2-10 modified nucleotides.

Where the agent for RNAi is represented as formula (IIId), each N _b , N _b 'is independently an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. Each N _a , N _a 'is independently an oligonucleotide sequence containing 2-20, 2-15, or 2-10 modified nucleotides. Each of N _a , N _a ', N _b and N _b ' independently contains modifications of the alternating pattern.

Each of X, Y and Z in formulas (III), (IIIa), (IIIb), (IIIc) and (IIId) may be the same or different from the others.

Where the RNAi agent is represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), at least one of the Y nucleotides may base-pair with one of the Y ′ nucleotides. Alternatively, at least two of the Y nucleotides form base pairs with the corresponding Y 'nucleotides; or all three of the Y nucleotides form base pairs with the corresponding Y 'nucleotides.

Where the RNAi agent is represented by formula (IIIb) or (IIId), at least one of the Z nucleotides may base pair with one of the Z ′ nucleotides. Alternatively, at least two of the Z nucleotides form base pairs with the corresponding Z 'nucleotides; or all three of the Z nucleotides form base pairs with the corresponding Z 'nucleotides.

Where the RNAi agent is represented by formula (IIIc) or (IIId), at least one of the X nucleotides may base pair with one of the X ′ nucleotides. Alternatively, at least two of the X nucleotides form base pairs with the corresponding X ′ nucleotides; or all three of the X nucleotides form base pairs with the corresponding X 'nucleotides.

In one embodiment, the modification of the Y nucleotide is different from the modification of the Y 'nucleotide, the modification of the Z nucleotide is different from the modification of the Z' nucleotide, and / or the modification of the X nucleotide is different from the modification of the X 'nucleotide.

In one embodiment, in cases where the means for RNAi represented by the formula (IIId), N _a modifications are 2'-O-methyl or 2'-fluoro-modification. In another embodiment, in cases where the means for RNAi represented by the formula (IIId), N _a modifications are 2'-O-methyl or 2'-fluoro-modification, and np '> 0, and at least one np' linked to an adjacent nucleotide through a phosphorothioate bond. In yet another embodiment, in cases where the means for RNAi represented by the formula (IIId), N _a modifications are 2'-O-methyl or 2'-ftormodifikatsii, n _p '> 0, and at least one np' is connected with an adjacent nucleotide via a phosphorothioate bond, and the sense strand is conjugated to one or more GalNAc derivatives linked via a bivalent or trivalent branched linker. In another embodiment, when the agent for RNAi is represented by formula (IIId), modifications-21 037110 n _a are 2'-O-methyl- or 2'-fluoro modifications, np '> 0, and at least one np 'is linked to an adjacent nucleotide via a phosphorothioate bond, the sense strand contains at least one phosphorothioate bond, and the sense strand is conjugated to one or more derivatives

GalNAc linked by a divalent or trivalent branched linker.

In one embodiment, in cases where the means for RNAi represented by the formula (IIIa), N _a modifications are 2'-O-methyl or 2'-fluoro-modification, np '> 0, and at least one n _p' is linked to an adjacent nucleotide via a phosphorothioate bond, the sense strand contains at least one phosphorothioate bond, and the sense strand is conjugated to one or more GalNAc derivatives linked via a bivalent or trivalent branched linker.

In one embodiment, the RNAi agent is a multimer comprising at least two duplexes represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), wherein the duplexes are linked by a linker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes, or each of the duplexes can target the same gene at two different target sites.

In one embodiment, the RNAi agent is a multimer containing three, four, five, six, or more duplexes represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), wherein the duplexes are linked by a linker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes, or each of the duplexes can target the same gene at two different target sites.

In one embodiment, two RNAi agents represented by formula (III), (IIIa), (IIIb), (IIIc) and (IIId) are connected to each other at the 5'-end, and one or both 3'-ends are optionally conjugated to the ligand. Each of the funds can target the same gene or two different genes, or each of the funds can target the same gene at two different target sites.

Various publications describe multimeric RNAi agents that can be used in the methods of the present invention. Such publications include WO 2007/091269, US Patent No. 7858769, WO 2010/141511, WO 2007/117686, WO 2009/014887 and WO 2011/031520, the entire contents of which are hereby incorporated by reference.

An RNAi agent containing one or more carbohydrate moieties conjugated to an RNAi agent may enhance one or more properties of the RNAi agent. In many cases, the carbohydrate moiety will be attached to the modified RNAi agent subunit. For example, the ribose sugar of one or more of the ribonucleotide subunits of the dsRNA agent can be substituted with other moieties, eg, a non-carbohydrate (preferably cyclic) carrier to which the carbohydrate ligand is attached. A ribonucleotide subunit in which the ribose sugar of the subunit has been substituted in this manner is referred to herein as a ribose substitution modification (RRMS) subunit. The cyclic support can be a carbocyclic ring system, i. E. all atoms in the ring are carbon atoms, or a heterocyclic ring system, i.e. one or more ring atoms can be heteroatoms, for example nitrogen, oxygen, sulfur. The cyclic support can be a monocyclic ring system or can contain two or more rings, for example fused rings. The cyclic support can be a fully saturated ring system or it can contain one or more double bonds.

The ligand can be linked to the polynucleotide via a carrier. The carriers include (i) at least one point of attachment to the backbone, preferably two points of attachment to the backbone, and (ii) at least one point of attachment to the backbone. The expression point of attachment to the backbone, as used herein, means a functional group, for example a hydroxyl group, or, as a rule, a bond available for the introduction of a carrier into the backbone and which is suitable for this, for example, a phosphate or a modified phosphate, for example, a sulfur-containing ribonucleic backbone. acid. The expression linking point of attachment (TAP) in some embodiments means a ring-ringed atom of a cyclic support, for example, a carbon atom or a heteroatom (other than the atom that provides the point of attachment to the backbone) to which the selected moiety binds. The moiety can be, for example, a carbohydrate, for example a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and polysaccharide. Optionally, the selected fragment is interconnected with a cyclic support. Thus, the cyclic support will often include a functional group, such as an amino group, or typically provide a bond that is suitable for introducing or linking another chemical entity, such as a ligand, to the compound ring.

RNAi agents can be conjugated to a ligand via a carrier, where the carrier can be a cyclic group or an acyclic group; preferably the cyclic group is selected from pyr

- 22 037110 rolidinil, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3] -dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, tetiazolidinyl, isothiazolidinylinyl; preferably the acyclic group is selected from a serinol backbone or diethanolamine backbone.

In certain specific embodiments, the RNAi agent for use in the methods of the present invention is an agent selected from the group consisting of those listed in Table II. 1 and 2.

Such agents may additionally contain a ligand.

A. Ligands.

The double-stranded RNA (dsRNA) agents of the present invention may optionally be conjugated to one or more ligands. The ligand can be attached to a sense strand, an antisense strand, or both strands at the 3 'end, 5' end, or both. For example, a ligand can be conjugated to a sense strand. In preferred embodiments, the ligand is conjugated to the 3 'end of the sense strand. In one preferred embodiment, the ligand is a GalNAc ligand. In particularly preferred embodiments, the ligand is GalNAc ₃

In some embodiments, a ligand, eg, a GalNAc ligand, is attached to the 3 'end of the RNAi agent. In one embodiment, the RNAi agent is conjugated to a ligand, e.g., a GalNAc ligand, as shown in the following diagram:

where X is O or S. In one embodiment, X is O.

A wide variety of building blocks can be coupled to the RNAi agents of the present invention. Preferred moieties are ligands that are linked, preferably covalently, either directly or indirectly via an intermediate linking moiety.

In preferred embodiments, the ligand changes the distribution, targeting, or lifetime of the molecule into which it is introduced. In preferred embodiments, the implementation of the ligand provides increased affinity for the selected target, for example, a molecule, cell or cell type, compartment, receptor, for example, a cell compartment or part of an organ, tissue, organ or body region, for example, compared to species that lack such ligand. Ligands that provide increased affinity for a selected target are also referred to as targeting ligands.

Some ligands may have endosomolytic properties. Endosomolytic ligands facilitate endosome lysis and / or transport of the composition according to the present invention or its

- 23 037110 components from the endosome into the cytoplasm of the cell. The endosomolytic ligand can be a polyanionic peptide or peptidomimetic that exhibits pH-dependent membrane activity and fusogenicity. In one embodiment, the endosomolytic ligand assumes an active conformation at endosomal pH. An active conformation is one in which the endosomolytic ligand facilitates the lysis of the endosome and / or the transport of the composition according to the present invention or its components from the endosome into the cytoplasm of the cell. Exemplary endosomolytic ligands include the GALA peptide (Subbarao et al., Biochemistry, 1987, 26: 29642972), the EALA peptide (Vogel et al., J. Am. Chem. Soc, 1996, 118: 1581-1586) and derivatives thereof (Turk et al., Biochem. Biophys. Acta, 2002,1559: 56-68). In one embodiment, the endosomolytic component may contain a chemical group (eg, an amino acid) that will undergo changes in charge or protonation in response to changes in pH. The endosomolytic component can be linear or branched.

Ligands can improve transport, hybridization and specificity properties, and can also improve nuclease resistance of the resulting natural or modified oligonucleotide or polymer molecule containing any combination of monomers described herein and / or natural or modified ribonucleotides.

Ligands can typically include therapeutic modifiers, for example, to enhance uptake; diagnostic connections or reporter groups, for example for tracking distribution; cross-linking agents and nuclease-resistant fragments. Common examples include lipids, steroids, vitamins, sugars, proteins, peptides, polyamines, and peptide mimetics.

The ligands can include a naturally occurring substance such as a protein (eg, human serum albumin (HSA), low density lipoprotein (LDL), high density lipoprotein (HDL), or globulin); a carbohydrate (eg dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid) or a lipid. The ligand can also be a recombinant or synthetic molecule such as a synthetic polymer, for example, a synthetic polyamino acid, an oligonucleotide (for example, an aptamer). Examples of polyamino acids include polyamino acid, which is polylysine (PLL), poly-B-aspartic acid, poly-B-glutamic acid, copolymer of styrene and maleic anhydride, copolymer of L-lactide and glycolide, copolymer of divinyl ether and maleic acid ( 2-hydroxypropyl) meacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly (2-ethyl acrylic acid), Nisopropyl acrylamide polymers, or polyphosphazine. Examples of polyamines include: polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide polyamine, polyamine peptidomimetic, polyamine dendrimer, arginine, amidine, protamine, cationic lipid, cationic porphyrin, polyamine quaternary salt, or α-helical peptide.

Ligands also include targeting groups, eg, a cell or tissue targeting agent, eg, a lectin, glycoprotein, lipid, or protein, eg, an antibody, that binds to a specific cell type, such as a kidney cell. The targeting group can be thyrotropin, melanotropin, lectin, glycoprotein, surface protein A, carbohydrate-mucin, polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetylglucosamine, polyvalent mannose, polyvalent fucose, glycosylated polyamines polyglutamate, polyaspartate, lipid, cholesterol, steroid, bile acid, folate, vitamin B12, biotin, RGD peptide, RGD peptide mimetic, or aptamer.

Other examples of ligands include dyes, intercalating agents (eg acridines), crosslinking agents (eg psoralen, mitomycin C), porphyrins (TPPC4, texafirin, sapphirin), polycyclic aromatic hydrocarbons (eg phenazine, dihydrophenazine), artificial endonucleases or chelator e.g. EDTA), lipophilic molecules, e.g. cholesterol, cholic acid, adamantane acetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O (hexadecyl) glycerol, geranyloxyhexyl group, hexadecyl-glycerol, borneol, manneol , heptadecyl group, palmitic acid, myristic acid, O3- (oleoyl) lithochlic acid, O3- (oleoyl) cholic acid, dimethoxytrityl or phenoxazine and peptide conjugates (e.g. antennapedia peptide, Tat peptide), alkylating agents, phosphate, amine mercapto, PEG (eg PEG-40K), MPEG, [MPEG] 2, polyamino, alkyl, substituted alkyl, radiolabelled markers, enzymes, haptens (eg biotin), helpers transport / absorption (e.g. aspirin, vitamin E, folic acid), synthetic ribonucleotides (e.g. imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3 complex + tetraazamacrocycles), dinitrophenyl, HRP or AP.

Ligands can be proteins, for example, glycoproteins, or peptides, for example, molecules with specific affinity for a co-ligand, or antibodies, for example, an antibody that binds to a specific cell type, such as a cancer cell, endothelial cell, or bone cell. Ligands can also include hormones and hormone receptors. They can also include species other than peptides such as lipids, lectins, carbohydrates, vitamins, cofactors, polyvalent

- 24 037110 glucose, polyvalent galactose, N-acetylgalactosamine, N-acetylglucosamine, polyvalent mannose, polyvalent fucose or aptamers. The ligand, for example, can be a lipopolysaccharide, a p38 MAP kinase activator, or an NF-kB activator.

The ligand can be a substance, for example a drug, that can increase the uptake of an mRNA agent by a cell, for example by disrupting the cytoskeleton of a cell, for example by disrupting microtubules, microfilaments and / or intermediate filaments of a cell. The drug, for example, can be taxon, vincristine, vinblastine, cytochalasine, nocodazole, yaplakinolide, latrunculin A, phalloidin, swingolide A, indanocin, or myoservin.

The ligand can increase the uptake of the oligonucleotide by the cell, for example, by activating an inflammatory response. Illustrative ligands that will have this effect include tumor necrosis factor α (TNF-a), interleukin-1-β, or γ-interferon.

In one aspect, the ligand is a lipid or lipid molecule. Such lipids or lipid molecules preferentially bind to a whey protein such as human serum albumin (HSA). The ligand binding to HSA allows the distribution of the conjugate to a target tissue, for example, other than the kidney tissue of the target tissue of the body. For example, the target tissue can be the liver, including liver parenchymal cells. Also other molecules that can bind to HSA can be used as ligands. For example, you can use naproxen or aspirin. A lipid or lipid ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport to a target cell or cell membrane, and / or (c) can be used to adjust binding to a whey protein such as HSA.

The lipid ligand can be used to modulate, for example, regulate the binding of the conjugate to the target tissue. For example, it is less likely that a lipid or lipid ligand that binds to HSA more strongly will target the kidney and thus less likely to be cleared from the body. A lipid or lipid ligand that binds less strongly to HSA can be used to target the conjugate to the kidney.

In a preferred embodiment, the lipid ligand binds to HSA. Preferably, it binds to HSA with sufficient affinity such that the conjugate will be preferentially distributed in tissue other than kidney tissue.

However, it is preferred that the affinity is not so strong that the binding of the HSA ligand is irreversible.

In another preferred embodiment, the lipid ligand binds little or no to HSA, so that the conjugate will be preferentially distributed in the kidney. Other fragments that target kidney cells can also be used instead of or in addition to lipid ligands.

In another aspect, the ligand is a moiety, eg, a vitamin, that is taken up by a target cell, eg, a proliferating cell. These are particularly useful for the treatment of disorders characterized by unwanted cell proliferation, for example of a malignant or benign type, for example of cancer cells. Exemplary vitamins include vitamins A, E, and K. Other exemplary vitamins include B vitamins such as folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients absorbed by cancer cells. Also included are HAS, low density lipoprotein (LDL) and high density lipoprotein (HDL).

In another aspect, the ligand is a cell penetration agent, preferably a helical cell penetration agent. Preferably, the agent is amphipathic. An illustrative agent is a peptide such as tat or antennopedia. If the agent is a peptide, then it can be modified, including a peptidyl mimetic, invertomers other than peptide or pseudopeptide bonds, and the use of D-amino acids. The coiled agent is preferably an α-helical agent, which is preferably characterized by a lipophilic and lipophobic phase.

The ligand can be a peptide or peptidomimetic. A peptide mimetic (also referred to herein as an oligopeptide mimetic) is a molecule capable of folding into a defined three-dimensional structure, similar to a naturally occurring peptide. A peptide or peptidomimetic fragment can be about 5-50 amino acids in length, such as about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length. The peptide or peptidomimetic, for example, can be a cell penetration peptide, a cationic peptide, an amphipathic peptide, or a hydrophobic peptide (eg, consisting mainly of Tyr, Trp, or Phe). The peptide fragment can be a dendrimer peptide, a hindered peptide, or a cross-linked peptide. In another alternative, the peptide fragment may include a hydrophobic membrane transfer control sequence (MTS).

An exemplary hydrophobic MTS peptide is RFGF with the amino acid sequence

- 25 037110

AAVALLPAVLLALLAP (SEQ ID NO: 1).

An RFGF analog (eg, the amino acid sequence AALLPVLLAAP (SEQ ID NO: 2)) containing a hydrophobic MTS can also be a targeting fragment. The peptide fragment can be a delivery peptide that can transport large polar molecules, including peptides, oligonucleotides, and proteins, across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO: 3)) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 4)) have been found to function as delivery peptides. A peptide or peptidomimetic can be encoded with random DNA sequences, such as a peptide identified from a phage display library or a one bead-one compound (OVOS) combinatorial library (Lam et al., Nature, 354: 82-84, 1991). Preferably, the peptide or peptidomimetic associated with the mRNA agent through the introduced monomeric unit is a cell targeting peptide, such as an arginine-glycine-aspartic acid (RGD) peptide or an RGD mimetic. The peptide fragment can be in the range of about 5 amino acids to about 40 amino acids in length. Peptide fragments can be characterized by structural modification, such as to increase stability or control conformational properties. Any of the structural modifications described below can be used. The RGD peptide fragment can be used to target a tumor cell, such as an endothelial tumor cell or a breast cancer tumor cell (Zitzmann et al., Cancer Res. 62: 5139-43, 2002). The RGD peptide can help target the mRNA agent to tumors of a variety of other tissues, including the lung, kidney, spleen, or liver (Aoki et al., Cancer Gene Therapy 8: 783-787, 2001). Preferably, the RGD peptide will aid in targeting the mRNA agent to the kidney. The RGD peptide can be linear or cyclic and can be modified, eg, glycosylated or methylated, to aid in targeting to specific tissues. For example, a glycosylated RGD-peptide can deliver the agent representing the mRNA in tumor cell expressing α.β ₃ (Haubner et al, Jour Nucl Med , 42:.... 326-336, 2001). You can use peptides that target markers that are enriched in proliferating cells. For example, peptides and peptidomimetics containing RGDs can target cancer cells, in particular cells on the surface of which integrin is present. Thus, you can use RGD peptides, cyclic peptides containing RGD, RGD peptides that include D-amino acids, as well as synthetic RGD mimetics. In addition to RGD, you can use other fragments that target the integrin ligand. Typically, such ligands can be used to control cell proliferation and angiogenesis. Preferred conjugates with this type of ligand target PECAM-1, VEGF, or another cancer gene, such as the cancer gene described herein.

The cell penetration peptide is capable of entering a cell, for example, a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. The peptide entering a microbial cell, for example, can be an α-helical linear peptide (e.g. LL-37 or Ceropin P1) containing a disulfide bond peptide (e.g. α-defensin, β-defensin or bactenecin), or a peptide containing only one or two predominant amino acids (eg PR-39 or indolicidine). The cell penetration peptide may also include a cellular intranuclear localization signal (NLS). For example, the cell penetration peptide can be a two-component amphipathic peptide such as MPG, which is derived from the HIV-1 gp41 fusion peptide domain and the NLS from the SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31: 2717-2724, 2003).

In one embodiment, the targeting peptide may be an amphipathic α-helical peptide. Exemplary amphipathic α-helical peptides include, but are not limited to, cecropins, lycotoxins, paradaxins, buforin, CPF, bombinin-like peptide (BLP), cathelicidins, ceratotoxins, S. clava peptides, intestinal antimicrobial myxin peptides (HFIAP), maginins, brevins 2, dermaseptins, mellitins, pleurocidins, H2A peptides, Xenopus peptides, esculentins-1 and caerins. A number of factors will preferably be considered to maintain the integrity of the coil stability. For example, they will use the maximum number of helix-stabilizing residues (eg, leu, ala, or lys) and will use the minimum amount of helix-destabilizing residues (eg, proline or cyclic monomer units). A capping moiety (eg, Gly, which is an exemplary N capping moiety) will be contemplated, and / or a C-terminal amidation will be used to provide an additional H-bond to stabilize the helix. The formation of salt bridges between residues with opposite charges, separated by i ± 3 or i ± 4 positions, can provide stability.

- 26 037110

For example, cationic residues such as lysine, arginine, homoarginine, ornithine, or histidine can form salt bridges with anionic residues, glutamate or aspartate.

Peptide and peptidomimetic ligands include those peptides naturally occurring or modified, for example D- or L-peptides; α-, β- or γ-peptides; peptides with N-methyl; azapeptides; peptides with one or more amides, i.e. peptides with bonds substituted with one or more of urea, thiourea, carbamate, or sulfonylurea bonds; or cyclic peptides.

The targeting ligand can be any ligand that is capable of targeting a specific receptor. Examples are folate, GalNAc, galactose, mannose, mannose-6P, sugar clusters such as GalNAc cluster, mannose cluster, galactose cluster or aptamer. A cluster is a combination of two or more sugar units. Targeting ligands also include integrin receptor ligands, chemokine receptor ligands, transferrin, biotin, serotonin receptor ligands, PSMA, endothelin, GCPII, somatostatin, LDL and HDL ligands. Ligands can also be based on nucleic acid such as an aptamer. The aptamer can be unmodified or can have any combination of modifications disclosed herein.

Endosomal release agents include imidazoles, poly- or oligoimidazoles, PEIs, peptides, fusogenic peptides, polycarboxylates, polyacations, latent oligo- or polycations or anions, acetals, polyacetals, ketals / polyketals, orthoesters, co-ionic or non-latent anionic polymers , dendrimers with hidden or non-hidden cationic or anionic charges.

PK modulator means pharmacokinetic modulator. PK modulators include lipophils, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEGs, vitamins, etc. Illustrative PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkyl glycerides, diacyl glyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, etc. Oligonucleotides that contain some amount of phosphorothioate bonds are also known to bind to whey protein, thus short oligonucleotides, for example oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, containing many phosphothioate bonds in the backbone, also are useful in the present invention as ligands (eg, as PK modulating ligands).

In addition, aptamers that bind to serum components (eg, serum proteins) are also useful as PK modulating ligands in the present invention.

Other conjugates that are ligands useful in the present invention are described in patent applications CIHAUSSN: 10/916185, filed August 10, 2004; USSN: 10/946873, filed September 21, 2004; USSN: 10/833934, filed Aug. 3, 2007; USSN: 11/115989, filed April 27, 2005, and USSN: 11/944227, filed November 21, 2007, which are incorporated by reference in their entirety for all purposes.

Where two or more ligands are present, all ligands may have the same properties, may have different properties, or some ligands have the same properties while others have different properties. For example, a ligand can have targeting properties, have endosomolytic activity, or have PK modulating properties. In a preferred embodiment, all ligands have different properties.

Ligands can be linked to oligonucleotides at different locations, for example at the 3'-end, 5'-end, and / or in an internal position. In preferred embodiments, the ligand is attached to the oligonucleotides via an intermediate linking moiety, such as the carrier described herein. A ligand or a linked ligand can be present on the monomer when the monomer is incorporated into the growing strand. In some embodiments, the ligand can be introduced by binding to a precursor monomer after the precursor monomer has been introduced into the growing strand. For example, a monomer, eg, with an amino-terminal linking moiety (ie, no associated ligand), eg TAP- (CH ₂ ) _n NH _2, can be introduced into the growing oligonucleotide strand. At a later stage, i.e. after introducing the precursor monomer into the strand, the ligand with an electrophilic group, for example, a pentafluorophenyl ether group or an aldehyde group, can subsequently be attached to the precursor monomer by linking the ligand electrophilic group to the terminal nucleophilic group of the binding fragment of the precursor monomer.

In another example, a monomer with a chemical group suitable for participating in click chemistry reactions can be introduced, for example, an azide or alkyne-terminated linking moiety / linker. At a later stage, i.e. after introducing the precursor monomer into the strand, a ligand with a complementary chemical group, for example an alkyne or azide, can be attached to the precursor monomer by linking the alkyne and azide together.

For double-stranded oligonucleotides, ligands can be attached to one

- 27 037110 or both threads. In some embodiments, the mRNA double-stranded agent comprises a ligand conjugated to a sense strand. In other embodiments, the mRNA double-stranded agent comprises a ligand conjugated to an antisense strand.

In some embodiments, the ligand can be conjugated to nucleobases, sugar moieties, or internucleoside linkages of nucleic acid molecules. Conjugation with purine nucleobases or their derivatives can occur in any position, including intra-ring and extra-ring atoms. In some embodiments, the 2-, 6-, 7-, or 8-positions of the purine nucleobase are attached to the conjugate moiety. Conjugation with pyrimidine nucleobases or derivatives thereof can also occur at any position. In some embodiments, the 2-, 5-, and 6-positions of the pyrimidine base may be substituted with a conjugate moiety. Conjugation with sugar moieties of nucleosides can occur at any carbon atom. Examples of carbon atoms of the sugar moiety that can be attached to the conjugate moiety include 2 ', 3' and 5 'carbon atoms. The 1 'position can also be attached to a conjugate moiety, such as in an abasic residue. Internucleoside linkages can also carry conjugate fragments. As for the phosphorus-containing bonds (for example, phosphodiester, phosphorothioate, phosphodithioate, phosphoramidate, etc.), the conjugate fragment can be attached directly to the phosphorus atom or to the O, N or S atom bonded to the phosphorus atom. For amine- or amide-containing internucleotide linkages (eg, PNA), the conjugate moiety can be attached to the amine or amide nitrogen or to an adjacent carbon atom.

Any ligand suitable in the field of RNA interference can be used, although the ligand is generally a carbohydrate, for example a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, polysaccharide.

Linkers by which the ligand conjugates to the nucleic acid include those described above. For example, the ligand can be one or more GalNAc (Nacetylglucosamine) derivatives attached via a divalent or trivalent branched linker.

In one embodiment, a dsRNA of the present invention is conjugated to bivalent and trivalent branched linkers comprising the structures shown by any of formulas (IV) to (VII)

Formula (VI) Formula (VII) or;

where q ^2A , q ^2B , q ^3A , q ^3B , q4 ^A , q ^4B , q ^5A , q ^5B and q ^{5C are} independently 0-20 for each case, and where the repeating units may be the same or different;

each of P ^2A , P ^2B , P ^3A , P ^3B , P ^4A , P ^4B , P ^5A , P ^5B , P ^5C , T ^2A , T ^2B , T ^3A , T ^3B , T ^4A , T ^4B , T ^4A , T ^5B , T ^5C independently for each case is absent, permutes CO, NH, O, S, OC (O), NHC (O), CH ₂ , CH2NH or CH2O;

q ² a, q ^2b , q ³ a, q ^3b , Q4A, q ^4b , q ⁵ a, q ^5b , q ^5c independently for each case is absent, is alkylene, substituted alkylene, where one or more methylenes can be interrupted or terminated one or more of O, S, S (O), SO ₂ , N (R ⁿ ), C (R ') = C (R), C = C, or C (O);

each of R ^2A , R ^2B , R ^3A , R ^3B , R ^4A , R ^4B , R ^5A , R ^5B , R ^5C independently for each case is absent, is

- 28 037110

or heterocyclyl;

L ^2A , L ^2B , L ^3A , L ^3B , L ^4A , L ^4B , L ^5A , L ^5B, and L ^5C are a ligand; i.e. each independently for each occurrence is a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide; and

R ^a represents H or an amino acid side chain.

The trivalent conjugating derivatives of GalNAc are particularly suitable for use with an RNAi agent for inhibiting the expression of a target gene, such as derivatives of formula (VII)

p5A_Q5A_p5A _____- | -5A_ | _5A __р5В q5B т »5В__т5В ι 5В

Formula (VII) wherein L ^5A , L ^5B and L ^5C are a monosaccharide such as a GalNAc derivative.

Examples of suitable bivalent and trivalent branched linker groups through which the GalNAc derivatives are conjugated include, without limitation, the following compounds:

- 29 037110

- 30 037110

In other embodiments, the RNAi agent for use in the methods of the present invention is an agent selected from the group consisting of AD-53815, AD56663, AD-56658, AD-56676, AD-56666, AD-57928, and AD-60212.

III. Delivery of mRNA according to the present invention.

The delivery of the mRNA agent of the present invention to a cell, for example, a cell of a subject, such as a human subject (eg, a subject in need thereof, such as a subject with a lipid metabolism such as hyperlipidemia), can be accomplished in a variety of ways. For example, delivery can be accomplished by contacting a cell with an mRNA of the present invention, either in vitro or in vivo. In vivo delivery can also be accomplished directly by administering an mRNA-containing composition, eg, dsRNA, to a subject. Alternatively, in vivo delivery can be accomplished indirectly by introducing one or more vectors that encode and direct mRNA expression. Such alternative cases are described further below.

In general, any method for delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with the mRNA of the present invention (see, for example, Akhtar S. and Julian RL (1992) Trends Cell. Biol. 2 (5) : 139-144 and WO 94/02595, which are incorporated herein by reference in their entirety). With regard to in vivo delivery, factors to be considered in the context of delivery of an mRNA molecule include, for example, the biological stability of the delivered molecule, prevention of non-specific action, and accumulation of the delivered molecule in the target tissue. The nonspecific effect of mRNA can be minimized by local administration, for example, by direct injection or implantation into tissue, or by local administration of the drug. Local administration to the treatment site maximizes the local concentration of the agent, limits the agent's exposure to systemic tissues that might otherwise be damaged by the agent or that could degrade the agent, and allows a lower total dose of the mRNA molecule to be administered. Several studies have shown effective knockdown of gene products when mRNA is administered locally. For example, intraocular delivery of dsRNA to VEGF has been shown to be both intravitreal injection of cynomolgus monkeys (Tolentino MJ et al. (2004) Retina 24: 132-138) and subretinal injections in mice (Reich SJ, et al. ( 2003) Mol. Vis. 9: 210-216) prevents the formation of new vessels in an experimental model of age-related macular dystrophy. In addition, direct intratumoral injection of dsRNA into mice reduces tumor size (Pille J. et al. (2005) Mol. Ther. 11: 267274) and may increase the lifespan of tumor-bearing mice (Kim WJ et al. (2006) Mol. Ther. 14: 343-350; Li S. et al. (2007) Mol. Ther. 15: 515-523). RNA interference has also been successful when locally delivered to the CNS by direct delivery (Dorn G. et al. (2004) Nucleic Acids 32: e49; Tan PH et al. (2005) Gene Ther. 12: 59-66; Makimura H. et al. (2002) BMC Neurosci. 3:18; Shishkina GT et al. (2004) Neuroscience 129: 521-528; Thakker ER et al. (2004) Proc. Natl. Acad. Sci. USA 101: 1727017275; Akaneya Y. et al. (2005) J. Neurophysiol. 93: 594-602) and to the lungs by intranasal administration (Howard KA et al. (2006) Mol. Ther. 14: 476-484; Zhang X. et al. ( 2004) J. Biol. Chem. 279: 10677-10684; Bitko V. et al. (2005) Nat. Med. 11: 50-55). Regarding the introduction of mRNA systemically to treat disease, the RNA can be modified or, alternatively, delivered using a drug delivery system; both methods work to prevent the rapid destruction of dsR

- 31 037110

NA endo- and exonucleases in vivo. Modification of the RNA or pharmaceutical carrier can also make it possible to target the mRNA composition to the target tissue, and by means of these, unwanted off-target effects can be avoided. The mRNA molecules can be modified by chemical conjugation with lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. For example, mRNA directed against ApoB and conjugated to a lipophilic cholesterol fragment was administered systemically to mice and resulted in knockdown of apoB mRNA in both the liver and small intestine (Soutschek J. et al. (2004) Nature 432: 173 -178). Conjugation of mRNA to an aptamer has been shown to inhibit tumor growth and mediate tumor regression in murine models of prostate cancer (McNamara J.O. et al. (2006) Nat. Biotechnol. 24: 1005-1015). In an alternative embodiment, the mRNA can be delivered using drug delivery systems such as nanoparticle, dendrimer, polymer, liposomes, or cationic delivery system. Positively charged cationic delivery systems promote binding of the mRNA molecule (negatively charged) and also enhance interactions on the negatively charged cell membrane to ensure efficient uptake of mRNA by the cell. Cationic lipids, dendrimers or polymers can either be bound to mRNA or manipulated to form a bubble or micelle (see, for example, Kim SH et al. (2008) Journal of Controlled Release 129 (2): 107-116). which contain mRNA. Bubble or micelle formation also prevents the destruction of mRNA when administered systemically. Methods for preparing and introducing cationic complexes with mRNA are within the skill of those skilled in the art (see, for example, Sorensen DR et al. (2003) J. Mol. Biol. 327: 761-766; Verma UN et al. (2003 ) Clin Cancer Res 9: 1291-1300; Arnold AS et al (2007) J. Hypertens 25: 197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems suitable for systemic delivery of mRNA include DOTAP (Sorensen DR et al. (2003), supra; Verma UN et al. (2003), supra), oligofectamine, nucleic acid lipid solid particles (Zimmermann TS et al. (2006) Nature 441: 111-114), cardiolipin (Chien PY et al. (2005) Cancer Gene Ther. 12: 321-328; Pal A. et al. (2005) Int J. Oncol. 26: 1087-1091), polyethyleneimine (Bonnet ME et al. (2008) Pharm. Res., E-published before printing August 16; Aigner A. (2006) J. Biomed. Biotechnol. 71659) containing Arg-Gly-Asp (RGD ) peptides (Liu S. (2006) Mol. Pharm. 3: 472-487) and polyamidoamines (Tomalia DA et al. (2007) Biochem. Soc. Trans. 35: 61-67; Yoo H. et al. (1999 ) Pharm Res 16: 1799-1804). In some embodiments, the mRNA is complexed with cyclodextrin for systemic administration. Methods of administration and pharmaceutical compositions of mRNA and cyclodextrins can be found in US Pat. No. 7,427,605, which is incorporated herein by reference in its entirety.

A. Vector-encoded mRNAs of the present invention mRNAs targeting the PCSK9 gene can be expressed by transcriptional units inserted into DNA or RNA vectors (see, for example, Couture A. et al., TIG. (1996), 12: 5-10 ; Skillern A. et al., PCT International Publication No. WO 00/22113, Conrad, PCT International Publication No. WO 00/22114 and Conrad, US Patent No. 6,054,299). Expression can be temporary (on the order of hours to weeks) or prolonged (from weeks to months or longer), depending on the particular construct used and the target tissue or cell type. Such transgenes can be introduced as a linear construct, circular plasmid, or viral vector, which can be an integrating or non-integrating vector. Transgenes can also be engineered to be inherited as an extrachromosomal plasmid (Gassmann et al., Proc. Natl. Acad. Sci. USA (1995) 92: 1292).

Individual strands or strands of mRNA can be transcribed from the expression vector promoter. In cases where it is necessary to express two separate strands to obtain, for example, dsRNA, then two separate expression vectors can be co-introduced into the target cell (for example, by transfection or infection). Alternatively, each individual dsRNA strand can be transcribed using promoters, both of which are located on the same expression plasmid. In one embodiment, the dsRNA is expressed as inverted repeat polynucleotides joined by a linker polynucleotide sequence such that the dsRNA has a stem-loop structure.

Expression vectors with mRNA, as a rule, are DNA plasmids or viral vectors. Expression vectors compatible with eukaryotic cells, preferably compatible with vertebrate cells, can be used to generate recombinant constructs for mRNA expression as described herein. Expression vectors for eukaryotic cells are well known in the art and are available from a number of commercial sources. Typically, such vectors are provided containing convenient restriction sites for insertion of the desired nucleic acid segment. Delivery of vectors expressing mRNA can be systemic, such as by intravenous or intramuscular administration, by injection into target cells explanted from a patient, followed by re-introduction to the patient, or by any other method that allows introduction into the desired target cell.

Target cells can be transfected with mRNA expression plasmids as a complex with carrier

- 32 037110 ally-cationic lipids (eg oligofectamine) or non-cationic lipid carriers (eg Transit-TKO ™). The present invention also contemplates multiple lipid-assisted transfections for types of mRNA-mediated knockdown targeting different regions of the target RNA for a week or more. The successful introduction of vectors into host cells can be controlled using a variety of known methods. For example, transient transfection can be reported by a reporter such as a fluorescent marker such as green fluorescent protein (GFP). Stable ex vivo cell transfection can be confirmed by markers that confer resistance to certain environmental factors (e.g., antibiotics and drugs) to the transfected cell, such as hygromycin B.

Viral vector systems that can be used with the methods and compositions described herein include, without limitation: (a) adenoviral vectors; (b) retroviral vectors, including but not limited to lentiviral vectors, Moloney murine leukemia virus, etc .; (c) vectors based on adeno-associated virus; (d) vectors based on herpes simplex virus; (e) vectors based on SV40; (f) vectors based on polyoma virus; (g) vectors based on papilloma virus; (h) vectors based on picornavirus; (i) vectors based on poxvirus, such as orthopox, for example, vectors based on vaccinia virus, or avipox, for example canarypox or chickenpox; and (j) helper-dependent or weak adenovirus. Replication-impaired viruses can also be advantageous. Different vectors will or will not integrate into the genome of cells. If necessary, the constructs can include viral sequences for transfection. Alternatively, the construct can be inserted into vectors capable of episomal replication, such as EPV and EBV vectors. In constructs for recombinant expression of mRNA, regulatory elements, for example, promoters, enhancers, etc., will generally be required. to ensure mRNA expression in target cells. Other aspects to be considered with respect to vectors and constructs are described further below.

Vectors suitable for delivery of mRNA will include regulatory elements (promoter, enhancer, etc.) sufficient to express the mRNA in the desired target cell or tissue. Regulatory elements can be selected to obtain either constitutive or regulated / inducible expression.

Expression of mRNA can be precisely regulated, for example, by using an inducible regulatory sequence that is sensitive to certain physiological regulators, for example, circulating glucose levels or hormones (Docherty et al., 1994, FASEB J. 8: 20-24). Such inducible expression systems suitable for directing dsRNA expression in cells or mammals include, for example, regulation by ecdysone, by estrogen, progesterone, tetracycline, chemical dimerization inducers, and isopropyl beta-Othiogalactopyranoside (TPTG). One skilled in the art will be able to select the appropriate regulatory / promoter sequence based on the intended use of the mRNA transgene.

You can use viral vectors that contain nucleic acid sequences encoding mRNA. For example, a retroviral vector can be used (see Miller et al., Meth. Enzymol. 217: 581-599 (1993)). Such retroviral vectors contain the components necessary for proper packaging of the viral genome and integration into host cell DNA. Nucleic acid sequences encoding mRNA are cloned into one or more vectors that facilitate delivery of the nucleic acid to a patient. A more detailed description of retroviral vectors can be found, for example, in Boesen et al., Biotherapy 6: 291-302 (1994), which describes the use of a retroviral vector to deliver the mdrl gene to hematopoietic stem cells to make stem cells more resistant to chemotherapy. Other references illustrating the use of retroviral vectors in gene therapy are: Clowes et al., J. Clin. Invest. 93: 644-651 (1994); Kiem et al., Blood 83: 1467-1473 (1994); Salmons and Gunzberg, Human Gene Therapy 4: 129-141 (1993); and Grossman and Wilson, Curr. Opin. in Genetics and Devel. 3: 110-114 (1993). Lentiviral vectors contemplated for use include, for example, the HIV-based vectors described in US Pat. Nos. 6,143,520; 5665557 and 5981276, which are incorporated herein by reference.

Adenoviruses are also contemplated for use in the delivery of the mRNA of the present invention. Adenoviruses are particularly promising vehicles, for example, for the delivery of genes to the respiratory epithelium. Adenoviruses naturally infect the respiratory epithelium, where they cause mild disease. Other targets for adenovirus-based delivery systems are the liver, central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being able to infect nondividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3: 499-503 (1993) provides a review article on adenovirus-based gene therapy. Bout et al., Human Gene Therapy 5: 3-10 (1994) showed the use of adenoviral vectors to transfer genes into the respiratory epithelium of rhesus monkeys. Additional examples of the use of adenoviruses in gene therapy can be found in Rosenfeld et al., Science 252: 431-434 (1991); Rosenfeld et al., Cell 68: 143-155 (1992); Mastrangeli et al., J.

- 33 037110

Clin. Invest. 91: 225-234 (1993); PCT publications WO 94/12649 and Wang et al., Gene Therapy 2: 775-783 (1995). A suitable AV vector for mRNA expression described in the present invention, a method for constructing a recombinant AV vector, and a method for delivering the vector to target cells are described in Xia

H. et al. (2002) Nat. Biotech. 20: 1006-1010.

Adeno-associated virus (AAV) vectors can also be used to deliver the mRNA of the present invention (Walsh et al., Proc. Soc. Exp. Biol. Med. 204: 289-300 (1993); US patent No. 5436146). In one embodiment, the mRNA can be expressed as two separate complementary single-stranded RNA molecules using a recombinant AAV vector, for example, with either the U6 or H1 RNA promoters or the cytomegalovirus (CMV) promoter. Suitable AAV vectors for expressing the dsRNA described in the present invention, methods for constructing a recombinant AV vector, and methods for delivering vectors to target cells are described in Samulski R et al. (1987) J. Virol. 61: 3096-3101; Fisher K.J. et al. (1996) J. Virol. 70: 520-532; Samulski R. et al. (1989) J. Virol. 63: 3822-3826; US patent No. 5252479; US patent No. 5139941; international patent application No. WO 94/13788 and international patent application No. WO 93/24641, the entire disclosure of which is incorporated herein by reference.

Another viral vector suitable for the delivery of mRNA according to the present invention is a poxvirus, such as vaccinia virus, for example, an attenuated vaccinia virus, such as modified Ankara virus (MVA) or NYVAC, avipox, such as chickenpox or canarypox ...

The tropism of viral vectors can be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses, or by replacing different viral capsid proteins, if necessary. For example, lentiviral vectors can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies virus, Ebola virus, Mocola virus, and the like. AAV vectors can be designed to target different cells by designing the vectors to express different serotypes of capsid proteins; see, for example, Rabinowitz J.E. et al. (2002) J. Virol. 76: 791-801, the entire disclosure of which is incorporated herein by reference.

The vector pharmaceutical preparation may include the vector in an acceptable diluent or may include a sustained release matrix in which a gene delivery vehicle is included. Alternatively, where the whole gene delivery vector can be produced natively by recombinant cells, for example retroviral vectors, then the pharmaceutical preparation can include one or more cells that produce the gene delivery system.

V. Pharmaceutical compositions according to the invention.

The present invention also includes pharmaceutical compositions and formulations that include the mRNA of the present invention. In one embodiment, provided herein are pharmaceutical compositions comprising an mRNA as described herein and a pharmaceutically acceptable carrier. Pharmaceutical compositions containing mRNA are useful for the treatment of a disease or disorder associated with the expression or activity of the PCSK9 gene, for example, lipid metabolism disorders. Such pharmaceutical compositions are formulated based on the method of delivery. One example are compositions that are formulated for systemic administration by parenteral delivery, eg, intravenous (IV) delivery. Another example are compositions that are formulated for direct delivery to the parenchyma of the brain, for example, by infusion into the brain, such as by continuous infusion by means of a pump.

Pharmaceutical compositions containing the RNAi agents of the present invention may, for example, be buffered or unbuffered solutions or compositions containing pharmaceutically acceptable carriers. Such compositions include, for example, aqueous or crystalline compositions, liposome compositions, micellar compositions, emulsions, and gene therapy vectors.

In the methods of the present invention, the RNAi agent can be administered in solution. The free agent for RNAi can be administered in a non-buffered solution such as saline or water. Alternatively, free siRNA can also be administered in a suitable buffer solution. The buffer solution may contain acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In a preferred embodiment, the buffered saline is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing the RNAi agent can be adjusted so that it is suitable for administration to a subject.

In some embodiments, the buffered solution further comprises an agent for adjusting the osmolarity of the solution so that the osmolarity is maintained at a desired value, for example, at physiological values for human blood plasma. Dissolved substances that can be added to the buffer to adjust osmolarity include, but are not limited to, proteins, peptides, amino acids, non-metabolizable polymers, vitamins, ions, sugars, metabolites, organic acids, lipids, or salts. In some embodiments, the agent for adjusting the osmolarity of the solution is a salt. In certain embodiments, the agent for adjusting the osmolarity of the solution is sodium chloride or potassium chloride.

The pharmaceutical compositions of the invention can be administered in doses sufficient to inhibit expression of the PCSK9 gene. Typically, an acceptable dose of mRNA according to the present invention will be in the range of about 0.001 to about 200.0 mg per kilogram of body weight of the recipient per day, typically in the range of about 1 to 50 mg per kilogram of body weight per day. For example, dsRNA can be administered at about 0.01 mg / kg, about 0.05 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 1.5 mg / kg, about 2 mg / kg , about 3 mg / kg, about 10 mg / kg, about 20 mg / kg, about 30 mg / kg, about 40 mg / kg, or about 50 mg / kg per single dose.

For example, an RNAi agent such as dsRNA can be administered at a dose of about

0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9,

2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1,

4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3,

6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5,

8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or about 10 mg / kg.

Values and ranges in between those listed are also intended to be part of the present invention.

In another embodiment, the RNAi agent, for example dsRNA, is administered at a dose of about 0.1 to about 50 mg / kg, about 0.25 to about 50 mg / kg, about 0.5 to about 50 mg / kg, about 0.75 to about 50 mg / kg, from about 1 to about 50 mg / kg, from about 1.5 to about 50 mg / kg, from about 2 to about 50 mg / kg, from about 2.5 to about 50 mg / kg, about 3 to about 50 mg / kg, about 3.5 to about 50 mg / kg, about 4 to about 50 mg / kg, about 4.5 to about 50 mg / kg, about 5 to about 50 mg / kg, from about 7.5 to about 50 mg / kg, from about 10 to about 50 mg / kg, from about 15 to about 50 mg / kg, from about 20 to about 50 mg / kg, about 20 to about 50 mg / kg, from about 25 to about 50 mg / kg, from about 25 to about 50 mg / kg, from about 30 to about 50 mg / kg, from about 35 to about 50 mg / kg, about 40 to about 50 mg / kg, from about 45 to about 50 mg / kg, from about 0.1 to example but 45 mg / kg, about 0.25 to about 45 mg / kg, about 0.5 to about 45 mg / kg, about 0.75 to about 45 mg / kg, about 1 to about 45 mg / kg, about 1.5 to about 45 mg / kg, from about 2 to about 45 mg / kg, from about 2.5 to about 45 mg / kg, from about 3 to about 45 mg / kg, from about 3, 5 to about 45 mg / kg, from about 4 to about 45 mg / kg, from about 4.5 to about 45 mg / kg, from about 5 to about 45 mg / kg, from about 7.5 to about 45 mg / kg, about 10 to about 45 mg / kg, from about 15 to about 45 mg / kg, from about 20 to about 45 mg / kg, from about 20 to about 45 mg / kg, from about 25 to about 45 mg / kg, about 25 to about 45 mg / kg, from about 30 to about 45 mg / kg, from about 35 to about 45 mg / kg, from about 40 to about 45 mg / kg, from about 0.1 to about 40 mg / kg, about 0.25 to about 40 mg / kg, from about 0.5 to about 40 mg / kg, from about 0.75 to about 40 mg / kg, from about 1 to about 40 mg / kg, from about 1.5 to about 40 mg / kg, from about 2 to about 40 mg / kg, from about 2.5 to about 40 mg / kg, from about 3 to about 40 mg / kg , from about 3.5 to about 40 mg / kg, from about 4 to about 40 mg / kg, from about 4.5 to about 40 mg / kg, from about 5 to about 40 mg / kg, from about 7.5 to about 40 mg / kg, from about 10 to about 40 mg / kg, from about 15 to about 40 mg / kg, from about 20 to about 40 mg / kg, from about 20 to about 40 mg / kg, from about 25 to about 40 mg / kg, from about 25 to about 40 mg / kg, from about 30 to about 40 mg / kg, from about 35 to about 40 mg / kg, from about 0.1 to about 30 mg / kg, from about 0.25 to about 30 mg / kg, from about 0.5 to about 30 mg / kg, from about 0.75 to about 30 mg / kg, from about 1 to about 30 mg / kg, from about 1.5 to about 30 mg / kg, from about 2 to about 30 mg / kg, from about 2.5 to about 30 mg / kg, from about 3 to about 30 mg / kg, from about about 3.5 to about 30 mg / kg, from about 4 to about 30 mg / kg, from about 4.5 to about 30 mg / kg, from about 5 to about 30 mg / kg, from about 7.5 to about 30 mg / kg, about 10 to about 30 mg / kg, about 15 to about 30 mg / kg, about 20 to about 30 mg / kg, about 20 to about 30 mg / kg, about 25 to about 30 mg / kg, about 0.1 to about 20 mg / kg, about 0.25 to about 20 mg / kg, about 0.5 to about 20 mg / kg, about 0.75 to about 20 mg / kg, about 1 to about 20 mg / kg, from about 1.5 to about 20 mg / kg, from about 2 to about 20 mg / kg, from about 2.5 to about 20 mg / kg, from about 3 to about 20 mg / kg, from about 3.5 to about 20 mg / kg, from about 4 to about 20 mg / kg, from about 4.5 to about 20 mg / kg, from about 5 to about 20 mg / kg , about 7.5 to about 20 mg / kg, about 10 to about 20 mg / kg, or about 15 to about 20 mg / kg. Values and ranges in between those listed are also intended to be part of the present invention.

For example, an RNAi agent such as dsRNA can be administered at a dose of about

- 35 037110

0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7,

0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9,

3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1,

5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3,

7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5,

9.6, 9.7, 9.8, 9.9, or about 10 mg / kg. Values and ranges in between those listed are also intended to be part of the invention. In another embodiment, the RNAi agent, e.g. dsRNA, is administered at a dose of about 0.5 to about 50 mg / kg, about 0.75 to about 50 mg / kg, about 1 to about 50 mg / kg, about 1.5 to about 50 mg / kg, from about 2 to about 50 mg / kg, from about 2.5 to about 50 mg / kg, from about 3 to about 50 mg / kg, from about 3.5 to about 50 mg / kg, about 4 to about 50 mg / kg, from about 4.5 to about 50 mg / kg, from about 5 to about 50 mg / kg, from about 7.5 to about 50 mg / kg, from about 10 to about 50 mg / kg, from about 15 to about 50 mg / kg, from about 20 to about 50 mg / kg, from about 20 to about 50 mg / kg, from about 25 to about 50 mg / kg, from about 25 to about 50 mg / kg, from about 30 to about 50 mg / kg, from about 35 to about 50 mg / kg, from about 40 to about 50 mg / kg, from about 45 to about 50 mg / kg, from about 0.5 to about 45 mg / kg, about 0.75 to about 45 mg / kg, about 1 to about 45 mg / kg, about 1.5 to about 45 mg / kg, from about 2 to about 45 mg / kg, from about 2.5 to about 45 mg / kg, from about 3 to about 45 mg / kg, from about 3.5 to about 45 mg / kg, about 4 to about 45 mg / kg, about 4.5 to about 45 mg / kg, about 5 to about 45 mg / kg, about 7.5 to about 45 mg / kg, about 10 to about 45 mg / kg, about 15 to about 45 mg / kg, about 20 to about 45 mg / kg, about 20 to about 45 mg / kg, about 25 to about 45 mg / kg, about 25 to about 45 mg / kg, about 30 to about 45 mg / kg, about 35 to about 45 mg / kg, about 40 to about 45 mg / kg, about 0.5 to about 40 mg / kg, from about 0.75 to about 40 mg / kg, from about 1 to about 40 mg / kg, from about 1.5 to about 40 mg / kg, from about 2 to about 40 mg / kg , from about 2.5 to about 40 mg / kg, from about 3 to about 40 mg / kg, from about 3.5 to about 40 mg / kg, from about 4 to example but 40 mg / kg, about 4.5 to about 40 mg / kg, about 5 to about 40 mg / kg, about 7.5 to about 40 mg / kg, about 10 to about 40 mg / kg, about 15 to about 40 mg / kg, about 20 to about 40 mg / kg, about 20 to about 40 mg / kg, about 25 to about 40 mg / kg, about 25 to about 40 mg / kg, about 30 to about 40 mg / kg, from about 35 to about 40 mg / kg, from about 0.5 to about 30 mg / kg, from about 0.75 to about 30 mg / kg, from about 1 to about 30 mg / kg, about 1.5 to about 30 mg / kg, about 2 to about 30 mg / kg, about 2.5 to about 30 mg / kg, about 3 to about 30 mg / kg, about 3.5 to about 30 mg / kg, from about 4 to about 30 mg / kg, from about 4.5 to about 30 mg / kg, from about 5 to about 30 mg / kg, from about 7.5 to about 30 mg / kg, from about 10 to about 30 mg / kg, from about 15 to about 30 mg / kg, from about 20 to about 30 mg / kg, from about 20 to about 30 mg / kg, from about 25 to about 30 mg / kg, from about 0.5 to about 20 mg / kg, from about 0.75 to about 20 mg / kg, from about 1 to about 20 mg / kg, about 1.5 to about 20 mg / kg, from about 2 to about 20 mg / kg, from about 2.5 to about 20 mg / kg, from about 3 to about 20 mg / kg, from about 3.5 to about 20 mg / kg, about 4 to about 20 mg / kg, about 4.5 to about 20 mg / kg, about 5 to about 20 mg / kg, about 7.5 to about 20 mg / kg, about 10 to about 20 mg / kg; or about 15 to about 20 mg / kg. In one embodiment, the dsRNA is administered at a dose of from about 10 mg / kg to about 30 mg / kg. Values and ranges in between those listed are also intended to be part of the present invention.

For example, subjects can be administered a therapeutic amount of mRNA, such as about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1,

2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 14.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg / kg. Values and ranges in between those listed are also intended to be part of the present invention.

The pharmaceutical composition can be administered once a day, or the mRNA can be administered in two, three, or more portions of a dose at regular intervals throughout the day, or even at

- 36 037110 power of continuous infusion, or delivery through a controlled release formulation. In such a case, the amount of mRNA contained in each portion of the dose should be correspondingly less in order to provide the total daily dose. The dosage unit can also be formulated to be delivered over several days, for example using a conventional sustained release formulation that sustains the release of mRNA over a period of several days. Sustained release formulations are well known in the art and are particularly convenient for delivering agents to a specific site, such as they can be used with the agents of the present invention. In such an embodiment, the dosage unit contains a corresponding plurality of the daily dose.

In other embodiments, a single dose of the pharmaceutical compositions can be long acting such that subsequent doses are administered at intervals of no more than 3, 4, or 5 days, or at intervals of no more than 1, 2, 3, or 4 weeks. In some embodiments, the implementation of the present invention, a unit dose of the pharmaceutical compositions of the present invention is administered once a week. In other embodiments of the present invention, a single dose of the pharmaceutical compositions of the present invention is administered every two months.

One of ordinary skill in the art will understand that certain factors can influence the dose and time frame required to effectively treat a subject, including, but not limited to, the severity of the disease or disorder, types of previous treatment, general health and / or age of the subject, and others. existing diseases. In addition, treating a subject with a therapeutically effective amount of the composition may include one treatment period or a series of treatment periods. Estimates of effective doses and in vivo half-lives for individual mRNAs encompassed by the present invention can be obtained using conventional methodologies, or from in vivo studies using an appropriate animal model, as described elsewhere in this document.

Advances in mouse genetics have provided a number of mouse models for the study of various human diseases, such as bleeding disorders, which can be beneficially affected by downregulating PCSK9 expression. Such models can be used to conduct in vivo studies of mRNA, as well as to determine therapeutically effective dose. Suitable mouse models are known in the art and include, for example, a mouse containing a transgene expressing human PCSK9.

The pharmaceutical compositions of the present invention can be administered in a variety of ways depending on whether local or systemic treatment is required and the area to be treated. The introduction can be local (for example, using a transdermal patch), pulmonary, for example, by inhalation or injection of powders or aerosols, including using an inhaler; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subdermal, for example by means of an implanted device; or intracranial, eg, intraparenchymal, intrathecal, or intraventricular administration.

mRNA can be delivered in such a way as to target a specific tissue, such as the liver (eg, liver hepatocytes).

Pharmaceutical compositions and topical formulations may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders. Conventional pharmaceutical carriers, aqueous, powdery or oily bases, thickeners and the like. may be necessary or desirable. You can also use coated condoms, gloves, etc. Suitable topical formulations include those in which the mRNAs described in the present invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents, and surfactants. Suitable lipids and liposomes include neutral (e.g. dioleoyl phosphatidylethanolamine (DOPE), dimyristoyl phosphatidylcholine (DMPC), distearoyl phosphatidylcholine), negative (e.g. dimyristoyl phosphatidylglycerol (DMPG)), and cationic (e.g., dioleoyl phosphatidylethylene ). The mRNAs described in the present invention can be encapsulated in liposomes or can form complexes with them, in particular with cationic liposomes. Alternatively, mRNA can form complexes with lipids, in particular with cationic lipids. Suitable fatty acids and esters include, but are not limited to, arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, triacaprate dilaurin, glyceryl-1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitine, acylcholine, or C _1-20 alkyl esters (eg isopropyl myristate (IPM)), monoglyceride, diglyceride, or a pharmaceutically acceptable salt thereof. Topical formulations are detailed in US Pat. No. 6,747,014, which is incorporated herein by reference.

- 37 037110

A. MRNA formulations containing membrane mRNA molecular assemblies for use in the compositions and methods of the present invention can be formulated for delivery to a membrane molecular assembly, eg, a liposome or micelle. As used herein, the expression liposome refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer, eg, one bilayer or multiple bilayers. Liposomes include unilamellar and multilamellar vesicles, which have a membrane formed from a lipophilic material and an aqueous interior. The aqueous part contains a composition with mRNA. The lipophilic material separates the aqueous internal environment from the aqueous external environment, which typically does not include an mRNA composition, although in some examples it may. Liposomes are useful for transporting and delivering active ingredients to the site of action. Due to the fact that the liposome membrane is structurally similar to biological membranes, when liposomes are applied to tissues, the liposome bilayer fuses with the cell membrane bilayer. As the fusion of the liposome and the cell proceeds, the internal aqueous content, which includes the mRNA, is delivered to the cell, where the mRNA can specifically bind to the target RNA and can mediate RNAi. In some cases, liposomes are also specifically targeted, for example, to target mRNA to specific cell types.

Liposomes containing an RNAi agent can be prepared in a number of ways. In one example, the lipid component of the liposome is dissolved in a detergent to form micelles with the lipid component. For example, the lipid component can be an amphipathic cationic lipid or a lipid conjugate. The detergent may have a high critical micelle concentration and may be non-ionic. Illustrative detergents include cholate, CHAPS, octyl glucoside, deoxycholate, and lauroyl sarcosine. The RNAi agent formulation is then added to the micelles that include the lipid component. The cationic groups of the lipid interact with the RNAi agent and condense around the RNAi agent to form a liposome. After condensation, the detergent is removed, for example by dialysis, to obtain a liposome preparation of the RNAi agent.

If necessary, a carrier compound that promotes condensation can be added during the condensation reaction, for example by controlled addition. For example, the carrier compound can be a polymer other than a nucleic acid (eg, spermine or spermidine). You can also adjust the pH to promote condensation.

Methods for making stable polynucleotide delivery vehicles that include a polynucleotide / cationic lipid complex as structural components of delivery vehicles are further described, for example, in WO 96/37194, the entire contents of which are incorporated herein by reference. Liposome formation can also include one or more aspects of the illustrative methods described in Feigner P.L. et al., Proc. Natl. Acad. Sci. USA 8: 7413-7417, 1987; US Pat. No. 4,897,355; US patent No. 5171678; Bangham et al., M. Mol. Biol. 23: 238,1965; Olson et al., Biochim. Biophys. Acta 557: 9, 1979; Szoka et al., Proc. Natl. Acad. Sci. 75: 4194, 1978; Mayhew et al., Biochim. Biophys. Acta 775: 169, 1984; Kim et al., Biochim. Biophys. Acta 728: 339, 1983; and Fukunaga et al., Endocrinol. 115: 757, 1984. Commonly used techniques for making lipid aggregates of appropriate size for use as delivery vehicles include sonication and freeze-thaw extrusion (see, for example, Mayer et al., Biochim. Biophys. Acta 858: 161, 1986 ). Microfluidization can be used where stable small (50 to 200 nm) and relatively uniform aggregates are desired (Mayhew et al., Biochim. Biophys. Acta 775: 169, 1984). Such methods are readily adapted for packaging an RNAi agent preparation into liposomes.

Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes that interact with negatively charged nucleic acid molecules to form stable complexes. The positively charged nucleic acid / liposome complex binds to the negatively charged cell surface and is internalized into the endosome. Due to the acidic pH within the endosome, the liposomes break apart, releasing their contents into the cellular cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980985).

Liposomes that are pH-sensitive or negatively charged take up nucleic acids instead of complexing with them. Since both the nucleic acid and the lipid have the same charge, repulsion occurs instead of complex formation. However, some of the nucleic acids are captured by the aqueous internal environment of these liposomes. Liposomes with pH sensitivity were used to deliver nucleic acids encoding the thymidine kinase gene to cell monolayers in culture. The expression of the exogenous gene was detected in the target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).

One major type of liposome composition includes phospholipids other than naturally occurring phosphatidylcholine. Compositions of neutral liposomes, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoylphosphatidylcholine (DPPC). Anionic liposome compositions are generally formed from dimyristoylphosphatidylglycerol, while anionic fusogenic liposomes are formed mainly from dioleylphosphatidylethanolamine

- 38 037110 (DOPE). Another type of liposome composition is formed from phosphatidylcholine (PC), such as, for example, soybean PC and egg PC. Another type is formed from mixtures of phospholipid and / or phosphatidylcholine and / or cholesterol.

Examples of other methods for in vitro and in vivo introduction of liposomes into cells include US Pat. No. 5,283,185; US patent No. 5171678; WO 94/00569; WO 93/24640; WO 91/16024; Feigner, J. Biol. Chem. 269: 2550,1994; Nabel, Proc. Natl. Acad. Sci. 90: 11307,1993; Nabel, Human Gene Ther. 3: 649,1992; Gershon, Biochem. 32: 7143,1993; and Strauss EMBO J. 11: 417,1992.

Nonionic liposome systems have also been investigated to determine their suitability for delivering drugs to the skin, in particular systems containing a nonionic surfactant and cholesterol. Nonionic liposome formulations containing Novasome I (glyceryldilaurate / cholesterol / polyoxyethylene 10-stearyl ether) and Novasome ™ II (glyceryl distearate / cholesterol / polyoxyethylene 10-stearyl ether) were used to deliver cyclosporin-A to the dermis layer of mouse skin. The results showed that such non-ionic liposome systems were effective in promoting the deposition of cyclosporin A in various layers of the skin (Hu et al., S. T. P. Pharm. Sci., 1994, 4 (6) 466).

Liposomes also include spatially stabilized liposomes, which, as used herein, mean liposomes containing one or more special lipids that, when incorporated into liposomes, result in an increased lifetime in the bloodstream compared to liposomes lacking such special lipids. Examples of spatially stabilized liposomes are those in which part of the lipid vesicle-forming constituent of the liposome (A) contains one or more glycolipids such as monosialoganglioside G _M1 , or (B) is derived from one or more hydrophilic polymers such as polyethylene glycol (PEG) fragment. Without wishing to be bound by any particular theory, it is believed in the art that, at least for spatially stabilized liposomes containing gangliosides, sphingomyelin or PEG-derived lipids, the increased circulating half-life of these spatially stabilized liposomes is due to decreased cellular uptake. reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765).

A variety of liposomes containing one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. NY Acad. Sci., 1987, 507, 64) described the ability of monosialoganglioside G _M1 , galactocerebroside sulfate and phosphatidylinositol to increase the half-life of liposomes in the blood. These findings were commented on by Gabizon et al. (Proc. Natl. Acad. Sci. USA, 1988, 85, 6949). US Pat. No. 4,837,028 and WO 88/04924, both of which are owned by Allen et al., Disclose liposomes comprising (1) sphingomyelin and (2) ganglioside G _M1 or galactocerebroside sulfate esters. US Pat. No. 5,543,152 (Webb et al) discloses liposomes containing sphingomyelin. Liposomes containing 1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lime et al.).

In one embodiment, cationic liposomes are used. Cationic liposomes have the advantage of being able to fuse with the cell membrane. Non-cationic liposomes, although they cannot fuse as efficiently with the plasma membrane, are taken up by macrophages in vivo and can be used to deliver RNAi agents to macrophages.

Additional benefits of liposomes include the following: liposomes derived from natural phospholipids are biocompatible and biodegradable; liposomes can include a wide range of water and fat-soluble drugs; liposomes can protect encapsulated RNAi agents in internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important aspects in the preparation of liposome formulations are the surface charge of the lipid, the bubble size, and the aqueous volume of the liposomes.

A positively charged synthetic cationic lipid, N- [1- (2,3-dioleyloxy) npropyl] -N, N, N-trimethylammonium chloride (DOTMA), can be used to form small liposomes that spontaneously interact with nucleic acid to form lipid-nucleic acid complexes acid, which are able to fuse with negatively charged lipids of the cell membranes of tissue culture cells, resulting in the delivery of an agent for RNAi (see, for example, Feigner PL et al., Proc. Natl. Acad. Sci., USA 8: 7413-7417, 1987 and US patent No. 4,897,355 regarding the description of DOTMA and its use with DNA).

The DOTMA analog, 1,2-bis (oleoyloxy) -3- (trimethylammonium) propane (DOTAP), can be used in combination with a phospholipid to form vesicles that complex with DNA. Lipofectin ™ (Bethesda Research Laboratories, Gaithersburg, MD) is an effective vehicle for the delivery of highly anionic nucleic acids into living tissue culture cells that contains positively charged DOTMA liposomes that spontaneously interact with negatively charged polynucleotides to form complexes. In cases where liposomes with a sufficient positive charge are used, then the total charge of the complexes obtained is also positive. The positively charged complexes obtained in this way spontaneously adhere to negatively charged cell surfaces, fuse with the plasma membrane, and efficiently deliver functional nucleic acids, for example, to tissue culture cells. Another commercially available cationic lipid, 1,2-bis (oleoyloxy) -3,3 (trimethylammonium) propane (DOTAP) (Boehringer Mannheim, Indianapolis, Indiana), differs from

DOTMA in that the oleyl moieties are linked by ester bonds rather than ether bonds.

Other published cationic lipid compounds include those that have been conjugated to a number of moieties including, for example, carboxypermine, which has been conjugated to one of two types of lipids, and includes compounds such as 5-carboxypermylglycine dioctaoleoylamide (DOGS) (Transfectam ™, Promega , Madison, WI) and dipalmitoylphosphatidylethanolamine 5-carboxypermylamide (DPPES) (see, for example, US Pat. No. 5,171,678).

Another cationic lipid conjugate includes the resulting cholesterol lipid derivatives (DC-Chol), which have been formulated as liposomes in combination with DOPE (see, Gao X. and Huang L., Biochim. Biophys. Res. Commun. 179: 280 , 1991). Lipopolylysine, obtained by conjugating polylysine to DOPE, has been reported to be effective when transfected in the presence of serum (Zhou X. et al., Biochim. Biophys. Acta 1065: 8, 1991). For certain cell lines, such liposomes containing conjugated cationic lipids are said to exhibit lower toxicity and more efficient transfection than DOTMA containing compositions. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, Calif.) And Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, Md.). Other cationic lipids suitable for the delivery of oligonucleotides are described in WO 98/39359 and WO 96/37194.

Liposome formulations are particularly suitable for topical application, with liposomes showing some advantages over other formulations. Such advantages include reduced side effects with respect to high systemic absorption of the administered drug, increased accumulation of the administered drug in the desired target, and the ability to deliver the RNAi agent into the skin. In some embodiments, liposomes are used to deliver the RNAi agent to epidermal cells and also to enhance the penetration of the RNAi agent into dermal tissues, such as the skin. For example, liposomes can be applied topically. Local delivery of drugs formulated as liposomes to the skin has been documented (see, for example, Weiner et al., Journal of Drug Targeting, 1992, vol. 2.405-410 and du Plessis et al., Antiviral Research, 18, 1992, 259-265; Mannino RJ and Fould-Fogerite S., Biotechniques 6: 682-690, 1988; Itani T. et al., Gene 56: 267-276. 1987; Nicolau C. et al., Meth. Enz 149: 157-176, 1987; Straubinger, RM and Papahadjopoulos D. Meth. Enz. 101: 512-527, 1983; Wang C.Y. and Huang L., Proc. Natl. Acad. Sci. USA 84: 7851 -7855, 1987).

Nonionic liposome systems have also been investigated to determine their suitability for delivering drugs to the skin, in particular systems containing a nonionic surfactant and cholesterol. Nonionic liposome formulations containing Novasome I (glyceryldilaurate / cholesterol / polyoxyethylene 10-stearyl ether) and Novasome II (glyceryl distearate / cholesterol / polyoxyethylene 10-stearyl ether) were used to deliver the drug to the dermis layer of the skin of mice. Such RNAi agent formulations are useful in the treatment of a dermatological disorder.

Liposomes that include mRNA can be produced with high deformability. This deformability can allow liposomes to penetrate through a pore that is smaller than the average radius of the liposome. For example, a type of deformable liposome is transferomes. Transferosomes can be prepared by adding surface border activators, usually surfactants, to a standard liposome composition. Transfersomes that include an RNAi agent can be delivered, for example, subcutaneously by injection to deliver the RNAi agent to keratinocytes in the skin. In order to pass through intact mammalian skin, lipid vesicles must pass through a series of small pores, each less than 50 nm in diameter, under a suitable intradermal gradient. In addition, due to the properties of lipids, such transferosomes can be self-optimizing (adapting to the shape of pores, for example, in the skin), self-healing, and can often reach their targets without splitting into fragments, and can often be self-loading.

Other formulations useful in the present invention are described in US Provisional Applications Serial No. 61/018616, filed January 2, 2008; 61/018611, filed January 2, 2008; 61/039748, filed March 26, 2008; 61/047087, filed April 22, 2008, and 61/051528, filed May 8, 2008. PCT Application No. PCT / US2007 / 080331, filed October 3, 2007, also describes formulations useful in the present invention.

Transfersomes are another type of liposomes and are highly deformable lipid aggregates; they are promising candidates for drug delivery. Transfersomes can be described as lipid droplets that are so highly deformable that they can easily penetrate the pores.

- 40 037110 smaller than droplets. Transfersomes are adaptable to the environment in which they are used, for example, they are self-optimizing (adapting to the shape of the pores in the skin), self-healing, often reaching targets without fragmentation, and can often be self-loading. For the preparation of transfersomes, surface boundary activators, usually surfactants, can be added to a standard liposome composition. Transfersomes were used to deliver serum albumin to the skin. Transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.

Surfactants are widely used in formulations such as emulsions (including microemulsions) and liposomes. The most common way to classify and rank the properties of many different types of surfactants, both natural and synthetic, is through the use of Hydrolipid Balance (HLB). The nature of the hydrophilic group (also known as the head) provides the most effective categorization of the various surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285 ).

If the surfactant molecule is not ionized, then it is classified as a non-ionic surfactant. Nonionic surfactants are widely used in pharmaceutical and cosmetic products and can be used over a wide range of pH values. Typically, their HLB values range from 2 to about 18, depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanoamides and esters such as fatty alcohol ethoxylates, propoxylated alcohols and ethoxylated / propoxylated block copolymers are also included in this class. Polyoxyethylene surfactants are the most common members of the nonionic surfactant class.

If the surfactant molecule carries a negative charge when dissolved or dispersed in water, then the surfactant is classified as anionic. Anionic surfactants include carboxylates such as saponifiers, acyl lactylates, amino acid acylamides, sulfuric acid esters such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates, and sulfosuccinates. The most important members of the class of anionic surfactants are alkyl sulfates and saponifiers.

If the surfactant molecule carries a positive charge when dissolved or dispersed in water, then the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. Quaternary ammonium salts are the most commonly used representatives of this class.

If the surfactant molecule has the ability to carry either a positive or negative charge, then the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkyl amides, N-alkyl betaines, and phosphatides.

The use of surfactants in finished dosage forms, formulations and emulsions has been considered (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

mRNA for use in the methods of the present invention may also be provided as micellar formulations. Micelles are defined herein as a particular type of molecular assembly in which amphipathic molecules are arranged in a spherical structure such that all hydrophobic portions of the molecule are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The opposite arrangement takes place if the environment is hydrophobic.

A mixed micellar formulation suitable for delivery across intradermal membranes can be prepared by mixing an aqueous solution of the formulation with siRNA, C ₈ -C ₂₂ alkali metal alkyl sulfate, and micelle-forming compounds. Exemplary micelle-forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable hyaluronic acid salts, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleates, monolaurate evening, borax oil , menthol, trihydroxyoxocholanyl-glycine and its pharmaceutically acceptable salts, glycerin, polyglycerol, lysine, polylysine, triolein, polyoxyethylene ethers and their analogs, polydocanol-alkyl ethers and their analogs, chenodeoxycholate, deoxycholate and mixtures thereof. Micelle-forming compounds can be added during or after the addition of the alkali metal alkyl sulfate. Mixed micelles will form in essentially any kind of mixing of the ingredients other than vigorous stirring to obtain smaller micelles.

- 41 037110

In one method, a first micellar composition is prepared that contains an siRNA composition and at least an alkali metal alkyl sulfate. The first micellar composition is then mixed with at least three micelle-forming compounds to form a mixed micellar composition. In another method, a micellar composition is prepared by mixing the composition with siRNA, an alkali metal alkyl sulfate and at least one of the micelle-forming compounds, followed by the addition of the remaining micelle-forming compounds with vigorous mixing.

Phenol and / or m-cresol can be added to the mixed micellar composition to stabilize the composition and protect against bacterial growth. Alternatively, phenol and / or m-cresol can be added with micelle-forming ingredients. An isotonic agent such as glycerin can also be added after the mixed micellar composition is formed.

To deliver the micellar formulation as a spray, the formulation can be placed in an aerosol dispenser and the dispenser charged with a propellant. The propellant, which is under pressure, is in liquid form in the atomizer. The ingredient ratios are adjusted so that the aqueous phase and the propellant phase become one, i. E. there is one phase. If there are two phases, it is necessary to shake the nebulizer before spraying part of the contents, for example, by means of a dosing valve. The nebulized dose of pharmaceutical agent is expelled from the metering valve in the form of a fine spray.

Propellants can include hydrogen-containing chlorofluorocarbons, hydrogen-containing fluorocarbons, dimethyl ether, and diethyl ether. In certain embodiments, HFA 134a (1,1,1,2-tetrafluoroethane) can be used.

The specific concentrations of the main ingredients can be determined by relatively simple experimentation. For absorption through the oral cavity, it is often necessary to increase, for example, at least double or triple, the dose to be injected or administered through the gastrointestinal tract.

B. Lipid particles.

mRNA, for example dsRNA according to the present invention, can be completely encapsulated in a lipid composition, for example LNP, or other nucleic acid-lipid particle.

As used herein, the expression LNP refers to a stable nucleic acid-lipid particle. LNPs contain a cationic lipid, a non-cationic lipid, and a lipid that prevents particle aggregation (eg, a PEG-lipid conjugate). LNPs are highly suitable for systemic applications because they have a long lifetime in the bloodstream after intravenous (i.v.) injection and accumulate in distal sites (eg, sites physically separated from the injection site). LNPs include pSPLP, which includes an encapsulated condensing agent-nucleic acid complex, which is disclosed in PCT Publication No. WO 00/03683. Particles according to the present invention typically have an average diameter of from about 50 nm to about 150 nm, more often from about 60 nm to about 130 nm, more from about 70 nm to about 110 nm, most often from about 70 nm to about 90 nm, and essentially are non-toxic. In addition, nucleic acids, when present in the nucleic acid-lipid particles of the present invention, are resistant to nuclease degradation in aqueous solution. Nucleic acid lipid particles and a method for their preparation are disclosed, for example, in US Pat. Nos. 5,976,567; 5981501; 6534484; 6586410; 6815432; US Publication No. 2010/0324120 and PCT Publication No. WO 96/40964.

In one embodiment, the lipid to drug ratio (weight / weight ratio) (e.g., lipid to dsRNA ratio) will range from about 1: 1 to about 50: 1, from about 1: 1 to about 25: 1, from about 3: 1 to about 15: 1, about 4: 1 to about 10: 1, about 5: 1 to about 9: 1, or about 6: 1 to about 9: 1. Ranges intermediate to those listed above are also contemplated as part of the present invention.

The cationic lipid can be, for example, N, N-dioleyl-N, N-dimethylammonium chloride (DODAC), N, N-distearyl-N, N-dimethylammonium bromide (DDAB), N- (1- (2,3 -dioleoyloxy) propyl) -N, N, N-trimethylammonium (DOTAP), N- (1- (2,3-dioleyloxy) npropyl) -N, N, N-trimethylammonium chloride (DOTMA), N, N-dimethyl- 2,3-dioleyloxy) propylamine (DODMA), 1,2-dilinoleyloxy-N, N-dimethylaminopropane (DLinDMA), 1,2-dilinoleyloxy-N, N-dimethylaminopropane (DLenDMA), 1,2-dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-dilinoleyloxy-3 - (dimethylamino) acetoxypropane (DLin-DAC), 1,2-dilinoleyloxy-3-morpholinopropane (DLin-MA), 1,2-dilinoleoyl-3-dimethylaminopropane (DLinDAP ), 1,2-dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-dilinoleyloxy-3trimethylaminopropane chloride (DLin- TMA.Cl), 1,2-dilinoleoyl-3-trimethylaminopropane chloride (DLin-TAP.Cl), 1,2-dilinoleyloxy-3- (N-methylpiperazino) propane (DLin-MPZ) or 3- (N, N -dilinoleylamine o) -1,2-propanediol (DLinAP), 3- (N, N-dioleylamino) -1,2-propanediol (DOAP), 1,2-dilinoleyloxo 3- (2-N, N-dimethylamino) ethoxypropane (DLin- EG-DMA), 1,2-dilinoleyloxy-N, N-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl- [1,3] -dioxolane (DLin-K-DMA) or its analogs,

- 42 037110 (3aR, 5s, 6aS) -N, N-dimethyl-2,2-di ((9Z, 12Z) -octadeca-9,12-dienyl) tetrahydro-3aH-cyclopenta [d] [1,3] dioxol-5-amine (ALN100), (6Z, 9Z, 28Z, 31Z) -renmampuaKOHTa-6,9,28,31 -tetraen-19-yl-4- (dimethylamino) butanoate (MC3), 1,1 '- (2- (4- (2 - ((2- (bis (2-hydroxydodecyl) amino) ethyl) (2-hydroxydodecyl) amino) ethyl) piperazin-1-yl) ethylazanediyl) didodecan-2-ol (Tech G1) or a mixture thereof. The cationic lipid may contain from about 20 mol% to about 50 mol% or about 40 mol% of the total lipids present in the particle.

In another embodiment, the compound 2,2-dilinoleyl-4-dimethylaminoethyl- [1,3] -dioxolane can be used to prepare lipid-siRNA nanoparticles. The synthesis of 2,2-dilinoleyl-4dimethylaminoethyl- [1,3] -dioxolane is described in US Provisional Patent Application No. 61/107998, filed October 23, 2008, which is incorporated herein by reference. In one embodiment, the lipid-siRNA particles comprise 40% 2,2-dilinoleyl-4-dimethylaminoethyl- [1,3] dioxolane; 10% DSPC; 40% cholesterol; 10% PEG-C-DOMG (mole percent) with a particle size of 63.0 ± 20 nm and a siRNA / lipid ratio of 0.027.

The ionizable / non-cationic lipid can be an anionic lipid or a neutral lipid, including, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), Dioleoylphosphatidylphosphate palmitoiloleoilfosfatidilholin (POPC) palmitoiloleoilfosfatidiletanolamin (POPE), dioleoilfosfatidiletanolamin4- (N-mαleimidometil) cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimiristoilfosfoetanolamin (DMPE), distearoylphosphatidylethanolamine (DSPE), 16-Omonometil-PE 16 -0-dimethyl-PE, 18-1-trans-PE, 1-stearoyl-2-oleoylphosphatidylethanolamine (SOPE), cholesterol, or a mixture thereof. The non-cationic lipid can comprise from about 5 mol% to about 90 mol%, about 10 mol%, or about 58 mol% of the total lipids present in the particle if cholesterol is included.

A conjugated lipid that inhibits particle aggregation can be, for example, a polyethylene glycol (PEG) -lipid conjugate, including but not limited to PEG-diacylglycerol (DAG), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer) or a mixture of both. The PEG-DAA conjugate can be, for example, PEG-dilauryloxypropyl (G2), PEG-dylauryloxypropyl (Ci4), PEG-dipalmyloxypropyl (Ci ₆ ), or PEG-distearyloxypropyl (Ci ₈ ). The conjugated lipid that prevents particle aggregation can range from 0 mol% to about 20 mol%, or about 2 mol% of the total lipids present in the particle.

In some embodiments, the nucleic acid lipid particle further comprises cholesterol in an amount of, for example, about 10 mol% to about 60 mol%, or about 48 mol% of the total lipid present in the particle.

In one embodiment, the lipidoid ND98-4HCl (MW 1487) (see US patent application No. 12/056230, filed March 26, 2008, which is incorporated herein by reference), cholesterol (Sigma-Aldrich), and PEG- Ceramide C16 (Avanti Polar Lipids) can be used to prepare lipid-dsRNA nanoparticles (i.e., LNP01 particles). Stock solutions of each in ethanol can be prepared as follows: ND98, 133 mg / ml; cholesterol, 25 mg / ml, PEG-ceramide C16, 100 mg / ml. Stock solutions of ND98, cholesterol and PEG-ceramide C16 can then be combined, for example, in a 42:48:10 molar ratio. The combined lipid solution can be mixed with an aqueous dsRNA solution (eg, sodium acetate, pH 5) such that the final concentration of ethanol is about 3545% and the final concentration of sodium acetate is about 100-300 mM. Lipid dsRNA nanoparticles usually form spontaneously when mixed. Depending on the desired particle size distribution, the resulting nanoparticle mixture can be forced through a polycarbonate membrane (e.g. with a cut-off of 100 nm) using, for example, a thermocylinder extruder such as a Lipex Extruder (Northern Lipids, Inc.). In some cases, the extrusion step can be skipped. Ethanol removal and simultaneous buffer exchange can be accomplished, for example, by dialysis or tangential flow filtration. The buffer can be replaced, for example, with phosphate buffered saline (PBS) at a pH of about 7, for example, pH about 6.9, pH about 7.0, pH about 7.1, pH about 7.2, pH about 7.3, or pH about 7.4.

ND98 Isomer

Formula 1

The formulations of LNP01 are described, for example, in International Application Publication No. WO 2008/042973, which is hereby incorporated by reference.

Additional illustrative formulations with lipid-dsRNA are described in table. BUT.

Table A

Ionizable / cationic lipid Cationic lipid / non-cationic lipid / cholesterol / PEG-lipid conjugate Lipid: siRNA ratio 1,2-dilino lenyloxy-Ν, Ν dimethylaminopropane (DLinDMA) DLinDMA / DPPC / xonecTepnn / PEG-cDMA (57.1 / 7.1 / 34.4 / 1.4) lipid: siRNA ~ 7: 1 2,2-dilinoleyl-4-dimethylaminoethyl- [1,3] dioxolane (CTS) XTS / BPRS / cholesterol / RES-sVMA 57.1 / 7.1 / 34.4 / 1.4 lipid: siRNA ~ 7: 1 2,2-dilinoleyl-4-dimethylaminoethyl- [1,3] dioxolane (CTS) XTC / DSPC / xonecTepnn / PEG-DMG 57.5 / 7.5 / 31.5 / 3.5 , ™ niu: siRN A ~ 6: 1

- 44 037110

LNP06 2,2-dilinoleyl-4-dimethylaminoethyl- [1,3] dioxolane (CTS) XTC / DSPC / xonecTepHH / PEG-DMG 57.5 / 7.5 / 31.5 / 3.5 lipid: siRNA - 11: 1 LNP07 2,2-dilinoleyl-4-dimethylaminoethyl- [1,3] dioxolane (CTS) XTC / DSPC / xonecTepnH / PEG-DMG 60 / 7.5 / 31 / 1.5 , ™ niu: siRN А - 6: 1 LNP08 2,2-dilinoleyl-4-dimethylaminoethyl- [1,3] dioxolane (CTS) XTC / DSPC / xonecTepnH / PEG-DMG 60 / 7.5 / 31 / 1.5 lipid: siRNA - 11: 1 LNP09 2,2-dilinoleyl-4-dimethylaminoethyl- [1,3] dioxolane (CTS) XTC / DSPC / xonecTepnH / PEG-DMG 50/10 / 38.5 / 1.5 , ™ niu: siRNA 10: 1 LNP10 (ZA, 58.6a8) -X, X-dimethyl-2,2-di ((92,122) octadeca-9,12-dienyl) tetrahydro-ZaHcyclopenta [<1] [1,3] dioxol-5-amine (ALN100) ALN100 / DSPC / xonecTepHH / PEG-DMG 50/10 / 38.5 / 1.5 nnniu: siRNA 10: 1 LNP11 (62,92,282,312) -heptatriaconta-6,9,28,31tetraen-19-yl-4- (dimethylamino) butanoate (MSZ) MC-3 / D SPC / xonecTepnH / PEG-DMG 50/10 / 38.5 / 1.5 lipid: siRNA 10: 1 LNP12 1, Г- (2- (4- (2 - ((2- (bis (2- hydroxydodecyl) amino) ethyl) (2- hydroxydodecyl) amino) ethyl) piperazin-1 yl) ethylazanediyl) didodecan-2-ol (Tech G1) Tech Gl / DSPC / xonecTepnH / PEG-DMG 50/10 / 38.5 / 1.5 nnniu: siRNA 10: 1 XTC / DSPC / xon / PEG-DMG LNP13 XTS 50/10 / 38.5 / 1.5 lipid: siRNA: 33: 1 MC3 / DSPC / xon / PEG-DMG LNP14 MRZ 40/15/40/5 lipid: siRNA: 11: 1 MC3 / DSPC / xon / PEG-DSG / GalNAc-PEG-DSG LNP15 MRZ 50/10/35 / 4.5 / 0.5 lipid: siRNA: 11: 1 MC3 / DSPC / xon / PEG-DMG LNP16 MRZ 50/10 / 38.5 / 1.5 lipid: siRNA: 7: 1 MC3 / DSPC / xon / PEG-DSG LNP17 MRZ 50/10 / 38.5 / 1.5 nnniu: siRNA: 10: 1 MC3 / DSPC / xon / PEG-DMG LNP18 MRZ 50/10 / 38.5 / 1.5 nnniu: siRNA: 12: 1 MC3 / DSPC / xon / PEG-DMG LNP19 MRZ 50/10/35/5 lipid: siRNA: 8: 1 MC3 / DSPC / xon / PEG-DPG LNP20 MRZ 50/10 / 38.5 / 1.5 nnniu: siRNA: 10: 1 C12-200 / DSPC / xon / PEG-DSG LNP21 S12-200 50/10 / 38.5 / 1.5 lipid: siRNA: 7: 1 XTC / DSPC / xon / PEG-DSG LNP22 XTS 50/10 / 38.5 / 1.5 nnniu: siRNA: 10: 1

DSPC: distearoyl phosphatidylcholine;

DPPC: dipalmitoyl phosphatidylcholine;

PEG-DMG: PEG-didymyristoylglycerol (C14-PEG or PEG-C14) (PEG with an average molecular weight of 2000);

PEG-DSG: PEG-distyrylglycerol (C18-PEG or PEG-C18) (PEG with an average molecular weight of 2000);

- 45 037110

PEG-cDMA: PEO-carbamoyl-1,2-dimyristoyloxypropylamine (PEG with an average molecular weight of 2000).

Formulations containing LNP (1,2-dilinolenyloxy-N, M-dimethylaminopropane (DLinDMA)) are described in International Publication No. WO 2009/127060, filed April 15, 2009, which is hereby incorporated by reference.

XTS-containing formulations are described, for example, in US Provisional Application Serial No. 61/148366, filed January 29, 2009; US Provisional Application Serial No. 61/156851, filed March 2, 2009; US Provisional Application Serial No. filed June 10, 2009; US Provisional Application Serial No. 61/228373, filed July 24, 2009; US Provisional Application Serial No. 61/239686, filed September 3, 2009, and International Application No. PCT / US2010 / 022614, filed January 29, 2010, which are hereby incorporated by reference.

MC3-containing formulations are described, for example, in US Publication No. 2010/0324120, filed June 10, 2010, the entire contents of which are hereby incorporated by reference.

ALNY-100-containing formulations are described, for example, in WO PCT / US09 / 63933, filed November 10, 2009, which is hereby incorporated by reference.

C12-200-containing formulations are described in U.S. Provisional Application Serial No. 61/175770, filed May 5, 2009, and WO No. PCT / US10 / 33777, filed May 5, 2010, which are thus incorporated by links.

Synthesis of ionizable / cationic lipids.

Any of the compounds, eg, cationic lipids and the like, used in the nucleic acid-lipid particles of the present invention can be prepared using known organic synthetic techniques, including those described in more detail in the examples. All substituents are as defined below, unless otherwise indicated.

Alkyl means a straight chain hydrocarbon or a branched, acyclic or cyclic, saturated aliphatic hydrocarbon containing from 1 to 24 carbon atoms. Typical saturated straight chain alkyls include methyl, ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl and the like; while saturated branched alkyls include isopropyl, sec-butyl, isobutyl, tert-butyl, isopentyl and the like. Typical saturated cyclic alkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and the like; while unsaturated cyclic alkyls include cyclopentenyl and cyclohexenyl and the like.

Alkenyl means alkyl, as defined above, containing at least one double bond between adjacent carbon atoms. Alkenyls include both cis and trans isomers. Typical straight chain and branched alkenyls include ethylene, propylene, 1-butenyl, 2butenyl, isobutylenyl, 1-pentenyl, 2-pentenyl, 3-methyl-1-butenyl, 2-methyl-2-butenyl, 2,3-dimethyl -2butenyl and the like.

Alkynyl means any alkyl or alkenyl as defined above, which additionally contains at least one triple bond between adjacent carbon atoms. Typical straight chain alkynyls and branched alkynyls include acetylenyl, propynyl, 1-butynyl, 2-butynyl, 1-pentynyl, 2-pentynyl, 3-methyl-1-butynyl, and the like.

Acyl means any alkyl, alkenyl or alkynyl in which the carbon atom at the point of attachment is substituted with an oxo group as defined below. For example, —C (= O) alkyl, —C (= O) alkenyl, and —C (= O) alkynyl are acyl groups.

Heterocycle means a 5-7 membered monocyclic or 7-10 membered bicyclic, heterocyclic ring that is either saturated, unsaturated, or aromatic and which contains 1 or 2 heteroatoms independently selected from nitrogen, oxygen and sulfur, and wherein the nitrogen heteroatoms and sulfur can optionally be oxidized, and a nitrogen heteroatom can optionally be quaternized, including bicyclic rings in which any of the above heterocycles is fused to a benzene ring. The heterocycle can be attached through any heteroatom or carbon atom. Heterocycles include heteroaryls as defined below. Heterocycles include morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyl, piperizinyl, hydantoinyl, valerolactamyl, oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, tetrahydropyridinyl, tetrahydroprimidinyl, tetrahydrotirotirotiranyl, the like.

Optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted acyl, and optionally substituted heterocycle mean that, upon substitution, at least one hydrogen atom is replaced by a substituent. In the case of the oxo substituent (= O), two hydrogen atoms are replaced. In this regard, substituents include oxo, halogen, heterocycle, -CN, -OR _x , -NR _x R _y , -NR _x C (= O) R _y , -NR _x SO ₂ R _y , -C (= O) R _x , -C (= O) OR _x , -C (= O) NR _x R _y , -SO _n R _x and -SO _n NR _x R _y , where n is 0, 1, or 2, R _x and R _y are the same or different and independently represent hydrogen, alkyl or heterocycle, and each of said alkyl and heterocycle substituents may additionally be substituted by one or more of oxo, halogen, -OH, -CN, alkyl, -OR _x , heterocycle, - NR _x R _y , -NR _x C (= O) R _y , -NR _x SO ₂ R _y , -C (= O) R _x , -C (= O) OR _x , -C (= O) NR _x R _y , -SO _n R _x and -SO _n NR _x R _y .

- 46 037110

Halogen means fluorine, chlorine, bromine and iodine.

In some embodiments, the implementation of the methods according to the present invention may require the use of protective groups. The technique using protective groups is well known to those skilled in the art (see, for example, Protective Groups in Organic Synthesis, Green T.W. et al., Wiley-Interscience, New York City, 1999). Briefly, protecting groups in the context of the present invention are any group that reduces or eliminates unwanted reactivity of a functional group. A protecting group can be added to a functional group to block its reactivity during certain reactions and then removed to expose the original functional group. In some embodiments, a protecting group is used for the alcohol group. A protecting group for an alcohol group is any group that reduces or eliminates unwanted reactivity of the alcohol functional group. Protecting groups can be added and removed using techniques well known in the art.

Synthesis of A.

In some embodiments, the nucleic acid lipid particles of the present invention are formulated using a cationic lipid of formula A ^R 3 \ N --- R ₄ ^r i ^ R ₂ wherein R ₁ and R2 are independently alkyl, alkenyl, or alkynyl, each may be optionally substituted, and R3 and R4 are independently lower alkyl, or R3 and R4 may be taken together to form an optionally substituted heterocyclic ring. In some embodiments, the cationic lipid is XTS, (2,2-dilinoleyl-4-dimethylaminoethyl [1,3] dioxolane). Typically, a lipid of Formula A above can be prepared using the following Reaction Schemes 1 or 2, where all substituents are as defined above, unless otherwise indicated.

Scheme 1

Lipid A, where R ¹ and R ^{2 are} independently alkyl, alkenyl or alkynyl, each optionally substituted, and R ³ and R ^{4 are} independently lower alkyl, or R ³ and R ⁴ , taken together, can optionally form substituted heterocyclic ring can be prepared according to Scheme 1. Ketone 1 and bromide 2 can be purchased or prepared according to methods known to the person skilled in the art. Reaction between 1 and 2 gives ketal 3. Treatment of ketal 3 with amine 4 gives lipids of formula A. Lipids of formula A can be converted to the corresponding ammonium salt using an organic salt of formula 5 where X is an anion, a counterion selected from halogen, hydroxide, phosphate, sulfate or the like.

- 47 037110

Scheme 2

Alternatively, the starting material, ketone 1, can be prepared according to Scheme 2. Grignard reagent 6 and cyanide 7 can be purchased or prepared according to methods known to the person skilled in the art. The reaction between 6 and 7 gives ketone 1. The conversion of ketone 1 to the corresponding lipids of formula A is as described in Scheme 1.

Synthesis of MC3.

The preparation of DLin-M-C3-DMA (i.e. (62,92,282,312) -heptatriaconta-6,9,28,31-tetraen-19-yl-4- (dimethylamino) butanoate) was as follows. A solution of (62,92,282,312) -heptatriacont-6,9,28,31-tetraen-19ol (0.53 g), 4-Н, Н-dimethylaminobutyric acid hydrochloride (0.51 g), 4-Н, Н-dimethylaminopyridine (0.61 g) and 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride (0.53 g) in dichloromethane (5 ml) were stirred at room temperature overnight. The solution was washed with dilute hydrochloric acid followed by dilute aqueous sodium bicarbonate. The organics were dried over anhydrous magnesium sulfate, filtered, and the solvent was removed using a rotary vacuum evaporator. The residue was passed through a silica gel column (20 g) using a gradient elution of 1-5% methanol / dichloromethane. The fractions containing the purified product were combined and the solvent removed to give a colorless oil (0.54 g).

Synthesis of ALNY-100.

Synthesis of ketal 519 [ALNY-100] was carried out using the following scheme 3:

To a stirred suspension of LiAlH ₄ (3.74 g, 0.09852 mol) in 200 ml of anhydrous THF in two-necked RBF (1 L) was slowly added a solution of 514 (10 g, 0.04926 mol) in 70 ml THF at 0 ° C in nitrogen atmosphere. After the addition was complete, the reaction mixture was warmed to room temperature and then heated until condensation appeared for 4 hours. The reaction progress was monitored by TLC. After completion of the reaction (determined by TLC), the mixture was cooled to 0 ° C and quenched by the careful addition of saturated Na ₂ SO ₄ solution. The reaction mixture was stirred for 4 h at room temperature and filtered off. The residue was washed well with THF. The filtrate and the precipitate obtained from the washing were mixed and diluted with 400 ml of dioxane and 26 ml of conc. HCl, and stirred for 20 min at room temperature. The volatiles were distilled off in vacuo to give the hydrochloric salt 515 as a white solid. Yield: 7.12 g. 1 H-NMR (DMSO, 400 MHz): δ = 9.34 (broad, 2H), 5.68 (s, 2H), 3.74 (m, 1H), 2.66- 2.60 (m, 2H), 2.50-2.45 (m, 5H).

Synthesis 516.

_{NEt 3} (37.2 ml, 0.2669 mol) was added to a stirred solution of compound 515 in 100 ml dry DCM in 250 ml two-necked RBF and cooled to 0 ° C. under nitrogen. After slowly adding N (benzyloxycarbonyloxy) succinimide (20 g, 0.08007 mol) in 50 ml dry DCM, the reaction mixture was allowed to warm to room temperature. After completion of the reaction (2-3 h, determined by TLC), the mixture was washed sequentially with a solution of 1N. HCl (1x100 ml) and saturated solution

- 48 037110

NaHCO ₃ (1x50 ml). The organic layer was then dried over anhydrous. Na ₂ SO ₄ and the solvent was evaporated to give a crude material, which was purified by silica gel column chromatography to give 516 as a sticky mass. Yield: 11 g (89%). 1H-NMR (CDCl ₃ , 400 MHz): δ =

7.36-7.27 (m, 5H), 5.69 (s, 2H), 5.12 (s, 2H), 4.96 (br., 1H) 2.74 (s, 3H), 2 , 60 (m, 2H), 2.30-2.25 (m, 2H). LCMS [M + H] -232.3 (96.94%).

Synthesis of 517A and 517B.

Cyclopentene 516 (5 g, 0.02164 mol) was dissolved in a solution of 220 ml of acetone and water (10: 1) in one neck of 500 ml RBF and N-methylmorpholine-N-oxide (7.6 g, 0.06492 mol ), followed by 4.2 ml of a 7.6% solution of OsO ₄ (0.275 g, 0.00108 mol) in tert-butanol at room temperature. After completion of the reaction (~ 3 h), the mixture was quenched by the addition of solid Na ₂ SO ₃ and the resulting mixture was stirred for 1.5 h at room temperature. The reaction mixture was diluted with DCM (300 ml) and washed with water (2x100 ml), followed by saturated NaHCO ₃ solution (1x50 ml), water (1x30 ml) and finally brine (1x50 ml). The organic phase was dried over anhydrous. Na ₂ SO ₄ and the solvent was removed in vacuo. Purification of the crude material by silica gel column chromatography gave a mixture of diastereoisomers, which were separated using prep. HPLC. Yield: 6 g of crude product. 517A - peak-1 (white solid), 5.13 g (96%). ¹ H-NMR (DMSO, 400 MHz): δ = 7.39-7.31 (m, 5H), 5.04 (s, 2H), 4.78-4.73 (m, 1H), 4, 48-4.47 (d, 2H), 3.94-3.93 (m, 2H), 2.71 (s, 3H), 1.72-1.67 (m, 4H). LC-MS - [M + H] -266.3, [M + NH4 +] - 283.5 present, HPLC 97.86%. Stereochemistry was confirmed by X-ray.

Synthesis 518.

Using a procedure similar to that described for the synthesis of compound 505, compound 518 (1.2 g, 41%) was obtained as a colorless oil. 1H-NMR (CDCl ₃ , 400 MHz): δ = 7.35-7.33 (m, 4H), 7.30-7.27 (m, 1H), 5.37-5.27 (m, 8H ), 5.12 (s, 2H), 4.75 (m, 1H), 4.58-4.57 (n, 2H), 2.78-2.74 (n, 7H), 2.06- 2.00 (m, 8H), 1.96-1.91 (m, 2H), 1.62 (m, 4H), 1.48 (m, 2H), 1.37-1.25 (br m , 36H), 0.87 (m, 6H). HPLC-98.65%.

General procedure for the synthesis of compound 519.

A solution of compound 518 (1 eq.) In hexane (15 ml) was added dropwise to an ice-cold solution of LAH in THF (1M, 2 eq.). After the addition was complete, the mixture was heated at 40 ° C. for 0.5 h, then cooled again in an ice bath. The mixture was carefully hydrolyzed with saturated aqueous Na ₂ SO ₄ , then filtered through celite and transferred to oil. Column chromatography gave pure 519 (1.3 g, 68%) which was obtained as a colorless oil. 13C-NMR δ = 130.2, 130.1 (x2), 127.9 (x3), 112.3, 79.3, 64.4, 44.7, 38.3, 35.4, 31.5 , 29.9 (x2), 29.7, 29.6 (x2), 29.5 (x3), 29.3 (x2), 27.2 (x3), 25.6, 24.5, 23, 3, 226, 14.1; electrospray MS (+ ve): molecular weight for C ₄₄ H ₈₀ NO ₂ (M + H) ⁺ calc. 654.6, found 654.6.

Formulations obtained either by a standard method or by a non-extrusion method can be characterized in the same way. For example, formulations are typically characterized by visual inspection. These should be whitish transparent solutions, in which there are no aggregates or sediment. The particle size and particle size distribution of lipid nanoparticles can be measured by light scattering using, for example, a Malvern Zetasizer Nano ZS (Malvern, USA). The particle size should be about 20-300 nm, for example 40-100 nm. The particle size distribution should be unimodal. The total concentration of dsRNA in the formulation, as well as the captured fraction, is determined using a dye exclusion assay. A sample of the formulated dsRNA can be incubated with an RNA-binding dye such as Ribogreen (Molecular Probes) in the presence or absence of a degrading surfactant such as 0.5% TritonX100. The total dsRNA in the formulation can be determined by the signal from the sample containing the surfactant relative to the calibration curve. The captured fraction is determined by subtracting the free dsRNA content (as measured by the signal in the absence of surfactant) from the total dsRNA content. The percentage of dsRNA captured is typically> 85%. For the LNP composition, the particle size is at least 30 nm, at least 40 nm, at least 50 nm, at least 60 nm, at least 70 nm, at least 80 nm, at least 90 nm, at least at least 100 nm, at least 110 nm, and at least 120 nm. A suitable range is generally from about at least 50 nm to about at least 110 nm, from about at least 60 nm to about at least 100 nm, or from about at least 80 nm to about at least 90 nm.

Compositions and formulations for oral administration include powders or granules, microparticles, nanoparticles, suspensions or solutions in water or non-aqueous media, capsules, gelatin capsules, powder sachets for solution preparation, tablets or minitablets. Thickeners, fragrances, diluents, emulsifiers, dispersants, or binders may be needed. In some embodiments, oral formulations are those in which the dsRNAs described herein are administered in combination with one or more penetration enhancers, surfactants, and chelators. Suitable surfactants include fatty acids and / or their esters or salts,

- 49 037110 bile acids and / or their salts. Suitable bile acids / bile salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholeic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid, 2 sodium dihydrofusidate and sodium glycodihydrofusidate. Suitable fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, glycaprate, tricaperinocl 1-dodecylazacycloheptan-2-one, acylcarnitine, acylcholine or monoglyceride, diglyceride, or a pharmaceutically acceptable salt thereof (e.g. sodium). In some embodiments, combinations of penetration enhancers are used, for example, fatty acids / fatty acid salts in combination with bile acids / bile salts. One illustrative combination is the sodium salt of lauric acid, capric acid and UDCA. Additional penetration aids include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. The dsRNAs described in the present invention can be delivered orally, in the form of granules, including spray dried particles, or form complexes to form micro- or nanoparticles. Complexing agents for dsRNA include poly-amino acids; polyimines; polyacrylates; polyalkyl acrylates, polyoxethanes, polyalkyl cyanoacrylates; cationized gelatins, albumins, starches, acrylates, polyethylene glycols (PEG) and starches; polyalkyl cyanoacrylates; DEAE derivatives of polyimines, pollulans, celluloses and starches. Suitable complexing agents include chitosan, N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylaminomethylethylene (PTDAE), polyaminostyrol (e.g. p-amino), poly (methyl cyanoacrylate), poly (methyl cyanoacrylate) poly (butyl cyanoacrylate), poly (isobutyl cyanoacrylate), poly (isohexyl cyanoacrylate), DEAE-methacrylate, DEAE-hexyl acrylate, DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethyl acrylate, polyhexyl acrylate, L-mol DL-lactic and glycolic acid (PLGA), alginate and polyethylene glycol (PEG). Oral formulations for dsRNAs and their preparation are described in detail in US Pat. No. 6,887,906, US Publication No. 20030027780 and US Pat. No. 6,747,014, each of which is incorporated herein by reference.

Compositions and formulations for parenteral, intraparenchymal (to the brain), intrathecal, intraventricular, or intrahepatic administration may include sterile aqueous solutions, which may also contain buffers, diluents, and other appropriate additives such as, without limitation, penetration enhancers, compounds carriers and other pharmaceutically acceptable carriers or excipients.

Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. Such compositions can be prepared from a number of components, which include, but are not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semi-solids. In particular, formulations which target the liver in the treatment of liver diseases such as hepatocarcinoma are preferred.

The pharmaceutical compositions of the present invention, which may conveniently be presented in a unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing the active ingredients into contact with pharmaceutical (pharmaceutical) carrier (s) or excipient (s). Typically, the formulations are prepared by uniformly and thoroughly bringing the active ingredients into contact with liquid carriers or finely divided solid carriers, or both, and then shaping the product as needed.

The compositions of the present invention can be formulated in any of many possible dosage forms, such as, without limitation, tablets, capsules, gelatin capsules, liquid syrups, plastic gels, suppositories, and enemas. The compositions of the present invention can also be formulated as suspensions in aqueous, non-aqueous, or mixed media. Aqueous suspensions may additionally contain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethyl cellulose, sorbitol and / or dextran. The suspension may also contain stabilizers.

C. Additional formulations.

Emulsions.

The compositions of the present invention can be prepared and formulated as emulsions. Emulsions are typically heterogeneous systems of one liquid dispersed in another, in the form of droplets, which typically exceed 0.1 μm in diameter (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen LV, Popovich NG, and Ansel HC, 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and

- 50 037110

Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335; Higuchi et al., In Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often two-phase systems containing two immiscible liquid phases, thoroughly mixed and dispersed into one another. Typically, emulsions can be either water-in-oil (w / o) or oil-in-water (o / w) emulsions. In cases where the aqueous phase is finely dispersed in the total volume of the oil phase and dispersed in the form of tiny droplets in it, then the resulting composition is called a water-in-oil (w / o) emulsion. Alternatively, in cases where the oil phase is finely dispersed in the total volume of the aqueous phase and dispersed as fine droplets therein, then the resulting composition is referred to as an oil-in-water (o / w) emulsion. Emulsions may contain additional components in addition to the dispersed phases and the active drug, which may be present as a solution either in the aqueous phase, in the oil phase, or as such as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, colorants and antioxidants can be present in emulsions as needed. Pharmaceutical emulsions can also be multiple emulsions that consist of more than two phases, such as, for example, in the case of oil-in-water-in-oil (o / w / o) and water-in-oil emulsions. input (w / o / w). Such complex formulations often provide certain advantages that simple two-component emulsions do not provide. Multiple emulsions in which the individual o / w emulsion oil droplets comprise small water droplets constituting the w / o / w emulsion. Likewise, an oil droplet system enclosed in water droplets stabilized in an oil dispersant phase provides an o / w / o emulsion.

Emulsions are characterized by little or no thermodynamic stability. Often the dispersed or dispersed phase of the emulsion is well dispersed in the dispersed or dispersed phase and is maintained in that form by the emulsifiers or the viscosity of the formulation. Any phase of the emulsion can be semi-solid or solid, as in the case of ointment bases like emulsions and creams. Other methods of stabilizing emulsions include the use of emulsifiers, which can be included in any phase of the emulsion. Emulsifiers can generally be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and fine solids (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen LV, Popovich NG, and Ansel HC, 2004, Lippincott Williams & Wilkins (. 8 ^{th ed), New York, NY} ; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (. Eds), 1988, Marcel Dekker, Inc., New York , NY, volume 1, p. 199).

Synthetic surfactants, also known as surfactants, have found widespread use in emulsion formulations and have been reviewed in the literature (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen LV, Popovich NG, and Ansel HC, 2004, Lippincott Williams & Wilkins (. 8 ^{th ed), New York, NY} ; Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (. Eds), 1988, Marcel Dekker, Inc., New York , NY, volume 1, p 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, NY, 1988, volume 1, p. 199). Surfactants are usually amphiphilic and contain a hydrophilic and hydrophobic moiety. The ratio of the hydrophilic to hydrophobic nature of the surfactant is called the Hydrolipid Balance (HLB) and is a valuable tool in categorizing and selecting surfactants when formulating formulations. Surfactants can be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic, and amphoteric (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen LV, Popovich NG, and Ansel HC, 2004, Lippincott Williams & Wilkins (8 ^{th ed.), New York,} NY Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York , NY, volume 1, p. 285).

Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin, and gum arabic. Absorbent bases such as anhydrous lanolin and hydrophilic petrolatum are hydrophilic so that they can absorb water to form w / o emulsions, yet retain their semi-solid consistency. Finely divided solids have also been used as suitable emulsifiers, especially in combination with surfactants and in viscous formulations. These include polar inorganic solids such as heavy metal hydroxides, non-swelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and non-polar solids such as carbon or glyceryl tristearate.

A wide variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of the emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives, and antioxidants (Block, in

- 51 037110

Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York,

N.Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988,

Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

Hydrophilic colloids or hydrocolloids include naturally occurring resins and synthetic polymers such as polysaccharides (e.g., gum arabic, agar, alginic acid, carrageenan, guar gum, karaya gum and tragacanth), cellulose derivatives (e.g., carboxymethyl cellulose and synthetic polymers) for example, carbomers, cellulose ethers and carboxyvinyl polymers). They disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the droplets of the dispersed phase and by increasing the viscosity of the dispersed phase.

Since emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that can easily support microbial growth, such formulations often include preservatives. Commonly used preservatives included in emulsion formulations include methylparaben, propylparaben, quaternary ammonium salts, benzalkonium chloride, p-hydroxybenzoic acid esters and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent breakdown of the formulation. The antioxidants used may be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium matabisulfite, and antioxidant synergists such as citric acid, tartaric acid and lecithin.

The use of emulsion formulations via the dermatological, oral and parenteral routes and methods for their preparation have been reviewed in the literature (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen LV, Popovich NG, and Ansel HC, 2004, Lippincott Williams & Wilkins ( 8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 199). Oral delivery emulsion formulations are very widely used due to ease of formulation, absorption efficiency and bioavailability (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen LV, Popovich NG, and Ansel HC, 2004, Lippincott Williams & Wilkins (. 8 ^{th ed), New York, NY} ; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (. Eds), 1988, Marcel Dekker, Inc., New York , NY, volume 1, p 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 199). Mineral oil laxatives, fat-soluble vitamins, and high-fat nutritional formulations are among the materials commonly administered orally as o / w emulsions.

ii. Microemulsions.

In one embodiment of the present invention, the mRNA and nucleic acid compositions are formulated as microemulsions. A microemulsion can be defined as a system of water, oil and an amphiphilic substance that is a separate optically isotropic and thermodynamically stable liquid solution (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen LV, Popovich NG, and Ansel HC, 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 245). Typically microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, typically a medium chain alcohol, to form a clear system. Thus, microemulsions have also been described as thermodynamically stable, isotropically pure dispersions of two immiscible liquids that are stabilized by interfacial films of surfactant molecules (Leung and Shah, in Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff M., Ed., 1989 , VCH Publishers, New York, pages 185-215). Microemulsions are typically prepared by combining three to five components, which include oil, water, surfactant, secondary surfactant, and electrolyte. Whether a microemulsion is a water-in-oil (w / o) or an oil-in-water (o / w) emulsion depends on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the molecules. surfactant (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271).

The phenomenological phase diagram approach has been extensively explored and has provided a wealth of data on how to formulate microemulsions by those skilled in the art (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen LV, Popovich NG, and Ansel HC, 2004, Lippincott Williams & Wilkins (. 8 ^{th ed), New York, NY} ; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (. Eds), 1988, Marcel Dekker, Inc., New York , NY, volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 335). Compared to traditional emulsions, microemulsions offer the advantage of stabilizing water-insoluble drugs in thermodynamically stable droplets that form spontaneously.

- 52 037110

Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, nonionic surfactants, Brij 96, polyoethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310 ), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), decaglycerol decoleate (DAO750), separately or in combination with secondary surfactants. A secondary surfactant, usually a short chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase interfacial fluidity by penetrating the surfactant film and thus creating a disordered film due to empty space formed among surfactant molecules. However, microemulsions can be prepared without the use of secondary surfactants, and self-emulsifying microemulsion systems without alcohol are known in the art. The aqueous phase can typically be water, an aqueous solution of a drug, glycerin, PEG300, PEG400, polyglycerols, propylene glycols, and ethylene glycol derivatives. The oily phase can include, without limitation, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C ₈ -C ₁₂ ) mono-, di- and triglycerides, polyoxyethylated fatty acid glyceryl esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C ₈ -C ₁₀ glycerides, vegetable oils and silicone oil.

Microemulsions are of particular interest in terms of drug solubility and enhanced drug absorption. Lipid microemulsions (both o / w and w / o) have been proposed to increase the oral bioavailability of drugs, including peptides (see, for example, U.S. Patent No. 6191105; 7063860; 7070802; 7157099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find Exp Clin Pharmacol 1993, 13, 205). Microemulsions provide advantages in the form of improved drug solubility, protection of the drug from enzymatic hydrolysis, possible increase in drug absorption due to surfactant-induced changes in membrane fluidity and permeability, ease of preparation, ease of oral administration compared to solid dosage form, improved clinical efficacy and reduced toxicity (see, for example, US patent No. 6191105; 7063860; 7070802; 7157099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85 , 138-143). Microemulsions can often form spontaneously when their components are combined at ambient temperature. This can be particularly advantageous when thermolabile drugs, peptides or mRNA are formulated. Microemulsions have also been effective in the transdermal delivery of active ingredients in both cosmetic and pharmaceutical applications. It is expected that the compositions and formulations of microemulsions according to the present invention will promote increased systemic absorption of mRNA and nucleic acids from the gastrointestinal tract, as well as improve local cellular uptake of mRNA and nucleic acids.

The microemulsions of the present invention may also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol and penetration enhancers to improve formulation properties and to enhance the absorption of mRNA and nucleic acids of the present invention. Penetration enhancers used in the microemulsions of the present invention can be classified as belonging to one of five main categories: surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed above.

iii. Microparticles.

The RNAi agent of the present invention can be incorporated into a particle, eg, a microparticle. Microparticles can be produced by spray drying, but can also be produced by other methods, including lyophilization, evaporation, fluidized bed drying, vacuum drying, or a combination of these techniques.

iv. Substances that promote penetration.

In one embodiment, the present invention employs a variety of permeation enhancers to effect efficient delivery of nucleic acids, in particular mRNA, to animal skin. Most drugs are present in solution in both ionized and non-ionized forms. However, as a rule, only fat-soluble or lipophilic drugs readily pass through cell membranes. It has been found that even non-lipophilic drugs can pass through cell membranes if the membrane to be passed through is treated with a penetration enhancer. In addition to allowing non-lipophilic drugs to diffuse across cell membranes, permeation enhancers also increase permeability to lipophilic drugs.

Penetrating agents can be classified as belonging to the same

- 53,037110 out of five main categories, i.e. surfactants, fatty acids, bile salts, chelating agents and non-chelating non-surfactants (see, for example,

Malmsten M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et ai.,

Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92). Each of the above classes of penetration enhancers is described in more detail below.

Surfactants (or surfactants) are chemical structural units that, when dissolved in an aqueous solution, reduce the surface tension of a solution or the interfacial tension between an aqueous solution and another liquid, as a result of which the absorption of mRNA through the mucous membrane is increased. In addition to bile salts and fatty acids, these penetration aids include, for example, sodium lauryl sulfate, polyoxyethylene 9 lauryl ether, and polyoxyethylene 20 cetyl ether (see, for example, Malmsten M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92) and perfluorinated emulsions such as FC-43. Takahashi et al. J. Pharm. Pharmacol., 1988, 40, 252).

A variety of fatty acids and their derivatives that act as permeation aids include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate , tricaprate, monoolein (1-monooleoyl-rac-glycerin), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, their C _1-20 alkyl esters methyl, isopropyl and tert-butyl) and their mono- and diglycerides (i.e. oleate, laurate, caprate, miistat, palmitate, stearate, linoleate, etc.). (see, for example, Touitou E., et al., Enhancement in Drug Delivery, CRC Press, Danvers, MA, 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol, 1992, 44, 651-654).

The physiological role of bile includes aiding the distribution and absorption of lipids and fat-soluble vitamins (see, for example, Malmsten M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Brunton, Chapter 38 in: Goodman &Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al., Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural bile salts and their synthetic derivatives act as permeation aids. Thus, the expression of bile salts includes any naturally occurring bile components as well as any of their synthetic derivatives. Suitable bile salts include, for example, cholic acid (or a pharmaceutically acceptable sodium salt thereof, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid, sodium taurodeoxycholate), sodium ursodeoxycholate, sodium taurodeoxycholate) -9-lauryl ether (POE) (see, for example, Malmsten M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18 ^th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems 1990, 7, 1-33; Yamamoto et al. J. Pharm. Exp. Ther. 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).

Chelating agents used in connection with the present invention can be defined as compounds that remove metal ions from solution by complexing with them, thereby increasing the absorption of mRNA through the mucosa. With regard to their use as penetration aids, chelating agents in the present invention have the additional advantage of also acting as DNase inhibitors, since most of the characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Suitable chelating agents include, but are not limited to, disodium ethylenediamine tetraacetate (EDTA), citric acid, salicylates (e.g. sodium salicylate, 5-methoxysalicylate and homovalate), N-acyl derivatives of collagen, laureth-9, and N-aminoacyl derivatives of β-diketones (cm. e.g. Katdare A. et al., Excipient development for pharmaceutical, biotechnology, and drug delivery, CRC Press, Danvers MA, 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990,7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51).

As used herein, non-chelating, non-surfactant penetration-promoting compounds can be defined as compounds that exhibit little activity as chelating agents or surfactants, but which nevertheless increase the absorption of mRNA through the gastrointestinal mucosa (see. e.g. Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetrating agents includes, for example, unsaturated cycloureas derived from 1-alkyl 1-alkenylazacycloalkanone (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page

92) and non-steroidal anti-inflammatory drugs such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol. 1987, 39, 621-626).

Agents that enhance the uptake of mRNA at the cellular level can also be added to pharmaceutical and other compositions of the present invention. For example, cationic lipids such as lipofectin (Junichi et al., US patent No. 5705188), cationic derivatives of glycerol and polycationic molecules such as polylysine (Lollo et al., PCT application WO 97/30731) are also known to enhance cellular uptake of dsRNA. Examples of commercially available transfection reagents include, for example, Lipofectamine ™ (Invitrogen; Carlsbad, CA), Lipofectamine 2000 ™ (Invitrogen; Carlsbad, CA), 293fectin ™ (Invitrogen; Carlsbad, CA), Cellfectin ™ (Invitrogen; Carlsbad, CA), CA), DMRIE-C ™ (Invitrogen; Carlsbad, CA), FreeStyle ™ MAX (Invitrogen; Carlsbad, CA), Lipofectamine ™ 2000 CD (Invitrogen; Carlsbad, CA), Lipofectamine ™ (Invitrogen; Carlsbad, CA), RNAiMAX ( Invitrogen; Carlsbad, CA), Oligofectamine ™ (Invitrogen; Carlsbad, CA), Optifect ™ (Invitrogen; Carlsbad, CA), X-tremeGENE Q2 Transfection Reagent (Roche; Grensacherstrasse, Switzerland), Liposomal Transfection Reagent Grenzaherstrasse, DOT Switzerland), liposome transfection reagent DOSPER (Grensacherstrasse, Switzerland) or Fugene (Grensacherstrasse, Switzerland), Transfectam® reagent (Promega; Madison, WI), TransFast ™ transfection reagent (Promega; Madison, WI), Tfx ™ -20 reagent (Promega; Madison, WI), Tfx ™ -50 reagent (Promega; Madison, WI), DreamFect ™ (OZ Biosciences; Marseille, France), EcoTransfect (OZ Biosciences; Marseille, France), TransPass ^a D1 transfection reagent (New England Biolabs; Ipswich, MA, USA), LyoVec ™ / LipoGen ™ (Invitrogen; San Diego, CA, USA), PerFectin Transfection Reagent (Genlantis; San Diego, CA, USA), NeuroPORTER Transfection Reagent (Genlantis; San Diego , CA, USA), GenePORTER transfection reagent (Genlantis; San Diego, CA, USA), GenePORTER 2 transfection reagent (Genlantis; San Diego, CA, USA), Cytofectin transfection reagent (Genlantis; San Diego, CA, USA), BaculoPORTER Transfection Reagent (Genlantis; San Diego, CA, USA), TroganPORTER ™ Transfection Reagent (Genlantis; San Diego, CA, USA), RiboFect (Bioline; Taunton, MA, USA), PlasFect (Bioline ; Taunton, MA, USA), UniFECTOR (B-Bridge International; Mountain View, CA, USA), SureFECTOR (B-Bridge International; Mountain View, CA, USA) or HiFect ™ (B-Bridge International, Mountain View, CA, USA).

Other agents can be used to enhance the penetration of the introduced nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrroles such as 2-pyrrole, azones and terpenes such as limonene and menthone.

v. Carriers.

Certain compositions of the present invention also contain carrier compounds. As used herein, the expressions carrier compound or carrier may mean a nucleic acid or an analogue thereof that is inert (i.e., does not possess biological activity perse), but is recognized as a nucleic acid in vivo by processes that reduce the bioavailability of the nucleic acid from biological activity, for example, by destroying biologically active nucleic acid or by facilitating its removal from the bloodstream. Co-administration of a nucleic acid and a carrier compound, usually with an excess of the latter, can lead to a significant reduction in the amount of nucleic acid processed by the liver, kidneys, or other extravascular depots, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, the processing of partially phosphorothioate dsRNA in liver tissue can be reduced when it is co-administered with polyinosinic acid, dextran sulfate, polycytidic acid, or 4-acetamido4'isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et al., DsRNA Res. Dev. Dev ., 1995, 5, 115-121; Takakura et al., DsRNA & Nucl. Acid Drug Dev., 1996, 6, 177-183.

vi. Fillers.

Unlike a carrier compound, a pharmaceutical carrier or excipient is a pharmaceutically acceptable diluent, suspending agent, or any other pharmacologically inert medium for delivering one or more nucleic acids to an animal. The filler can be liquid or solid and is selected based on the intended route of administration in order to provide the desired volume, consistency, etc., when combined with nucleic acid and other components of the pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binders (eg, pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (eg lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or dibasic calcium phosphate, etc.); lubricants - 55,037110 substances (for example, magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metal stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (eg starch, sodium starch glycolate, etc.) and wetting agents (eg sodium lauryl sulfate, etc.).

Pharmaceutically acceptable organic or inorganic excipients suitable for administration other than parenteral, which do not react adversely with nucleic acids, can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, saline solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone, and the like.

Formulations for topical application of nucleic acids can include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of nucleic acids in liquid or solid oil bases. Solutions can also contain buffers, diluents, and other suitable additives. You can use pharmaceutically acceptable organic or inorganic excipients, suitable for administration other than parenteral, which do not adversely interact with nucleic acids.

Suitable pharmaceutically acceptable excipients include, but are not limited to, water, saline solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone, and the like. vii. Other components.

The compositions of the present invention may further comprise other adjuvants conventionally found in pharmaceutical compositions at application levels established in the art. Thus, for example, the compositions may contain additional compatible pharmaceutically active materials such as, for example, antipruritic agents, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials suitable for physically formulating the compositions of the present invention in various dosage forms, such as colorants, flavors, preservatives, antioxidants, opacifiers, thickeners and stabilizers. However, such materials, when added, should not unduly conflict with the biological activities of the components of the compositions of the present invention. The formulations can be sterile and, if necessary, can be mixed with adjuvants, for example, lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorants, flavors and / or fragrances, and the like, which do not adversely interact with the nucleic acid (s) of the composition.

Aqueous suspensions may contain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethyl cellulose, sorbitol and / or dextran. The suspension may also contain stabilizers.

In some embodiments, the pharmaceutical compositions described herein comprise (a) one or more mRNA compounds, and (b) one or more agents that act by a mechanism other than RNAi and that are useful in treating a clotting disorder blood. Examples of such agents include, but are not limited to, an anti-inflammatory agent, an anti-steat agent, an antiviral agent, and / or an anti-fibrosis agent. In addition, other substances commonly used to protect the liver, such as silymarin, can also be used in combination with the mRNAs described herein. Other agents useful in the treatment of liver diseases include telbivudine, entecavir, and protease inhibitors such as telaprevir and others, as disclosed, for example, in US Patent Application Publication Nos. 2005/0148548, 2004/0167116 and 2003/0144217, Tung et al. , and in US Patent Application Publication No. 2004/0127488, Hale et al.

The toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, for example, to determine LD ₅₀ (dose lethal to 50% of the population) and ED ₅₀ (dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effect is the therapeutic index and can be expressed as the ratio LD ₅₀ / ED ₅₀ . Compounds that have a high therapeutic index are preferred.

Data from cell culture and animal studies can be used to formulate a range of doses for use in humans. In the present invention, the dose of the compositions described herein is typically in the circulating concentration range that includes the ED50 with little or no toxicity. The dose can vary within this range depending on the dosage form used and the route of administration used. For any compound used in the methods of the present invention, the therapeutically effective dose can be initially determined from cell culture assays. The dose can be formulated in animal models to obtain a concentration range of circulating plasma compound or, if necessary, a polypeptide product of the target sequence.

56 037110 (eg, achieving a reduced polypeptide concentration), which includes an IC50 (ie, the concentration of test compound that achieves half-maximal inhibition of symptoms) as determined in cell culture. This information can be used to more accurately determine the appropriate dose in humans. Plasma levels can be measured, for example, using high performance liquid chromatography.

In addition to their administration, discussed above, the mRNAs described in the present invention can be administered in combination with other known agents effective in the treatment of pathological processes mediated by the expression of PCSK9. In any case, the supervising physician can adjust the amount and timing of mRNA administration based on the results observed using standard efficacy measures known in the art or described herein.

IV. Methods for inhibiting expression of PCSK9.

The present invention provides methods for inhibiting the expression of proprotein convertase subtilisin / kexin 9 (PCSK9) in a cell. The methods include contacting the cell with an RNAi agent, eg, a double-stranded RNAi agent, in an amount effective to inhibit expression of PCSK9 in the cell, thereby inhibiting expression of PCSK9 in the cell.

Contacting the cell with the double-stranded RNAi agent can be performed in vitro or in vivo. In vivo, contacting a cell with an RNAi agent comprises contacting a cell or group of cells from a subject, eg, a human subject, with an RNAi agent. Combinations of in vitro and in vivo contacting methods are also possible. Bringing into contact can be direct or indirect, as discussed above. Moreover, contacting the cell can be accomplished with a targeting ligand, including any ligand described herein or known in the art. In preferred embodiments, the targeting ligand is a carbohydrate moiety, eg, a GalNAc3 ligand, or any other ligand that directs the RNAi agent to a site of interest, eg, the liver of a subject.

The expression inhibition, as used herein, is used interchangeably with contraction, silencing, down-regulation, and the like, and includes any level of inhibition.

The phrase inhibiting the expression of PCSK9 is intended to mean inhibiting the expression of any PCSK9 gene (such as, for example, the mouse PCSK9 gene, the rat PCSK9 gene, the monkey PCSK9 gene, or the human PCSK9 gene), as well as variants or mutants of the PCSK9 gene. Thus, the PCSK9 gene can be a wild-type PCSK9 gene, a mutant PCSK9 gene, or a transgenic PCSK9 gene in the context of genetically manipulated cells, group of cells, or organism.

Inhibition of the expression of the PCSK9 gene includes any level of inhibition of the PCSK9 gene, for example, at least partial suppression of the expression of the PCSK9 gene. Expression of the PCSK9 gene can be assessed based on the level or change in the level of any variable associated with the expression of the PCSK9 gene, for example, the level of PCSK9 mRNA, the level of the PCSK9 protein, or lipid levels. This level can be assessed in a single cell or in a group of cells, including, for example, a sample obtained from a subject.

Inhibition can be assessed by the decrease in the absolute or relative level of one or more variables that are associated with the expression of PCSK9, compared with the control level. The control level can be any type of control level that is used in the art, for example, the baseline level before drug administration, or the level determined in a similar subject, cell or sample that has not been treated or treated with a control (such as, for example, a control with only buffer or control with an inactive agent).

In some embodiments of the methods of the present invention, expression of the PCSK9 gene is inhibited by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25 %, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

Evidence of inhibition of the expression of the PCSK9 gene can be a decrease in the amount of mRNA expressed by the first cell or the first group of cells (such cells may be present, for example, in a sample obtained from a subject) in which the PCSK9 gene is transcribed and which or which have been treated (for example, by bringing the cell or cells in contact with the RNAi agent of the present invention or by administering the RNAi agent of the present invention to the subject in which the cells are or have been) such that expression of the PCSK9 gene is inhibited as compared to the second cell or second group of cells essentially identical to the first cell or group of cells, but which or which were not treated (control cell (s)). In preferred embodiments, inhibition is assessed by expressing the level of mRNA in treated cells as a percentage of the level of mRNA in control cells using the following formula:

| (mRNA in control cells) - (mRNA in treated cells) _{1 l} . _c (mRNA in control cells)

Alternatively, inhibition of PCSK9 gene expression can be assessed by a decrease in a score that is functionally related to PCSK9 gene expression, eg, expression of the PCSK9 protein, eg, lipid levels, cholesterol levels, eg, LDLc levels. Silencing of the PCSK9 gene can be detected in any cell expressing PCSK9, either constitutively or by genetic engineering, and using any assay known in the art. The liver is the main site of PCSK9 expression. Other important sites of expression include the pancreas, kidney, and intestines.

Evidence for inhibition of the expression of the PCSK9 protein may be a decrease in the level of the PCSK9 protein that is expressed by a cell or group of cells (eg, the level of protein expressed in a sample obtained from a subject). As explained above in relation to the assessment of mRNA suppression, inhibition of protein expression levels in a treated cell or group of treated cells can similarly be expressed as a percentage of the protein level in a control cell or a group of control cells.

A control cell or group of control cells that can be used to assess inhibition of expression of the PCSK9 gene include a cell or group of cells that have not yet been contacted with the RNAi agent of the present invention. For example, a control cell or group of control cells can be obtained from a separate subject (eg, a human subject or an animal subject) prior to treating the subject with an RNAi agent.

The level of PCSK9 mRNA that is expressed by a cell or group of cells can be determined using any method known in the art to assess mRNA expression. In one embodiment, the level of expression of PCSK9 in the sample is determined by detecting the transcribed polynucleotide or a portion thereof, for example, mRNA of the PCSK9 gene. RNA can be extracted from cells using RNA extraction techniques including, for example, acidic phenol / guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNeasy RNA extraction kits (Qiagen), or PAXgene (PreAnalytix, Switzerland). Typical assay formats that use ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays (Melton et al., Nuc. Acids Res. 12: 7035), Northern blotting, in situ hybridization, and microarray analyzes.

In one embodiment, the expression level of PCSK9 is determined using a nucleic acid probe. The expression probe, as used herein, means any molecule that is capable of selectively binding to a specific PCSK9. Probes can be synthesized by a person skilled in the art or obtained from appropriate biological preparations. Probes containing a label can be specially designed. Examples of molecules that can be used as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.

The isolated mRNAs can be used in hybridization or amplification assays, which include, but are not limited to, Southern or Northern blotting assays, polymerase chain reaction (PCR) assays, and probe arrays. One method for determining mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to PCSK9 mRNA. In one embodiment, the mRNA is immobilized on a solid surface and contacted with a probe, for example by passing the isolated mRNA through an agarose gel and transferring the mRNA from the gel to a membrane such as nitrocellulose. In an alternative embodiment, the probe (s) are immobilized on a solid surface and the mRNA is contacted with the probe (s), for example, on an Affymetrix gene microarray. One of ordinary skill in the art can easily adapt known mRNA detection methods for use in determining PCSK9 mRNA levels.

An alternative method for determining the level of expression of PCSK9 in a sample includes a method for amplifying a nucleic acid and / or reverse transcription (to obtain cDNA), for example, mRNA in a sample, for example, using RT-PCR (experimental embodiment set forth in Mullis, 1987, US patent No. 4683202 ), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88: 189-193), self-sustaining sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87: 1874- 1878), a transcription-mediated amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86: 1173-1177), Q-β replicase (Lizardi et al. (1988) Bio / Technology 6: 1197 ), rolling ring replication (Lizardi et al., US patent No. 5854033), or any

- 58 037110 another method for amplifying a nucleic acid, followed by the detection of amplified molecules using techniques well known to the person skilled in the art. Such detection schemes are especially useful for detecting nucleic acid molecules if such molecules are present in very small quantities. In specific aspects of the present invention, PCSK9 expression levels are determined using a fluorogenic RT-PCR (ie, TaqMan ™ System).

Expression levels of PCSK9 mRNA can be monitored using a membrane blot (such as used in hybridization assays such as Northern, Southern, Dot, etc.) or microwells, test tubes, gels, beads or fibers (or any solid support, containing linked nucleic acid). See US Patent Nos. 5770722, 5874219, 5744305, 5677195 and 5445934, which are incorporated herein by reference. Determining the expression level of PCSK9 can also involve the use of probes for the nucleic acid in solution.

In preferred embodiments, mRNA expression level is assessed using branched DNA assays (bDNA) or real-time PCR (qPCR). The use of such techniques is described and illustrated in the Examples section of this document.

The expression level of the PCSK9 protein can be determined using any method known in the art for measuring protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, liquid or gel precipitation reactions, absorption spectroscopy, colorimetric assays, spectrophotometric assays, immunodiffusion or diffuse double), immunoelectrophoresis, Western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISA), immunofluorescence assays, electrochemiluminescence assays, etc.

The expression sample, as used herein, means the selection of similar fluids, cells or tissues isolated from a subject's body, as well as fluids, cells or tissues present in a subject's body. Examples of biological fluids include blood, serum and serous fluids, plasma, lymph, urine, cerebrospinal fluid, saliva, intraocular fluids, and the like. Tissue samples can include tissue, organ, or local tissue samples. For example, samples can be obtained from specific organs, parts of organs, or fluids or cells in those organs. In certain embodiments, samples can be obtained from the liver (eg, the entire liver, or certain segments of the liver, or certain types of cells in the liver, such as, for example, hepatocytes). In preferred embodiments, the implementation of the sample obtained from the subject means blood or plasma obtained from the subject. In additional embodiments, the implementation of the sample obtained from the subject means liver tissue obtained from the subject.

In some embodiments of the methods of the present invention, the RNAi agent is administered to a subject such that the RNAi agent is delivered to a specific site in the subject's body. Inhibition of PCSK9 expression can be assessed by measuring the level or change in the level of PCSK9 mRNA or PCSK9 protein in a sample obtained from a fluid or tissue from a specific location in a subject. In preferred embodiments, the site is liver. The site can also be a subsection or subset of cells from any of the above locations. The site can also include cells that express a particular type of receptor.

V. Methods for Treating or Preventing PCSK9 Associated Disease.

The present invention also provides methods for treating or preventing diseases and conditions that can be affected by down-regulating the expression of the PCSK9 gene. For example, the compositions described herein can be used to treat lipidemia, such as hyperlipidemia, and other forms of lipid imbalance such as hypercholesterolemia, hypertriglyceridemia, and pathological conditions associated with these disorders, such as heart disease and diseases associated with the disorder. blood circulation. Other diseases and conditions that can be affected by downregulating the expression of the PCSK9 gene include lysosomal storage disease, including, but not limited to, Niemann-Pick disease, Tay-Sachs disease, lysosomal acid lipase deficiency, and Gaucher disease. The methods include administering to a subject a therapeutically effective amount or a prophylactically effective amount of an RNAi agent of the present invention. In some embodiments, the method comprises administering an effective amount of PCSK9 siRNA to a patient with a heterozygous LDLR genotype.

The effect of reducing the expression of the PCSK9 gene preferably leads to a decrease in the levels of LDLc (low density lipoprotein cholesterol) in the blood, and more particularly in the serum of a mammal. In some embodiments, LDLc levels are reduced by at least 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90% or more compared to pre-treatment levels.

As used herein, the expression “subject” includes a human or non-human animal, preferably a vertebrate and more preferably a mammal. The subject can include a transgenic organism. Most preferably, the subject is a human, such as a human suffering from a PCSK9-associated disease or predisposed to

- 59 037110 for its development.

In some embodiments of the methods of the present invention, the expression of PCSK9 is decreased over an extended period of time, for example, at least one week, two weeks, three weeks, or four weeks, or longer. For example, in some cases, expression of the PCSK9 gene is suppressed by at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50% by administration of the mRNA agent described herein. In some embodiments, the PCSK9 gene is inhibited by at least about 60%, 70%, or 80% by administration of an mRNA agent. In some embodiments, the PCSK9 gene is inhibited by at least about 85%, 90%, or 95% by the introduction of a double-stranded oligonucleotide.

The RNAi agents of the present invention can be administered to a subject using any route of administration known in the art, including, but not limited to, subcutaneous, intravenous, intramuscular, intraocular, intrabronchial, intrapleural, intraperitoneal, intraarterial, lymphatic, spinal, and any combination thereof. ... In preferred embodiments, the agents are administered subcutaneously.

In some embodiments, administration is by injection of a sustained release agent. Injection of the sustained release agent can release the RNAi agent in a sustained manner over an extended period of time. Thus, by injection of a sustained release agent, it is possible to reduce the frequency of dosing necessary to obtain the desired effect, for example the desired inhibition of PCSK9, or a therapeutic or prophylactic effect. Delayed absorption may also provide for more stable serum concentrations. Delayed absorption injections may include subcutaneous injections or intramuscular injections. In preferred embodiments, the injection of the sustained release agent is subcutaneous injection.

In some embodiments, administration is by pump. The pump can be an external pump or a surgically implanted pump. In certain embodiments, the pump is a subcutaneously implanted osmotic pump. In other embodiments, the pump is an infusion pump. The infusion pump can be used for intravenous, subcutaneous, arterial, or epidural infusions. In preferred embodiments, the infusion pump is a subcutaneous infusion pump. In other embodiments, the pump is a surgically implantable pump that delivers the RNAi agent to the liver.

Other routes of administration include epidural, intracerebral, intracerebroventricular, nasal, intraarterial, intracardiac, intraosseous infusion, intrathecal, and intravitreal, and pulmonary. The route of administration can be selected based on whether a local or systemic treatment is required and based on the area to be treated. The route and site of injection can be selected to increase the targeted exposure.

The method comprises administering an mRNA agent, eg, a dose sufficient to lower PCSK9 mRNA levels for at least 5, more preferably 7, 10, 14, 21, 25, 30 or 40 days; and optionally administering a second single dose of dsRNA, wherein the second single dose is administered at least 5, more preferably 7, 10, 14, 21, 25, 30, or 40 days after the first single dose, thereby inhibiting expression of the PCSK9 gene in subject.

In one embodiment, the doses of the mRNA agent of the present invention are administered no more than once every four weeks, no more than once every three weeks, no more than once every two weeks, or no more than once every week. In another embodiment, the administrations can last for one, two, three, or six months, or one year, or longer.

In another embodiment, administration may be contemplated when levels of low density lipoprotein cholesterol (LDLc) reach or exceed a predetermined minimum level, such as greater than 70, 130, 150, 200, 300, or 400 mg / dL.

Typically, the mRNA agent does not activate the immune system, for example, it does not increase cytokine levels such as TNF-α or IFN-α levels. For example, when measured by assays such as an in vitro PBMC assay such as described herein, the increase in TNF-α or IFN-α levels is less than 30, 20, or 10% of the level in control cells treated with control dsRNA such as dsRNA, which does not target PCSK9.

For example, a therapeutic amount of an mRNA agent, such as 0.5, 1.0, 1.5, 2.0, or 2.5 mg / kg dsRNA, can be administered to a subject. The mRNA agent can be administered by intravenous infusion over a period of time, such as over a period of 5, 10, 15, 20 or 25 minutes. The administration is repeated, for example, regularly, such as every two weeks (ie, every two weeks) for one month, two months, three months, four months or longer. After the primary treatment regimen, treatments can be administered less frequently. For example, after administration every two weeks for three months, the administration can be repeated once a month at

- 60 037110 for six months, or a year, or longer. Administration of an mRNA agent can reduce PCSK9 levels, for example, in a cell, tissue, blood, urine, or other part of a patient's body, by at least 10%, at least 15%, at least 20%, by at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least at least 90% or more.

Before the full dose of the mRNA agent is administered, patients can be given a lower dose, such as a 5%> infusion reaction, and monitored for adverse effects such as allergic reactions or increased lipid levels or blood pressure. ... In another example, a patient can be observed for an undesirable immunostimulatory effect, such as an increase in cytokine levels (eg, TNF-α or INF-α).

The effect of treatment or preventive action is obvious when there is a statistically significant improvement in one or more indicators of a disease state, or in the absence of aggravation or development of symptoms in cases where they, under other circumstances, were predicted. As an example, a favorable change in the measured disease score of at least 10%, and preferably at least 20, 30, 40, 50% or more, can be indicative of effective treatment. The efficacy for a given mRNA agent according to the present invention, or the composition of such an mRNA agent, can also be judged using an experimental animal model for a given disease, which is known in the art. In an experimental animal model, treatment is proven effective if a statistically significant decrease in marker or decrease in symptom is observed.

In one embodiment, the RNAi agent is administered at a dose of from about 0.25 mg / kg to about 50 mg / kg, for example, from about 0.25 mg / kg to about 0.5 mg / kg, from about 0.25 mg / kg to about 1 mg / kg, from about 0.25 mg / kg to about 5 mg / kg, from about 0.25 mg / kg to about 10 mg / kg, from about 1 mg / kg to about 10 mg / kg , about 5 mg / kg to about 15 mg / kg, from about 10 mg / kg to about 20 mg / kg, from about 15 mg / kg to about 25 mg / kg, from about 20 mg / kg to about 30 mg / kg, from about 25 mg / kg to about 35 mg / kg, or from about 40 mg / kg to about 50 mg / kg.

In some embodiments, the RNAi agent is administered at a dose of about 0.25 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 6 mg / kg, about 7 mg / kg, about 8 mg / kg, about 9 mg / kg, about 10 mg / kg, about 11 mg / kg, about 12 mg / kg, about 13 mg / kg, about 14 mg / kg, about 15 mg / kg, about 16 mg / kg, about 17 mg / kg, about 18 mg / kg, about 19 mg / kg, about 20 mg / kg, about 21 mg / kg, about 22 mg / kg, about 23 mg / kg, about 24 mg / kg, about 25 mg / kg, about 26 mg / kg, about 27 mg / kg, about 28 mg / kg, about 29 mg / kg, 30 mg / kg, about 31 mg / kg, about 32 mg / kg, about 33 mg / kg, about 34 mg / kg, about 35 mg / kg, about 36 mg / kg, about 37 mg / kg, about 38 mg / kg, about 39 mg / kg, about 40 mg / kg, about 41 mg / kg, about 42 mg / kg, about 43 mg / kg, about 44 mg / kg, about 45 mg / kg, about 46 mg / kg , about 47 mg / kg, about 48 mg / k g, about 49 mg / kg or about 50 mg / kg. In one embodiment, the mRNA agent is administered at a dose of about 25 mg / kg.

The dose of the RNAi agent that is administered to a subject can be adjusted to balance the risks and benefits of a given dose, for example, to achieve the desired level of suppression of the PCSK9 gene (as determined, for example, in terms of suppression of PCSK9 mRNA, expression of the PCSK9 protein, or lowering of lipid levels) or necessary therapeutic or prophylactic action, while at the same time avoiding unwanted side effects.

In some embodiments, the RNAi agent is administered in two or more doses. If necessary, to facilitate repetitive or frequent infusions, implantation of a delivery device, such as a pump, a semi-permanent stent (eg, intravenous, intraperitoneal, intracisternal, or intraarticular), or vessel may be appropriate. In some embodiments, the number or number of sequential doses depends on achieving the desired effect, such as suppressing the PCSK9 gene, or achieving a therapeutic or prophylactic effect, such as reducing a symptom of hypercholesterolemia. In some embodiments, the RNAi agent is administered according to a schedule. For example, the RNAi agent can be administered once a week, twice a week, three times a week, four times a week, or five times a week. In some embodiments, the regimen includes administrations at regular intervals, for example, every hour, every 4 hours, every 6 hours, every 8 hours, every 12 hours, every day, every 2 days, every 3 days, every 4 days, every 5 days , once a week, once every two weeks or once a month. In other embodiments, the regimen comprises administrations at short intervals followed by a longer period of time during which the agent is not administered. For example, a regimen may include an initial set of doses that are administered over a relatively short period of time (e.g., about every 6 hours, about every 12 hours, about every 24 hours, about every 48 hours, or about every 72 hours) followed by a longer period. time (eg, about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, or about 8 weeks) during which the RNAi agent is not administered. In one embodiment, the RNAi agent is initially administered hourly and subsequently administered at longer intervals (eg, once a day, once a week, once every two weeks, or once a month). In another embodiment, the RNAi agent is initially administered daily and subsequently administered at longer intervals (eg, weekly, biweekly, or monthly). In some embodiments, the implementation of the longer interval increases over time, or is determined based on the achievement of the desired effect. In a specific embodiment, the RNAi agent is administered once a day for the first week, followed by dosing once a week starting on the eighth day of administration. In another specific embodiment, the RNAi agent is administered every other day during the first week, followed by dosing once a week starting on the eighth day of administration.

In one embodiment, the mRNA agent is administered twice a week. In one embodiment, the mRNA agent is administered twice weekly at a dose of 1 mg / kg. In another embodiment, the mRNA agent is administered twice weekly at a dose of 2 mg / kg.

In one embodiment, the mRNA agent is administered once every two weeks. In one embodiment, the mRNA agent is administered once every two weeks at a dose of 1 mg / kg. In another embodiment, the mRNA agent is administered once every two weeks at a dose of 2 mg / kg.

In one embodiment, the mRNA agent is administered once a week. In one embodiment, the mRNA agent is administered once a week at a dose of 0.5 mg / kg. In one embodiment, the mRNA agent is administered once a week at a dose of 1 mg / kg. In another embodiment, the mRNA agent is administered once a week at a dose of 2 mg / kg.

In some embodiments, the RNAi agent is administered in a dosing regimen that includes a saturation phase of short-interval administrations, followed by a maintenance phase in which the RNAi agent is administered at longer intervals. In one embodiment, the saturation phase comprises five daily administrations of the RNAi agent during the first week. In another embodiment, the maintenance phase comprises administering the RNAi agent once or twice a week. In an additional embodiment, the maintenance phase is 5 weeks. In one embodiment, the satiety phase comprises administering a dose of 2, 1, or 0.5 mg / kg five times a week. In another embodiment, the maintenance phase comprises administering a dose of 2, 1, or 0.5 mg / kg once, twice, or three times a week, once every two weeks, once every three weeks, once a month, once every two months, once every three months, once every four months, once every five months, or once every six months.

Any of these patterns can optionally be repeated for one or more repetitions. The number of repeats can depend on achieving the desired effect, for example, suppressing the PCSK9 gene, and / or achieving a therapeutic or prophylactic effect, for example, lowering serum cholesterol levels or reducing the symptom of hypercholesterolemia.

In additional embodiments, the siRNA is administered in combination with an additional therapeutic agent. The siRNA and the additional therapeutic agent can be administered in combination in the same composition, eg, parenterally, or the additional therapeutic agent can be administered as part of a separate composition or in another manner described herein.

Examples of additional therapeutic agents include agents known to treat lipid disorders such as hypercholesterolemia, atherosclerosis, or dyslipidemia. For example, the siRNAs described in the present invention can be administered, for example, with an HMG-CoA reductase inhibitor (e.g., a statin), a fibrate, a bile acid sequestrant, niacin, an antiplatelet agent, an angiotensin converting enzyme inhibitor, an angiotensin II receptor antagonist (e.g., an angiotensin II receptor antagonist) , such as Cozaar® from Merck & Co.), an acylCoA: cholesterol acyltransferase (ACAT) inhibitor, a cholesterol absorption inhibitor, a cholesterol ester transport protein (CETP) inhibitor, a microsomal triglyceride transporter protein (MTTP) inhibitor, a cholesterol modulator a bile acid modulator, a peroxisome proliferator-activated receptor (PPAR) agonist, a gene therapy agent, a complex vascular protective agent (e.g. AGI-1067 from Atherogenics), a glycoprotein IIb / IIIb inhibitor, aspirin or aspirin-like substance, an IBAT inhibitor ( e.g. S-8921 from Shionogi), a squalene synthesis inhibitor, or an inhibitor of monocytary th chemoattractant protein (MCP) -I. Exemplary HMG-CoA reductase inhibitors include atorvastatin (Lipitor® / Tahor / Sortis / Torvast / Cardyl from Pfizer), pravastatin (Pravachol from Bristol-Myers Squibb, Mevalotin / Sanaprav from Sankyo), simvastatin (Zocor® / Sinvacor from Merck Boehringer Ingelheim, Lipovas from Banyu), lovastatin (Mevacor / Mevinacor from Merck, Lovastatina from Bexal, Liposcler from Sulfur Schwarz Pharma), fluvastatin (Lescol® / Locol / Lochol from Novartis, Cranoc from Fujisawa), Digaril from Solobay / Glaxo from Bayer, Baycol from

- 62 037110

SmithKline), rosuvastatin (Crestor® from AstraZeneca) and pivastatin (itavastatin / risivastatin) (Nissan Chemical, Kowa Kogyo, Sankyo and Novartis). Exemplary fibrates include, for example, bezafibrate (e.g. Befizal® / Cedur® / Bezalip® from Roche, Bezatol from Kissei), clofibrate (e.g. Atromid-S® from Wyeth), fenofibrate (e.g. Lipidil / Lipantil from Fournier, Tricor® from Abbott, Lipantil from Takeda, generics), gemfibrozil (e.g. Lopid / Lipur from Pfizer) and ciprofibrate (Modalim® from Sanofi-Synthelabo). Exemplary bile acid sequestrants include, for example, cholestyramine (Questran® and Questran Light ™ from Bristol-Myers Squibb), colestipol (eg, Colestid from Pharmacia) and colesevelam (WelChol ™ from Genzyme / Sankyo). Exemplary niacin therapies include, for example, rapid release formulations such as Nicobid from Aventis, Niacor from Upsher-Smith, Nicolar from Aventis, and Perycit from Sanwakagaku. Sustained release niacin formulations include, for example, Niaspan from Kos Pharmaceuticals and Slo-Niacin from Upsher-Smith. Illustrative antiplatelet agents include, for example, aspirin (eg, aspirin from Bayer), clopidogrel (Plavix from SanofiSynthelabo / Bristol-Myers Squibb), and ticlopidine (eg, Ticlid from Sanofi-Synthelabo and Panaldine from Daiichi). Other aspirin-like compounds useful in combination with dsRNAs targeting PCSK9 include, for example, Asacard (slow release aspirin from Pharmacia) and pamicogrel (Kanebo / Angelini Ricerche / CEPA). Illustrative angiotensin-converting enzyme inhibitors include, for example, ramipril (eg Altace from Aventis) and enalapril (eg Vasotec from Merck & Co.). Exemplary acylCoA cholesterol acyltransferase (ACAT) inhibitors include, for example, avazimib (Pfizer), eflucimib (BioMsrieux Pierre Fabre / Eli Lilly), CS-505 (Sankyo and Kyoto), and SMP-797 (Sumito). Illustrative cholesterol absorption inhibitors include, for example, ezetimibe (Zetia® from Merck / Schering-Plow Pharmaceuticals) and Pamaqueside (Pfizer). Exemplary CETP inhibitors include, for example, torcetrapib (also called CP-529414 from Pfizer), JTT-705 (Japan Tobacco), and CETi-I (Avant Immunotherapeutics). Exemplary microsomal triglyceride transfer protein (MTPP) inhibitors include, for example, implitapid (Bayer), R-103757 (Janssen), and CP-346086 (Pfizer). Other illustrative cholesterol modulators include, for example, NO-1886 (Otsuka / TAP Pharmaceutical), CI-1027 (Pfizer), and WAY-135433 (Wyeth-Ayerst).

Exemplary bile acid modulators include, for example, HBS-107 (Hisamitsu / Banyu), Btg-511 (British Technology Group), BARI-1453 (Aventis), S-8921 (Shionogi), SD-5613 (Pfizer), and AZD-7806 (AstraZeneca). Exemplary peroxisome proliferator activated receptor (PPAR) agonists include, for example, tezaglitazar (AZ-242) (AstraZeneca), netoglitazone (MCC-555) (Mitsubishi / Johnson & Johnson), GW-409544 (Ligand Pharniaceuticals / GlaxoSmith -501516 (Ligand Pharmaceuticals / GlaxoSmithKline), LY-929 (Ligand Pharmaceuticals and Eli Lilly), LY-465608 (Ligand Pharmaceuticals and Eli Lilly), LY-518674 (Ligand Pharmaceuticals and Eli Lilly) and MK-767 (Merck and Kyorin) ... Exemplary gene therapy modalities include, for example, AdGWEGF 121.10 (GenVec), ApoA1 (UCB Pharma / Groupe Fournier), EG-004 (Trinam) (Ark Therapeutics), and ATP binding cassette transporter A1 (ABCA1) (CV Therapeutics / Incyte , Aventis, Xenon). Exemplary glycoprotein IIb / IIIa inhibitors include, for example, roxifiban (also called DMP754, Bristol-Myers Squibb), gantofiban (Merck KGaA / Yamanouchi), and cromafiban (Millennium Pharmaceuticals). Exemplary squalene synthesis inhibitors include, for example, BMS-1884941 (Bristol-Myers Squibb), CP-210172 (Pfizer), CP-295697 (Pfizer), CP-294838 (Pfizer), and TAK-475 (Takeda). An illustrative MCPI inhibitor is, for example, RS-504393 (Roche Bioscience). The anti-atherosclerotic agent BO-653 (Chugai Pharmaceuticals) and the nicotinic acid derivative Nyclin (Yamanouchi Pharmacuticals) are also suitable for administration in combination with the dsRNA described in the present invention. Exemplary combination therapies suitable for administration with dsRNAs targeting PCSK9 include, for example, Advicor (niacin / lovastatin from Kos Pharmaceuticals), amlodipine / atorvastatin (Pfizer), and ezetimibe / simvastatin (e.g. Vytorin® 10/10 tablets , 10/20, 10/40 and 10/80, Merck / Schering-Plow Pharmaceuticals). Agents for the treatment of hypercholesterolemia, and suitable for administration in combination with dsRNAs targeting PCSK9, include, for example, lovastatin, niacin, Altoprev® extended release tablet (Andrx Labs), lovastatin, Caduet® tablets (Pfizer), amlodipine besilate, atorvastatin calcium salt, Crestor® tablets (AstraZeneca), rosuvastatin calcium salt, Lescol® capsules (Novartis), fluvastatin sodium salt Lescol® (Reliant, Novartis), fluvastatin sodium salt, Lipitor® tablets (Parke- Davis), atorvastatin calcium salt, Lofibra® (Gate) capsules, Niaspan (Kos) extended release tablets, niacin, Pravachol tablets (Bristol-Myers Squibb), pravastatin sodium salt, TriCor® tablets (Abbott), fenofibrate , Vytorin® 10/10 tablets (Merck / Schering-Plow Pharmaceuticals), ezetimibe, simvastatin, WelChol ™ tablets (Sankyo), colesevelam hydrochloric salt, Zetia® tablets (Schering), ezetimibe, table ecty Zetia® (Merck / Schering-Plow Pharmaceuticals) and ezetimibe, Zocor® tablets (Merck).

In one embodiment, the mRNA agent is administered in combination with an ezetimibe / simvastatin combination (eg, Vytorin® (Merck / Schering-Plow Pharmaceuticals)). AT

63 037110 in one embodiment, the mRNA agent is administered to a patient and then an additional therapeutic agent (or vice versa) is administered to the patient. In another embodiment, the mRNA agent and the additional therapeutic agent are administered simultaneously.

In another aspect, the present invention provides a method of instructing an end user, such as a caregiver or treatment provider, or subject, on how to administer the mRNA agent described herein. The method includes, optionally, providing the end user with one or more doses of the mRNA agent and instructing the end user to administer the mRNA agent as described herein, thereby instructing the end user.

In one aspect, the present invention provides a method of treating a patient by selecting a patient so that the patient needs to lower LDL levels, lower LDL levels without lowering HDL levels, lower ApoB levels, or lower total cholesterol levels. The method includes administering to the patient an amount of siRNA sufficient to lower LDL levels or ApoB levels in the patient, for example, without substantially lowering HDL levels.

Genetic predisposition plays a role in the development of diseases associated with the target gene, such as hyperlipidemia. Thus, a patient in need of siRNA can be identified by reviewing family history or, for example, testing for one or more genetic markers or variants. Examples of genes involved in hyperlipidemia include, but are not limited to, those of the LDL receptor (LDLR), apoliproteins (ApoA1, ApoB, ApoE, etc.), cholesterol ester transport protein (CETP), lipoprotein lipase (LPL), hepatic lipase (LIPC), endothelial lipase (EL), lecithin: cholesterol acyltransferase (LCAT).

A healthcare professional such as a physician, nurse, or family member may take a family history into account before prescribing or administering an mRNA agent according to the present invention. In addition, an analysis can be performed to determine the genotype or phenotype. For example, DNA analysis can be performed on a sample from a patient, such as a blood sample, to establish the PCSK9 genotype and / or phenotype prior to administering an anti-PCSK9 dsRNA to the patient. In another embodiment, an analysis is performed to establish a related genotype and / or phenotype, eg, LDLR genotype. Examples of genetic variants of the LDLR gene can be found in the art, for example, in the following publications, which are incorporated by reference: Costanza et al. (2005) Am. J. Epidemiol. 15; 161 (8): 714-24; Yamada et al. (2008) J. Med. Genet. Jan; 45 (1): 22-8, electronic publication August 31, 2007; and Boes et al. (2009) Exp. Gerontol 44: 136-160, electronic publication November 17, 2008.

Vi. Sets.

The invention also provides kits for using any of the mRNA agents and / or performing any of the methods of the invention. Such kits include one or more RNAi agents and instructions for use, eg, instructions for inhibiting PCSK9 expression in a cell by contacting the cell with RNAi agent (s) in an amount effective to inhibit PCSK9 expression. The kits may optionally further comprise means for contacting the cell with an RNAi agent (eg, an injection device) or means for determining the degree of inhibition of PCSK9 (eg, means for measuring the degree of inhibition of PCSK9 mRNA or TTR protein). Such means for determining the degree of inhibition of PCSK9 may include means for obtaining a sample from a subject, such as, for example, a plasma sample. The kits of the present invention may optionally further comprise means for administering the RNAi agent (s) to a subject, or a means for determining a therapeutically effective or prophylactically effective amount.

Unless otherwise indicated, all technical and scientific terms used in this document have a meaning that is usually understood by one of ordinary skill in the art to which the present invention belongs. While methods and materials similar or equivalent to those described herein can be used in the practice or testing of mRNA and methods described in the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other literary sources that are mentioned in this document are incorporated by reference in their entirety. In the event of a conflict, this description, including definitions, will prevail. In addition, the materials, methods, and examples are illustrative only and are not meant to be limiting.

Examples of

Materials and methods.

The following materials and methods were used in the examples. CDNA synthesis using ABI High capacity with DNA reverse transcription kit (Applied Biosystems, Forster City, CA, Cat # 4368813).

A master mix of 2 μl 10X buffer, 0.8 μl 25X dNTP, 2 μl random primers, 1 μl reverse transcriptase, 1 μl RNase inhibitor and 3.2 μl H2O per reaction was added to 10 μl total RNA.

- 64 037110 cDNA was obtained using a Bio-Rad C-1000 or S-1000 thermal cycler (Hercules, CA) through the following steps: 25 ° C 10 min, 37 ° C 120 min, 85 ° C 5 sec, storage at 4 ° C ...

Cell culture and transfection.

Hep3B, HepG2, or HeLa cells (ATCC, Manassas, VA) were grown to near confluence at 37 ° C under 5% CO ₂ in Recommended Medium (ATCC) supplemented with 10% FBS and Glutamine (ATCC) prior to separation from the Petri dish by trypsin treatment. For duplexes sorted in 96-well format, transfection was performed by adding 44.75 μl Opti-MEM with 0.25 μl Lipofectamine RNAiMax per well (Invitrogen, Carlsbad, CA, Cat # 13778-150) to 5 μl of each duplex siRNA in a separate well in a 96-well plate. The mixture was then incubated at room temperature for 15 minutes. Fifty μl of complete culture media without antibiotic containing ~ 2x10 ⁴ cells was then added to the siRNA mixture. For duplexes sorted in 384 well format, 5 μl Opti-MEM with 0.1 μl Lipofectamine RNAiMax (Invitrogen, Carlsbad, CA, Cat # 13778-150) was mixed with 5 μl of each siRNA duplex per well. The mixture was then incubated at room temperature for 15 min followed by the addition of 40 μl of complete culture media without antibiotic containing ~ 8x10 ³ cells. The cells were incubated for 24 h before RNA purification. Single dose experiments were performed at a final duplex concentration of 10 and 0.1 nM and dose effect experiments were performed using 8x5-fold serial dilutions starting at 2 nM.

Transfection by free uptake.

Five μl of each GalNac conjugated siRNA in PBS was pooled with 3x10 ⁴ freshly thawed cryopreserved hepatocytes of cynomolgus monkeys (In Vitro Technologies-Celsis, Baltimore, Maryland; serial number JQD) resuspended in 95 μl In Vitro Gro CP media (In Vitro Technologies- Celsis, Baltimore, MD), in each well of a 96-well plate or 5 μl siRNA and 45 μl media containing 1.2x10 ³ cells for a 384-well plate format. The mixtures were incubated for about 24 hours at 37 ° C in an atmosphere of 5% CO ₂ . siRNA was tested at multiple concentrations from 500 to 0.1 nM for single dose experiments and using 8x5-fold serial dilutions starting at 500 nM for dose-response experiments.

Isolation of total RNA using the DYNABEADS mRNA Isolation Kit (Invitrogen cat # 610-12).

Cells were harvested and lysed in 150 μl lysis / binding buffer, then mixed for 5 min at 850 rpm using an Eppendorf Thermomixer (mixing speed was the same throughout the process). Ten microliters of magnetic beads and 80 μl of lysis / binding buffer mixture were added to a round bottom plate and mixed for 1 min. The magnetic beads were fixed using a magnetic stand and the supernatant was removed without displacing the beads. After removing the supernatant, lysed cells were added to the remaining beads and mixed for 5 minutes. After removing the supernatant, the magnetic beads were washed 2 times with 150 μl of wash buffer A and mixed for 1 min. The pellets were fixed again and the supernatant was discarded. The beads were then washed with 150 μl of wash buffer B, fixed and the supernatant removed. The beads were then washed with 150 μl of elution buffer, fixed and the supernatant removed. The granules were allowed to dry for 2 minutes. After drying, 50 μl of elution buffer was added and mixed for 5 min at 70 ° C. The granules were fixed on a magnet for 5 min. Remove fifty μl of supernatant and add to another 96 well plate.

For 384-well format, cells were lysed for one minute by adding 50 μl of lysis / binding buffer. Two μl of magnetic beads were used per well. The required volume of granules was divided into aliquots, fixed on a magnetic stand, and the storage solution for the granules was removed. The beads were then resuspended in the required volume of lysis / binding buffer (25 µl per well) and 25 µl of the bead suspension was added to the lysed cells. The lysate and pellet mixture was incubated for 10 min on a VibraTransaltor at parameter # 7 (Union Scientific Corp., Randallstown, MD). Subsequently, the beads were fixed with a magnetic stand, the supernatant was removed and the beads were washed once with 90 μl of buffer A, followed by separate washing steps with 90 μl of buffer B and 100 μl of elution buffer. The beads were soaked with each wash buffer for ~ 1 min (no mixing). After the final washing step, the beads were resuspended in 15 μl of elution buffer for 5 min at 70 ° C, followed by fixing the beads and removing the supernatant (up to 8 μl) for cDNA synthesis and / or storage of purified RNA (-20 ° C).

PCR in real time.

Two μl of cDNA was added to the master mix containing 0.5 μl of TaqMan probe for human GAPDH (Applied Biosystems, Cat # 4326317E), 0.5 μl of TaqMan probe for human PCSK9 (Applied Biosystems, Cat # Hs03037355_m1) for human cells or 0.5 μl of the Custom TaqMan Assay reagent kit for cynomolgus GAPDH (150 nM cyno GAP F primer- '' GCATCCTGGGCTACACTGA (SEQ ID NO. 5), 150 nM cyno GAP R primer- '-TGGGTGTCGCTGT IDTGA : 6) 250 nM cyno GAP probe - 65 037110

5'-5HEX-CCAGGTGGTCTCCTCC-BHQl-Q-3 '(SEQ ID NO: 7)), 0.5 μl Custom TaqMan reagent kit

Assay for PCSK9 Javanese Macaque (900 nM cyno

5'-ACGTGGCTGGCATTGCA (SEQ ID NO: 8); 900 nM

5'-AAGTGGATCAGTCTCTGCCTCAA (SEQ ID NO: 9); 250

PCSK9 F primer

PCSK9 R primer cyno PCSK9 probe cyno NM

5'-6FAM-CATGATGCTGTCTGCCGAGCCG-BHQl-Q-3 '(SEQ ID NO: 10)) for cynomolgus macaque cells, and 5 μl Master Mix with Lightcycler 480 probe (Roche, Cat. # 04887301001) per well at 384- well plate (Roche, Cat. No. 04887301001). Real-time PCR performed on the system

Roche LC480 Real Time PCR system (Roche) using ΔΔCt (RQ) analysis. Each duplex was examined in two independent transfections, and each transfection was evaluated in two parallel trials, unless otherwise indicated.

To calculate the relative fold change, real-time data were analyzed using the ΔΔCt method and normalized according to those performed with cells transfected with 10 nM AD-1955 or sham transfected cells. For assays with free uptake, data were normalized according to those treated with PBS or GalNAc-1955 (highest concentration for experimental compounds) cells. IC _{50 was} calculated using a 4-parameter matching model using XLFit and normalized to that of cells transfected with AD-1955 at the same dose range or at its lowest dose.

The sense and antisense sequences of AD-1955 are sense: 5'-cuuAcGcuGAGuAcuucGAdTsdT-3 '(SEQ LDNO: I) and antisense: 5'-UCGAAGuACUcAGCGuAAGdTsdT-3' (SEQ ID NO: 12).

Table B. Nucleotide Monomer Abbreviations Used in Nucleic Acid Sequence Representation

Abbreviation Nucleotide (s) BUT adenosine-3'-phosphate Ab beta-E-adenosine-3'-phosphate Af 2'-fluoroadenosine-3'-phosphate Afs 2'-fluoroadenosine-3'-phosphorothioate As adenosine-3'-phosphorothioate WITH cytidine-3'-phosphate

- 66 037110

Cb beta-b-cytidine-3'-phosphate Cf 2'-fluorocytidine-3'-phosphate Cfs 2'-fluorocytidine-3'-phosphorothioate Cs cytidine-3'-phosphothioate G guanosine-3 '-phosphate Gb beta-b-guanosine-3'-phosphate Gbs beta-L-guanosine-3'-phosphorothioate Gf 2'-fluoroguanosine-3'-phosphate Gfs 2'-fluoroguanosine-3'-phosphorothioate Gs guanosine-3 '-phosphothioate T 5'-methylurium idin-3'-phosphate Tf 2'-fluoro-5-methyluridine-3'-phosphate Tfs 2'-fluoro-5-methyluridine-3'-phosphorothioate Ts 5-methyluridin-3 '-phosphothioate U uridine-3'-phosphate Uf 2'-fluorouridine-3'-phosphate Ufs 2'-fluorouridine-3'-phosphorothioate Us uridine-3 '-phosphothioate N any nucleotide (G, A, C, T or U) a 2'-O-methyladenosine-3'-phosphate as 2'-O-methyladenosine-3'-phosphorothioate c 2'-O-methylcytidine-3'-phosphate cs 2'-O-methylcytidine-3'-phosphorothioate g 2'-O-methylguanosine-3'-phosphate gs 2'-O-methylguanosine-3'-phosphorothioate t 2'-O-methyl-5-methyluridine-3'-phosphate ts 2'-O-methyl-5-methyluridine-3'-phosphorothioate u 2'-O-methyluridin-3'-phosphate US 2'-O-methyluridin-3'-phosphorothioate dT 2'-deoxythymidine dTs 2'-deoxythymidine-3'-phosphorothioate dU 2 '- deoxyuridine s phosphorothioate bond L96 M- [tris (OaNoAc-alkyl) -amidodecanoyl)] - 4-hydroxyprolinolHyp- (OaNAc-alkyl) 3 (Aeo) 2'-O-methoxyethyladenosine-3'-phosphate

- 67 037110

(Aeos) 2'-O-methoxyethyladenosine-3'-phosphothioate (Geo) 2'-O-methoxyethylguanosine-3'-phosphate (Geos) 2'-O-methoxyethylguanosine-3'-phosphorothioate (Theo) 2'-O-methoxyethyl-5-methyluridine-3'-phosphate (Teos) 2'-O-methoxyethyl-5-methyluridine-3'-phosphorothioate (m5Ceo) 2'-O-methoxyethyl-5-methylcytidine-3'-phosphate (m5Ceos) 2'-O-methoxyethyl-5-methylcytidine-3'-phosphorothioate (AZsh) 3'-O-methyladenosine-2'-phosphate (АЗшх) 3'-O-methyl-xylofuranosyladenosine-2'-phosphate (G3m) 3'-O-methylguanosine-2'-phosphate (G3mx) 3'-O-methyl-xylofuranosylguanosine-2'-phosphate (NWS) 3'-O-methylcytidine-2'-phosphate (C3mx) 3'-O-methyl-xylofuranosylcytidine-2 ^, -phosphate (U3m) 3'-O-methyluridine-2'-phosphate (U3mx) 3 ^, -O-methylxylouridine-2'-phosphate (Chd) 2'-O-hexadecyl-cytidine-3'-phosphate (pshe) hydroxyethylphosphorothioate (Uhd) 2'-O-hexadecyl-uridine-3'-phosphate (Tgn) thymidine glycol nucleic acid (GNA), S-isomer (Cgn) cytidine glycol nucleic acid (GNA) (Chd) 2'-O-hexadecyl-cytidine-3'-phosphate (Ggn) 2'-O-hexadecyl-cytidine-3'-phosphate (Agn) adenosine glycol nucleic acid (GNA) P 5'-phosphate (m5Cam) 2'-O- (M-methylacetamide) -5-methylcytidine-3'-phosphate (m5Cams) 2'-O- (M-methylacetamide) -5-methylcytidine-3'-phosphorothioate (Tam) 2'-O- (M-methylacetamide) thymide yn-3'-phosphate (Tams) 2'-O- (M-methylacetamide) thymide in-3'-phosphorothioate (Aam) 2'-O- (M-methylacetamide) adenosine-3'-phosphate (Aams) 2'-O- (M-methylacetamide) adenosine-3'-phosphorothioate (Gam) 2'-O- (M-methylacetamide) guanosine-3'-phosphate (Gams) 2'-O- (M-methylacetamide) guanosine-3'-phosphorothioate (Uyh) 2'-O- (1-hexyl-4-methylene-1,2,3-triazolyl) -uridine-3'-phosphate (Ayh) 2'-O- (1-hexyl-4-methylene-1,2,3-triazolyl) -adenosine-3'-phosphate (Gyh) 2'-O- (1-hexyl-4-methylene-1,2,3-triazolyl) -guanosine-3'-phosphate (Cyh) 2'-O- (1-hexyl-4-methylene-1,2,3-triazolyl) -cytidine-3'-phosphate

Example 1. Synthesis of GalNAc-conjugated oligonucleotides.

A series of siRNA duplexes spanning the PCSK9 mRNA sequence were designed, synthesized and conjugated to trivalent GalNAc at the 3-end of the sense strand using the techniques described above. The sequences of such duplexes are shown in table. 1. The same sequences were also synthesized with various nucleotide modifications and conjugated to trivalent GalNAc. The sequences of the modified duplexes are shown in table. 2.

- 68 037110

Table 1. Unmodified sequences for PCSK9

Duplex name The name of the meaning of the oligonucleotide Semantic trance, ate. SEQ ID NO: The name of the antisense in the th oligonucleotide Antisense trance, ate. SEQ ID NO: Started at NM_17 4936.3 Kone C in NM_1 74936 .3 AD-53649.1 A-110542.1 CGAGGACGGCGACUACGAGGA thirteen A-109239.2 UCCUCGUAGUCGCCGUCCUCGUC 234 459 481 AD-53661.1 A-110544.1 ACCGCUGCGCCAAGGAUCCGU 14 A-109243.2 ACGGAUCCUUGGCGCAGCGGUGG 235 554 576 AD-53667.1 A-110545.1 GCUGCGCCAAGGAUCCGUGGA 15 A-109245.2 UCCACGGAUCCUUGGCGCAGCGG 236 557 579 AD-53679.1 A-110547.1 CUACGUGGUGGUGCUGAAGGA 16 A-109249.2 UCCUUCAGCACCACCACGUAGGU 237 591 613 AD-53685.1 A-110548.1 CCCGCCGGGGAUACCUCACCA 17 A-109251.2 UGGUGAGGUAUCCCCGGCGGGCA 238 668 690 AD-53691.1 A-110549.1 CCGCCGGGGAUACCUCACCAA 18 A-109253.2 UUGGUGAGGUAUCCCCGGCGGGC 239 669 691 AD-53650.1 A-110550.1 GCCGGGGAUACCUCACCAAGA 19 A-109255.2 UCUUGGUGAGGUAUCCCCGGCGG 240 671 693 AD-53656.1 A-110551.1 CCGGGGAUACCUCACCAAGAU twenty A-109257.2 AUCUUGGUGAGGUAUCCCCGGCG 241 672 694 AD-53668.1 A-110553.1 AUACCUCACCAAGAUCCUGCA 21 A-109261.2 UGCAGGAUCUUGGUGAGGUAUCC 242 678 700 AD-53674.1 A-110554.1 CACCAAGAUCCUGCAUGUCUU 22 A-109263.2 AAGACAUGCAGGAUCUUGGUGAG 243 684 706 AD-53680.1 A-110555.1 CAAGAUCCUGCAUGUCUUCCA 23 A-109265.2 UGGAAGACAUGCAGGAUCUUGGU 244 687 709 AD-53692.1 A-110557.1 GUUGCCCCAUGUCGACUACAU 24 A-109269.2 AUGUAGUCGACAUGGGGCAACUU 245 768 790 AD-53651.1 A-110558.1 GCCCCAUGUCGACUACAUCGA 25 A-109271.2 UCGAUGUAGUCGACAUGGGGCAA 246 771 793 AD-53657.1 A-110559.1 CCAUGUCGACUACAUCGAGGA 26 A-109273.2 UCCUCGAUGUAGUCGACAUGGGG 247 774 796 AD-53663.1 A-110560.1 UCGACUACAUCGAGGAGGACU 27 A-109275.2 AGUCCUCCUCGAUGUAGUCGACA 248 779 801 AD-53669.1 A-110561.1 ACUACAUCGAGGAGGACUCCU 28 A-109277.2 AGGAGUCCUCCUCGAUGUAGUCG 249 782 804 AD-53675.1 A-110562.1 UACAUCGAGGAGGACUCCUCU 29 A-109279.2 AGAGGAGUCCUCCUCGAUGUAGU 250 784 806 AD-53681.1 A-110563.1 UCGAGGAGGACUCCUCUGUCU thirty A-109281.2 AGACAGAGGAGUCCUCCUCGAUG 251 788 810 AD-53687.1 A-110564.1 CGAGGAGGACUCCUCUGUCUU 31 A-109283.2 AAGACAGAGGAGUCCUCCUCGAU 252 789 811 AD-53693.1 A-110565.1 GUACCGGGCGGAUGAAUACCA 32 A-109285.2 UGGUAUUCAUCCGCCCGGUACCG 253 855 877 AD-53652.1 A-110566.1 CCUGGUGGAGGUGUAUCUCCU 33 A-109287.2 AGGAGAUACACCUCCACCAGGCU 254 894 916 AD-53658.1 A-110567.1 CUGGUGGAGGUGUAUCUCCUA 34 A-109289.2 UAGGAGAUACACCUCCACCAGGC 255 895 917 AD-53664.1 A-110568.1 GGUGGAGGUGUAUCUCCUAGA 35 A-109291.2 UCUAGGAGAUACACCUCCACCAG 256 897 919 AD-53670.1 A-110569.1 UGGAGGUGUAUCUCCUAGACA 36 A-109293.2 UGUCUAGGAGAUACACCUCCACC 257 899 921 AD-53676.1 A-110570.1 AGGUGUAUCUCCUAGACACCA 37 A-109295.2 UGGUGUCUAGGAGAUACACCUCC 258 902 924 AD-53682.1 A-110571.1 GUAUCUCCUAGACACCAGCAU 38 A-109297.2 AUGCUGGUGUCUAGGAGAUACAC 259 906 928 AD-53688.1 A-110572.1 UAUCUCCUAGACACCAGCAUA 39 A-109299.2 UAUGCUGGUGUCUAGGAGAUACA 260 907 929 AD-53694.1 A-110573.1 UCUCCUAGACACCAGCAUACA 40 A-109301.2 UGUAUGCUGGUGUCUAGGAGAUA 261 909 931 AD-53653.1 A-110574.1 UCCUAGACACCAGCAUACAGA 41 A-109303.2 UCUGUAUGCUGGUGUCUAGGAGA 262 911 933 AD-53659.1 A-110575.1 AGACACCAGCAUACAGAGUGA 42 A-109305.2 UCACUCUGUAUGCUGGUGUCUAG 263 915 937 AD-53665.1 A-110576.1 CACCAGCAUACAGAGUGACCA 43 A-109307.2 UGGUCACUCUGUAUGCUGGUGUC 264 918 940 AD-53671.1 A-110577.1 UACAGAGUGACCACCGGGAAA 44 A-109309.2 UUUCCCGGUGGUCACUCUGUAUG 265 926 948 AD-53677.1 A-110578.1 ACAGAG UG ACCACCGGG AAAU 45 A-109311.2 AUUUCCCGGUGGUCACUCUGUAU 266 927 949 AD-53683.1 A-110579.1 GAGUGACCACCGGGAAAUCGA 46 A-109313.2 UCGAUUUCCCGGUGGUCACUCUG 267 930 952 AD-53689.1 A-110580.1 GGAAAUCGAGGGCAGGGUCAU 47 A-109315.2 AUGACCCUGCCCUCGAUUUCCCG 268 942 964 AD-53695.1 A-110581.1 AAUCGAGGGCAGGGUCAUGGU 48 A-109317.2 ACCAUGACCCUGCCCUCGAUUUC 269 945 967 AD-53654.1 A-110582.1 GCAGGGUCAUGGUCACCGACU 49 A-109319.2 AGUCGGUGACCAUGACCCUGCCC 270 953 975 AD-53660.1 A-110583.1 CAGGGUCAUGGUCACCGACUU fifty A-109321.2 AAGUCGGUGACCAUGACCCUGCC 271 954 976 AD-53666.1 A-110584.1 GGUCAUGGUCACCGACUUCGA 51 A-109323.2 UCGAAGUCGGUGACCAUGACCCU 272 957 979 AD-53672.1 A-110585.1 UCAUGGUCACCGACUUCGAGA 52 A-109325.2 UCUCGAAGUCGGUGACCAUGACC 273 959 981 AD-53678.1 A-110586.1 AGGACGGGACCCGCUUCCACA 53 A-109327.2 UGUGGAAGCGGGUCCCGUCCUCC 274 992 1014 AD-53684.1 A-110587.1 CGGGACCCGCU UCCACAGACA 54 A-109329.2 UGUCUGUGGAAGCGGGUCCCGUC 275 996 1018 AD-53690.1 A-110588.1 UCCACAGACAGGCCAGCAAGU 55 A-109331.2 ACUUGCUGGCCUGUCUGUGGAAG 276 1007 1029 AD-53696.1 A-110589.1 CCUGCGCGUGCUCAACUGCCA 56 A-109333.2 UGGCAGUUGAGCACGCGCAGGCU 277 1107 1129 AD-53702.1 A-110590.1 CUGCGCGUGCUCAACUGCCAA 57 A-109335.2 UUGGCAGUUGAGCACGCGCAGGC 278 1108 ISO AD-53708.1 A-110591.1 CGUGCUCAACUGCCAAGGGAA 58 A-109337.2 UUCCCUUGGCAGUUGAGCACGCG 279 1113 1135 AD-53714.1 A-110592.1 CACCCUCAUAGGCCUGGAGUU 59 A-109339.2 AACUCCAGGCCUAUGAGGGUGCC 280 1149 1171 AD-53720.1 A-110593.1 ACCCUCAUAGGCCUGGAGUUU 60 A-109341.2 AAACUCCAGGCCUAUGAGGGUGC 281 1150 1172 AD-53726.1 A-110594.1 CCCUCAUAGGCCUGGAGUUUA 61 A-109343.2 UAAACUCCAGGCCUAUGAGGGUG 282 1151 1173

- 69 037110

AD-53732.1 A-110595.1 CCUCAUAGGCCUGGAGUUUAU 62 A-109345.2 AUAAACUCCAGGCCUAUGAGGGU 283 1152 1174 AD-53738.1 A-110596.1 CUCAUAGGCCUGGAGUUUAUU 63 A-109347.2 AAUAAACUCCAGGCCUAUGAGGG 284 1153 1175 AD-53697.1 A-110597.1 UAGGCCUGGAGUUUAUUCGGA 64 A-109349.2 UCCGAAUAAACUCCAGGCCUAUG 285 1157 1179 AD-53703.1 A-110598.1 AGGCCUGGAGUUUAUUCGGAA 65 A-109351.2 UUCCGAAUAAACUCCAGGCCUAU 286 1158 1180 AD-53709.1 A-110599.1 GGCCUGGAGUUUAUUCGGAAA 66 A-109353.2 UUUCCGAAUAAACUCCAGGCCUA 287 1159 1181 AD-53715.1 A-110600.1 GCCUGGAGUUUAUUCGGAAAA 67 A-109355.2 UUUUCCGAAUAAACUCCAGGCCU 288 1160 1182 AD-53721.1 A-110601.1 GG AG U U U AU UCGG AAAAGCCA 68 A-109357.2 UGGCUUUUCCGAAUAAACUCCAG 289 1164 1186 AD-53727.1 A-110602.1 GUUUAUUCGGAAAAGCCAGCU 69 A-109359.2 AGCUGGCUUUUCCGAAUAAACUC 290 1167 1189 AD-53733.1 A-110603.1 GGGCUGGGGUCGUGCUGGUCA 70 A-109361.2 UGACCAGCACGACCCCAGCCCUC 291 1277 1299 AD-53739.1 A-110604.1 GGUCACCGCUGCCGGCAACUU 71 A-109363.2 AAGUUGCCGGCAGCGGUGACCAG 292 1293 1315 AD-53698.1 A-110605.1 GGGACGAUGCCUGCCUCUACU 72 A-109365.2 AGUAGAGGCAGGCAUCGUCCCGG 293 1316 1338 AD-53704.1 A-110606.1 CAACUUUGGCCGCUGUGUGGA 73 A-109367.2 U CCACACAGCGGCCAAAG U UGG U 294 1419 1441 AD-53710.1 A-110607.1 UUGGCCGCUGUGUGGACCUCU 74 A-109369.2 AGAGGUCCACACAGCGGCCAAAG 295 1424 1446 AD-53716.1 A-110608.1 UGGCCGCUGUGUGGACCUCUU 75 A-109371.2 AAGAGGUCCACACAGCGGCCAAA 296 1425 1447 AD-53722.1 A-110609.1 GGCCGCUGUGUGGACCUCUUU 76 A-109373.2 AAAGAGGUCCACACAGCGGCCAA 297 1426 1448 AD-53728.1 A-110610.1 UGUGUGGACCUCUUUGCCCCA 77 A-109375.2 UGGGGCAAAGAGGUCCACACAGC 298 1432 1454 AD-53734.1 A-110611.1 GGGAGGACAUCAUUGGUGCCU 78 A-109377.2 AGGCACCAAUGAUGUCCUCCCCU 299 1454 1476 AD-53740.1 A-110612.1 ACUGCAGCACCUGCUUUGUGU 79 A-109379.2 ACACAAAGCAGGUGCUGCAGUCG 300 1481 1503 AD-53699.1 A-110613.1 GCAUUGCAGCCAUGAUGCUGU 80 A-109381.2 ACAGCAUCAUGGCUGCAAUGCCA 301 1541 1563 AD-53705.1 A-110614.1 GUUGAGGCAGAGACUGAUCCA 81 A-109383.2 UGGAUCAGUCUCUGCCUCAACUC 302 1590 1612 AD-53711.1 A-110615.1 UGAGGCAGAGACUGAUCCACU 82 A-109385.2 AGUGGAUCAGUCUCUGCCUCAAC 303 1592 1614 AD-53717.1 A-110616.1 GAGGCAGAGACUGAUCCACUU 83 A-109387.2 AAGUGGAUCAGUCUCUGCCUCAA 304 1593 1615 AD-53723.1 A-110617.1 GGCAGAGACUGAUCCACUUCU 84 A-109389.2 AGAAGUGGAUCAGUCUCUGCCUC 305 1595 1617 AD-53729.1 A-110618.1 CAGAGACUGAUCCACUUCUCU 85 A-109391.2 AGAGAAGUGGAUCAGUCUCUGCC 306 1597 1619 AD-53735.1 A-110619.1 ACUGAUCCACUUCUCUGCCAA 86 A-109393.2 UUGGCAGAGAAGUGGAUCAGUCU 307 1602 1624 AD-53741.1 A-110620.1 AUCCACUUCUCUGCCAAAGAU 87 A-109395.2 AUCUUUGGCAGAGAAGUGGAUCA 308 1606 1628 AD-53700.1 A-110621.1 GGCCUGGUUCCCUGAGGACCA 88 A-109397.2 UGGUCCUCAGGGAACCAGGCCUC 309 1638 1660 AD-53706.1 A-110622.1 GGUACUGACCCCCAACCUGGU 89 A-109399.2 ACCAGGUUGGGGGUCAGUACCCG 310 1662 1684 AD-53712.1 A-110623.1 GUUGGCAGCUGUUUUGCAGGA 90 A-109401.2 UCCUGCAAAACAGCUGCCAACCU 311 1715 1737 AD-53718.1 A-110624.1 UGGCAGCUGUUUUGCAGGACU 91 A-109403.2 AGUCCUGCAAAACAGCUGCCAAC 312 1717 1739 AD-53724.1 A-110625.1 GCAGCUGUUUUGCAGGACUGU 92 A-109405.2 ACAGUCCUGCAAAACAGCUGCCA 313 1719 1741 AD-53730.1 A-110626.1 UCUGCCGGGCCCACAACGCUU 93 A-109407.2 AAGCGUUGUGGGCCCGGCAGACC 314 1883 1905 AD-53736.1 A-110627.1 CUGCCGGGCCCACAACGCUUU 94 A-109409.2 AAAGCGUUGUGGGCCCGGCAGAC 315 1884 1906 AD-53742.1 A-110628.1 GCCCACAACGCUUUUGGGGGU 95 A-109411.2 ACCCCCAAAAGCGUUGUGGGCCC 316 1891 1913 AD-53701.1 A-110629.1 CGCUUUUGGGGGUGAGGGUGU 96 A-109413.2 ACACCCUCACCCCCAAAAGCGUU 317 1899 1921 AD-53707.1 A-110630.1 CUUUUGGGGGUGAGGGUGUCU 97 A-109415.2 AGACACCCUCACCCCCAAAAGCG 318 1901 1923 AD-53713.1 A-110631.1 UUUUGGGGGUGAGGGUGUCUA 98 A-109417.2 UAGACACCCUCACCCCCAAAAGC 319 1902 1924 AD-53719.1 A-110632.1 GGGGUGAGGGUGUCUACGCCA 99 A-109419.2 UGGCGUAGACACCCUCACCCCCA 320 1907 1929 AD-53725.1 A-110633.1 GGGUGAGGGUGUCUACGCCAU 100 A-109421.2 AUGGCGUAGACACCCUCACCCCC 321 1908 1930 AD-53731.1 A-110634.1 GGUGAGGGUGUCUACGCCAUU 101 A-109423.2 AAUGGCGUAGACACCCUCACCCC 322 1909 1931 AD-53737.1 A-110635.1 AGGGUGUCUACGCCAUUGCCA 102 A-109425.2 UGGCAAUGGCGUAGACACCCUCA 323 1913 1935 AD-53743.1 A-110636.1 GUGUCUACGCCAUUGCCAGGU 103 A-109427.2 ACCUGGCAAUGGCGUAGACACCC 324 1916 1938 AD-53749.1 A-110637.1 UGCAGCGUCCACACAGCUCCA 104 A-109429.2 UGGAGCUGUGUGGACGCUGCAGU 325 1960 1982 AD-53755.1 A-110638.1 GCAUGGGGACCCGUGUCCACU 105 A-109431.2 AGUGGACACGGGUCCCCAUGCUG 326 1994 2016 AD-53761.1 A-110639.1 CCCACAAGCCGCCUGUGCUGA 106 A-109433.2 UCAGCACAGGCGGCUUGUGGGUG 327 2078 2100 AD-53767.1 A-110640.1 GAGGCCACGAGGUCAGCCCAA 107 A-109435.2 UUGGGCUGACCUCGUGGCCUCAG 328 2097 2119 AD-53773.1 A-110641.1 CACG AGG U CAGCCCAACCAG U 108 A-109437.2 ACUGGUUGGGCUGACCUCGUGGC 329 2102 2124 AD-53779.1 A-110642.1 GGGAGGCCAGCAUCCACGCU U 109 A-109439.2 AAGCGUGGAUGCUGGCCUCCCUG 330 2135 2157 AD-53785.1 A-110643.1 AUCCACGCUUCCUGCUGCCAU 110 A-109441.2 AUGGCAGCAGGAAGCGUGGAUGC 331 2146 2168 AD-53744.1 A-110644.1 GGAAUGCAAAGUCAAGGAGCA 111 A-109443.2 UGCUCCUUGACUUUGCAUUCCAG 332 2178 2200 AD-53750.1 A-110645.1 AAUCCCGGCCCCUCAGGAGCA 112 A-109445.2 UGCUCCUGAGGGGCCGGGAUUCC 333 2202 2224 AD-53762.1 A-110647.1 GCUGGGGCUGAGCUUUAAAAU 113 A-109449.2 AUUUUAAAGCUCAGCCCCAGCCC 334 2479 2501

- 70 037110

AD-53768.1 A-110648.1 GGAGGUGCCAGGAAGCUCCCU 114 A-109451.2 AGGGAGCUUCCUGGCACCUCCAC 335 2648 2670 AD-53774.1 A-110649.1 ACUGUGGGGCAUUUCACCAUU 115 A-109453.2 AAUGGUGAAAUGCCCCACAGUGA 336 2674 2696 AD-53780.1 A-110650.1 CCACCAAGGAGGCAGGAU U CU 116 A-109455.2 AGAAUCCUGCCUCCUUGGUGGAG 337 2811 2833 AD-53786.1 A-110651.1 CACCAAGGAGGCAGGAUUCUU 117 A-109457.2 AAGAAUCCUGCCUCCUUGGUGGA 338 2812 2834 AD-53804.1 A-110701.1 ACCAAGGAGGCAGGAUUCUUU 118 A-109557.2 AAAGAAUCCUGCCUCCUUGGUGG 339 2813 2835 AD-53810.1 A-110702.1 GGAGGCAGGAUUCUUCCCAUU 119 A-109559.2 AAUGGGAAGAAUCCUGCCUCCUU 340 2818 2840 AD-53816.1 A-110703.1 GAGGCAGGAUUCUUCCCAUGA 120 A-109561.2 UCAUGGGAAGAAUCCUGCCUCCU 341 2819 2841 AD-53745.1 A-110652.1 UGAUGGCCCUCAUCUCCAGCU 121 A-109459.2 AGCUGGAGAUGAGGGCCAUCAGC 342 2904 2926 AD-53822.1 A-110704.1 CUUUCUGGAUGGCAUCUAGCA 122 A-109563.2 UGCUAGAUGCCAUCCAGAAAGCU 343 2971 2993 AD-53751.1 A-110653.1 UUUCUGGAUGGCAUCUAGCCA 123 A-109461.2 UGGCUAGAUGCCAUCCAGAAAGC 344 2972 2994 AD-53827.1 A-110705.1 UUCUGGAUGGCAUCUAGCCAA 124 A-109565.2 UUGGCUAGAUGCCAUCCAGAAAG 345 2973 2995 AD-53757.1 A-110654.1 UCUGGAUGGCAUCUAGCCAGA 125 A-109463.2 UCUGGCUAGAUGCCAUCCAGAAA 346 2974 2996 AD-53833.1 A-110706.1 CUGGAUGGCAUCUAGCCAGAA 126 A-109567.2 UUCUGGCUAGAUGCCAUCCAGAA 347 2975 2997 AD-53793.1 A-110707.1 CUUUACUCUGCUCUAUGCCAA 127 A-109569.2 UUGGCAUAGAGCAGAGUAAAGGU 348 3053 3075 AD-53799.1 A-110708.1 UUUACUCUGCUCUAUGCCAGA 128 A-109571.2 UCUGGCAUAGAGCAGAGUAAAGG 349 3054 3076 AD-53763.1 A-110655.1 GCUCUAUGCCAGGCUGUGCUA 129 A-109465.2 UAGCACAGCCUGGCAUAGAGCAG 350 3062 3084 AD-53769.1 A-110656.1 CUCAGCCAACCCGCUCCACUA 130 A-109467.2 UAGUGGAGCGGGUUGGCUGAGAC 351 3158 3180 AD-53805.1 A-110709.1 UCAGCCAACCCGCUCCACUAA 131 A-109573.2 UUAGUGGAGCGGGUUGGCUGAGA 352 3159 3181 AD-53811.1 A-110710.1 CCUGCCAAGCUCACACAGCAA 132 A-109575.2 UUGCUGUGUGAGCUUGGCAGGCA 353 3245 3267 AD-53781.1 A-110658.1 GCCAAGCUCACACAGCAGGAA 133 A-109471.2 UUCCUGCUGUGUGAGCUUGGCAG 354 3248 3270 AD-53817.1 A-110711.1 CCAAGCUCACACAGCAGGAAA 134 A-109577.2 UUUCCUGCUGUGUGAGCUUGGCA 355 3249 3271 AD-53787.1 A-110659.1 CAAGCUCACACAGCAGGAACU 135 A-109473.2 AGUUCCUGCUGUGUGAGCUUGGC 356 3250 3272 AD-53823.1 A-110712.1 AAGCUCACACAGCAGGAACUU 136 A-109579.2 AAGUUCCUGCUGUGUGAGCUUGG 357 3251 3273 AD-53746.1 A-110660.1 CUGAAGCCAAGCCUCUUCUUA 137 A-109475.2 UAAGAAGAGGCUUGGCUUCAGAG 358 3298 3320 AD-53828.1 A-110713.1 UGAAGCCAAGCCUCUUCUUAA 138 A-109581.2 UUAAGAAGAGGCUUGGCUUCAGA 359 3299 3321 AD-53752.1 A-110661.1 GAAGCCAAGCCUCUUCUUACU 139 A-109477.2 AGUAAGAAGAGGCUUGGCUUCAG 360 3300 3322 AD-53758.1 A-110662.1 AAGCCAAGCCUCUUCUUACUU 140 A-109479.2 AAGUAAGAAGAGGCUUGGCUUCA 361 3301 3323 AD-53834.1 A-110714.1 AGUGAGGCUGGGAAGGGGAAA 141 A-109583.2 UUUCCCCUUCCCAGCCUCACUGU 362 3355 3377 AD-53764.1 A-110663.1 GUGAGGCUGGGAAGGGGAACA 142 A-109481.2 UGUUCCCCUUCCCAGCCUCACUG 363 3356 3378 AD-53770.1 A-110664.1 GGCUGGGAAGGGGAACACAGA 143 A-109483.2 UCUGUGUUCCCCUUCCCAGCCUC 364 3360 3382 AD-53776.1 A-110665.1 GAAGGGGAACACAGACCAGGA 144 A-109485.2 UCCUGGUCUGUGUUCCCCUUCCC 365 3366 3388 AD-53782.1 A-110666.1 AAGGGGAACACAGACCAGGAA 145 A-109487.2 UUCCUGGUCUGUGUUCCCCUUCC 366 3367 3389 AD-53794.1 A-110715.1 AGGGGAACACAGACCAGGAAA 146 A-109585.2 UUUCCUGGUCUGUGUUCCCCUUC 367 3368 3390 AD-53788.1 A-110667.1 GGGAACACAGACCAGGAAGCU 147 A-109489.2 AGCUUCCUGGUCUGUGUUCCCCU 368 3370 3392 AD-53747.1 A-110668.1 ACUGUCCCUCCUUGAGCACCA 148 A-109491.2 UGGUGCUCAAGGAGGGACAGUUG 369 3509 3531 AD-53753.1 A-110669.1 CCAGCCCCACCCAAGCAAGCA 149 A-109493.2 UGCUUGCUUGGGUGGGGCUGGUG 370 3527 3549 AD-53759.1 A-110670.1 CCCCACCCAAGCAAGCAGACA 150 A-109495.2 UGUCUGCUUGCUUGGGUGGGGCU 371 3531 3553 AD-53765.1 A-110671.1 CCCACCCAAGCAAGCAGACAU 151 A-109497.2 AUGUCUGCUUGCUUGGGUGGGGC 372 3532 3554 AD-53771.1 A-110672.1 CCACCCAAGCAAGCAGACAUU 152 A-109499.2 AAUGUCUGCUUGCUUGGGUGGGG 373 3533 3555 AD-53777.1 A-110673.1 CACCCAAGCAAGCAGACAU U U 153 A-109501.2 AAAUGUCUGCUUGCUUGGGUGGG 374 3534 3556 AD-53783.1 A-110674.1 ACCCAAGCAAGCAGACAUUUA 154 A-109503.2 UAAAUGUCUGCUUGCUUGGGUGG 375 3535 3557 AD-53789.1 A-110675.1 CCCAAGCAAGCAGACAU U U AU 155 A-109505.2 AUAAAUGUCUGCUUGCUUGGGUG 376 3536 3558 AD-53800.1 A-110716.1 CCAAGCAAGCAGACAUUUAUU 156 A-109587.2 AAUAAAUGUCUGCUUGCUUGGGU 377 3537 3559 AD-53748.1 A-110676.1 CAAGCAAGCAGACAUUUAUCU 157 A-109507.2 AGAUAAAUGUCUGCUUGCUUGGG 378 3538 3560 AD-53754.1 A-110677.1 AAGCAAGCAGACAUUUAUCUU 158 A-109509.2 AAGAUAAAUGUCUGCUUGCUUGG 379 3539 3561 AD-53760.1 A-110678.1 AGCAAGCAGACAUUUAUCUUU 159 A-109511.2 AAAGAUAAAUGUCUGCUUGCUUG 380 3540 3562 AD-53806.1 A-110717.1 CAAGCAG ACAU UUAUCUUUUU 160 A-109589.2 AAAAAGAUAAAUGUCUGCUUGCU 381 3542 3564 AD-56975.1 A-116394.4 160 A-109589.5 381 AD-56976.1 A-116407.1 160 A-109589.11 381 AD-56977.1 A-116406.2 160 A-109589.11 381 AD-56978.1 A-116418.1 160 A-109589.18 381 AD-56979.1 A-116393.1 Similar 160 A-109589.6 Similar 381 Analogue Anal

- 71 037110

AD-56980.1 A-116408.1 Similar 160 A-109589.12 Similar 381 egg Analogous ogichny Anal ogichnaya AD-56981.1 A-116419.1 160 A-109589.19 381 AD-56982.1 A-116426.1 160 A-109589.19 381 AD-56983.1 A-116400.1 160 A-109589.7 381 AD-56984.1 A-116409.1 160 A-109589.13 381 AD-56985.1 A-116420.1 160 A-109589.20 381 AD-56986.1 A-116428.1 160 A-109589.20 381 AD-56986.2 A-116428.2 160 A-109589.17 381 AD-56987.1 A-116410.1 160 A-109589.14 381 AD-56988.1 A-116421.1 160 A-109589.21 381 AD-56989.1 A-116430.1 160 A-109589.21 381 AD-56990.1 A-116432.1 160 A-109589.9 381 AD-56991.1 A-116415.1 160 A-109589.15 381 AD-56992.1 A-116434.1 160 A-109589.15 381 AD-56993.1 A-116416.1 160 A-109589.16 381 AD-56994.1 A-116436.1 160 A-109589.22 381 AD-56995.1 A-116417.1 160 A-109589.17 381 AD-56996.1 A-116438.1 160 A-109589.17 381 AD-56997.1 A-116450.1 160 A-109589.17 381 AD-56998.1 A-116471.1 160 A-109589.17 381 AD-56999.1 A-116479.2 160 A-109589.17 381 AD-57000.1 A-116492.3 160 A-109589.17 381 AD-57001.1 A-116440.1 160 A-109589.17 381 AD-57002.1 A-116452.1 160 A-109589.17 381 AD-57003.1 A-116460.1 160 A-109589.17 381 AD-57004.1 A-116473.1 160 A-109589.17 381 AD-57005.1 A-116486.1 160 A-109589.17 381 AD-57006.1 A-116494.3 160 A-109589.17 381 AD-57007.1 A-116442.1 160 A-109589.17 381 AD-57008.1 A-116453.1 160 A-109589.17 381 AD-57009.1 A-116462.1 160 A-109589.17 381 AD-57010.1 A-116475.1 160 A-109589.17 381 AD-57011.1 A-116488.1 160 A-109589.17 381 AD-57012.1 A-116498.1 160 A-109589.17 381 AD-57013.1 A-116444.1 160 A-109589.17 381 AD-57014.1 A-116454.1 160 A-109589.17 381 AD-57015.1 A-116464.1 160 A-109589.17 381 AD-57016.1 A-116477.1 160 A-109589.17 381 AD-57017.1 A-116490.1 160 A-109589.17 381 AD-57018.1 A-116500.1 160 A-109589.17 381 AD-57019.1 A-116446.1 160 A-109589.17 381 AD-57020.1 A-116455.1 160 A-109589.23 381 AD-57021.1 A-116481.1 160 A-109589.23 381 AD-57022.1 A-116448.1 160 A-109589.23 381 AD-57023.1 A-116467.1 160 A-109589.23 381 AD-57024.1 A-116483.1 160 A-109589.23 381 AD-57025.1 A-116449.1 160 A-109589.23 381 AD-57026.1 A-116457.1 160 A-109589.23 381 AD-57027.1 A-116469.1 160 A-109589.23 381 AD-53812.1 A-110718.1 AAGCAGACAUUUAUCUUUUGA 161 A-109591.2 UCAAAAGAUAAAUGUCUGCUUGC 382 3543 3565 AD-53818.1 A-110719.1 AGCAGACAUUUAUCUUUUGGA 162 A-109593.2 UCCAAAAGAUAAAUGUCUGCUUG 383 3544 3566 AD-53766.1 A-110679.1 GCAGACAUUUAUCUUUUGGGU 163 A-109513.2 ACCCAAAAGAUAAAUGUCUGCUU 384 3545 3567

- 72 037110

AD-53772.1 A-110680.1 AGACAUUUAUCUUUUGGGUCU 164 A-109515.2 AGACCCAAAAGAUAAAUGUCUGC 385 3547 3569 AD-53824.1 A-110720.1 GACAUUUAUCUUUUGGGUCUU 165 A-109595.2 AAGACCCAAAAGAUAAAUGUCUG 386 3548 3570 AD-53778.1 A-110681.1 ACAUUUAUCUUUUGGGUCUGU 166 A-109517.2 ACAGACCCAAAAGAUAAAUGUCU 387 3549 3571 AD-53784.1 A-110682.1 UUUAUCUUUUGGGUCUGUCCU 167 A-109519.2 AGGACAGACCCAAAAGAUAAAUG 388 3552 3574 AD-53829.1 A-110721.1 UUAUCUUUUGGGUCUGUCCUU 168 A-109597.2 AAGGACAGACCCAAAAGAUAAAU 389 3553 3575 AD-53790.1 A-110683.1 UAUCUUUUGGGUCUGUCCUCU 169 A-109521.2 AGAGGACAGACCCAAAAGAUAAA 390 3554 3576 AD-53835.1 A-110722.1 AUCUUUUGGGUCUGUCCUCUU 170 A-109599.2 AAGAGGACAGACCCAAAAGAUAA 391 3555 3577 AD-53796.1 A-110684.1 UCUUUUGGGUCUGUCCUCUCU 171 A-109523.2 AGAGAGGACAGACCCAAAAGAUA 392 3556 3578 AD-53802.1 A-110685.1 UUUUGGGUCUGUCCUCUCUGU 172 A-109525.2 ACAGAGAGGACAGACCCAAAAGA 393 3558 3580 AD-53808.1 A-110686.1 UUUGGGUCUGUCCUCUCUGUU 173 A-109527.2 AACAGAGAGGACAGACCCAAAAG 394 3559 3581 AD-53795.1 A-110723.1 UUGGGUCUGUCCUCUCUGUUU 174 A-109601.2 AAACAGAGAGGACAGACCCAAAA 395 3560 3582 AD-53801.1 A-110724.1 UGGGUCUGUCCUCUCUGUUGA 175 A-109603.2 U CAACAGAG AGG ACAG ACCCAAA 396 3561 3583 AD-53807.1 A-110725.1 GGGUCUGUCCUCUCUGUUGCA 176 A-109605.2 UGCAACAGAGAGGACAGACCCAA 397 3562 3584 AD-53814.1 A-110687.1 GGUCUGUCCUCUCUGUUGCCU 177 A-109529.2 AGGCAACAGAGAGGACAGACCCA 398 3563 3585 AD-53820.1 A-110688.1 GUCUGUCCUCUCUGUUGCCUU 178 A-109531.2 AAGGCAACAGAGAGGACAGACCC 399 3564 3586 AD-53825.1 A-110689.1 UCUGUCCUCUCUGUUGCCUUU 179 A-109533.2 AAAGGCAACAGAGAGGACAGACC 400 3565 3587 AD-53831.1 A-110690.1 CUGUCCUCUCUGUUGCCUUUU 180 A-109535.2 AAAAGGCAACAGAGAGGACAGAC 401 3566 3588 AD-53791.1 A-110691.1 UGUCCUCUCUGUUGCCUUUUU 181 A-109537.2 AAAAAGGCAACAGAGAGGACAGA 402 3567 3589 AD-53797.1 A-110692.1 GUCCUCUCUGUUGCCUUUUUA 182 A-109539.2 UAAAAAGGCAACAGAGAGGACAG 403 3568 3590 AD-48400.1 A-98247.2 UUUUCUAGACCUGUUUUGCUU 183 A-93455.4 AAGCAAAACAGGUCUAGAAAAGU 404 3597 3619 AD-53830.1 A-110872.1 A-110873.1 AD-53803.1 A-110693.1 UUUCUAGACCUGUUUUGCUUU 184 A-109541.2 AAAGCAAAACAGGUCUAGAAAAG 405 3598 3620 AD-53809.1 A-110694.1 UUCUAGACCUGUUUUGCUUUU 185 A-109543.2 AAAAGCAAAACAGGUCUAGAAAA 406 3599 3621 AD-53813.1 A-110726.1 UCUAGACCUGUUUUGCUUUUU 186 A-109607.2 AAAAAGCAAAACAGGUCUAGAAA 407 3600 3622 AD-53815.1 A-110695.1 CUAGACCUGUUUUGCUUUUGU 187 A-109545.2 ACAAAAGCAAAACAGGUCUAGAA 408 3601 3623 AD-56610.1 A-115523.2 187 A-115525.1 408 AD-56611.1 A-115533.2 Similar 187 A-115534.1 Similar 408 Anal ogichnaya AD-56612.1 A-115536.2 187 A-115540.3 408 AD-56613.1 A-115538.3 187 A-115541.5 408 AD-56614.1 A-110695.9 187 A-115548.1 408 AD-56615.1 A-110695.5 187 A-115519.1 408 AD-56616.1 A-115523.3 187 A-115526.1 408 AD-56617.1 A-115535.1 187 A-109545.7 408 AD-56618.1 A-115537.2 187 A-115540.4 408 AD-56619.1 A-115539.3 187 A-115541.6 408 AD-56620.1 A-115542.2 187 A-115548.2 408 AD-56621.1 A-115520.1 187 A-115519.2 408 AD-56622.1 A-115527.1 187 A-115526.2 408 AD-56623.1 A-115536.1 187 A-109545.8 408 AD-56624.1 A-115538.2 187 A-115540.5 408 AD-56625.1 A-115542.1 187 A-109545.12 408 AD-56626.1 A-115543.2 187 A-115548.3 408 AD-56627.1 A-115521.1 187 A-115519.3 408 AD-56628.1 A-115527.2 187 A-115528.1 408 AD-56629.1 A-115537.1 187 A-109545.9 408 AD-56630.1 A-115539.2 187 A-115540.6 408 AD-56631.1 A-115543.1 187 A-109545.13 408 AD-56632.1 A-115544.2 187 A-115548.4 408 AD-56633.1 A-115520.2 187 A-109545.6 408 AD-56634.1 A-115529.1 187 A-115530.1 408 AD-56635.1 A-115538.1 187 A-109545.10 408 AD-56636.1 A-110695.8 187 A-115541.1 408

- 73 037110

- 74 037110

AD-56681.1 A-115586.1 Similar 191 A-115587.1 Similar 412 egg ogichny AD-56682.1 A-115602.1 191 A-115603.1 412 AD-56686.1 A-115588.1 191 A-115589.1 412 AD-56687.1 A-115604.1 191 A-115605.1 412 AD-56691.1 A-115590.1 191 A-115591.1 412 AD-56692.1 A-115606.1 191 A-115607.1 412 AD-56695.1 A-115592.1 191 A-115593.1 412 AD-56696.1 A-115608.1 191 A-115609.1 412 AD-53826.1 A-110697.1 UUUUGUAACUUGAAGAUAUUU 192 A-109549.2 AAAUAUCUUCAAGUUACAAAAGC 413 3616 3638 AD-53832.1 A-110698.1 UUUGUAACUUGAAGAUAUUUA 193 A-109551.2 UAAAUAUCUUCAAGUUACAAAAG 414 3617 3639 AD-53792.1 A-110699.1 UUGUAACUUGAAGAUAUUUAU 194 A-109553.2 AUAAAUAUCUUCAAGUUACAAAA 415 3618 3640 AD-53798.1 A-110700.1 UGUAACUUGAAGAUAUUUAUU 195 A-109555.2 AAUAAAUAUCUUCAAGUUACAAA 416 3619 3641 AD-53819.1 A-110727.1 GUAACUUGAAGAUAUUUAUUU 196 A-109609.2 AAAUAAAUAU CU U CAAG U UACAA 417 3620 3642 AD-53815.1 CUAGACCUGUUUUGCUUUUGU 197 ACAAAAGCAAAACAGGUCUAGAA 418 3601 AD57928.40 Similar 197 Similar 418 AD-59182.5 197 418 AD-59184.3 197 418 AD-59186.3 197 418 AD59171.13 197 418 AD-59176.7 197 418 AD-59170.7 197 418 AD-59175.7 Similar 197 Similar 418 AD-59179.7 197 418 AD-59218.1 197 418 AD-59222.1 197 418 AD-59226.1 197 418 AD-59230.1 197 418 AD-59235.1 197 418 AD-59207.1 197 418 AD-59211.1 197 418 AD-59215.1 197 418 AD-59219.1 197 418 AD-59223.1 197 418 AD-59181.5 197 418 AD-59172.5 197 418 AD-59177.5 197 418 AD-59180.5 197 418 AD-59183.5 197 418 AD-59185.5 197 418

- 75 037110

AD-59173.5 197 418 AD-59232.1 CUAGACCUGUUUUGCUUUUGU 198 ACAAAAGCAAAACAGGUCUAGAA 419 3600 AD-59236.1 Similar 198 Similar 419 Analogous AD-59216.1 198 419 AD-59220.1 198 419 AD-59224.1 198 419 AD-59228.1 198 419 AD-59233.1 198 419 AD-59237.1 198 419 AD-59209.1 198 419 AD-59208.1 198 419 AD-59212.1 CUAGACCUGUUUUGCUUUUGU 199 ACAAAAGCAAAACAGGUCUAGAA 420 3600 AD-59210.1 CUAGACCUGUUUUGCUUUUGU 200 ACAAAAGCAAAACAGGUCUAGAA 421 3601 AD-59214.1 AGACCUGUUUUGCUUUUGU 201 ACAAAAGCAAAACAGGUCUAG 422 3603 AD-59227.1 Similar 201 Similar 422 AD-59231.1 201 422 AD-59198.3 201 422 AD-59200.3 201 422 AD-59203.3 Similar 201 Similar 422 AD-59204.3 201 422 AD-59188.3 201 422 AD-59191.3 201 422 AD-59213.1 201 422 AD-59217.1 201 422 AD-59221.1 201 422 AD-59225.1 201 422 AD-59229.1 201 422 AD-59234.1 201 422 AD-59238.1 201 422 AD-59241.1 201 422 AD-59245.1 201 422 AD-59250.1 201 422 AD-59246.1 CUAGACCUGUUUUGCUUUUGU 202 ACAAAAGCAAAACAGGUCUAGA 423 3602 AD-59253.2 UAGACCUGUUUUGCUUUUGU 203 ACAAAAGCAAAACAGGUCUAGA 424 3602 AD-59242.1 AGACCUGUUUUGCUUUUGU 204 ACAAAAGCAAAACAGGUCUAGA 425 3602 AD-59253.1 UAGACCUGUUUUGCUUUUGU 205 ACAAAAGCAAAACAGGUCUAGA 426 3602

- 76 037110

AD-59258.1 UAGACCUGUUUUGCUUUUGU 206 ACAAAAGCAAAACAGGUCUAGA 427 3602 AD-59251.1 CUAGACCUGUUUUGCUUUUGU 207 ACAAAAGCAAAACAGGUCUAG 428 3603 AD-59256.1 UAGACCUGUUUUGCUUUUGU 208 ACAAAAGCAAAACAGGUCUA 429 3604 AD-59260.1 AGACCUGUUUUGCUUUUGU 209 ACAAAAGCAAAACAGGUCU 430 3605 AD-59248.1 GACCUGUUUUGCUUUUGU 210 ACAAAAGCAAAACAGGUCU 431 3605 AD-59247.1 GACCUGUUUUGCUUUUGU 211 ACAAAAGCAAAACAGGUCUA 432 3604 AD-59252.1 AGACCUGUUUUGCUUUUGU 212 ACAAAAGCAAAACAGGUCUA 433 3604 AD-59257.1 UAGACCUGUUUUGCUUUUGU 213 ACAAAAGCAAAACAGGUCUA 434 3604 AD-59261.1 AGACCUGUUUUGCUUUUGU 214 ACAAAAGCAAAACAGGUCUAG 435 3603 AD-59262.1 UAGACCUGUUUUGCUUUUGU 215 ACAAAAGCAAAACAGGUCUAG 436 3603 AD-59265.1 CUAGACCUGUUUUGCUUUUGU 216 ACAAAAGCAAAACAGGUCUAG 437 3603 AD59196.13 UAGACCUGUUUUGCUUUUGU 217 ACAAAAGCAAAACAGGUCUAGAA 438 3601 AD59189.11 AGACCUGUUUUGCUUUUGU 218 ACAAAAGCAAAACAGGUCUAGAA 439 3601 AD-59190.3 UCUAGACCUGUUUUGCUUUUG U 219 ACAAAAGCAAAACAGGUCUAGAA 440 3601 AD-59192.3 UUCUAGACCUGUUUUGCUUUU GU 220 ACAAAAGCAAAACAGGUCUAGAA 441 3601 AD-59240.1 220 441 AD-59244.1 220 441 AD-59202.7 Similar 220 Similar 441 Analogous AD-59195.5 220 441 AD-59249.1 220 441 AD-59254.1 220 441 AD-59259.1 220 441 AD-59264.1 220 441 AD-59264.2 220 441 AD-59255.1 220 441 AD-57928.1 220 441 AD-58893.1 220 441 AD-58894.1 220 441 AD-58895.1 220 441 AD-58896.1 220 441 AD-58897.1 220 441 AD-58898.1 220 441 AD-58899.1 220 441 AD-58900.1 CAAGCAG ACAU UUAUCUUUUU 221 AAAAAGAUAAAUGUCUGCUUGCU 442 N / A AD-58902.1 UUUUCUAGACCUGUUUUGCUU 222 AAGCAAAACAGGUCUAGAAAAGU 443 3597

- 77 037110

AGACCUGUUUUGCUUUUGU 223 ACAAAAGCAAAACAGGUCUAG 444 AGACCUGUUUUGCUUUUGU 224 ACAAAAGCAAAACAGGUCUAG 445 AGACCUGUUUUGCUUUUGU 225 ACAAAAGCAAAACAGGUCUAG 446 AGACCUGUUUUGCUUUUGU 226 ACAAAAGCAAAACAGGUCUAG 447 AGACCUGUUUUGCUUUUGU 227 ACAAAAGCAAAACAGGUCUAG 448 AGACCUGUUUUGCUUUUGU 228 ACAAAAGCAAAACAGGUCUAG 449 CUAGACCUGUUUUGCUUUUGU Similar 229 ACAAAAGCAAAACAGGUCUAGAA Similar 450 229 450 229 450 229 450 229 450 229 450 229 450 229 450 229 450 229 450 229 450 229 450 AGACCUGUUUUGCUUUUGU 230 ACAAAAGCAAAACAGGUCUAG 451 AGACCUGUUUUGCUUUUGU 231 ACAAAAGCAAAACAGGUCUAG 452 CUAGACCUGUUUUGCUUUUGU Similar 232 ACAAAAGCAAAACAGGUCUAGAA Similar 453 232 453 232 453 232 453 232 453 232 453 CUAGACCUGUUUUGCUUUUGU Similar Similar 233 ACAAAAGCAAAACAGGUCUAGAA Similar Similar 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454

- 78 037110

- 79 037110

233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 Similar 233 Similar 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454

Table 2. Modified sequences for PCSK9

Name duplex The name of the sense oligonucleotide ida Sense oligonucleotide sequence SEQ ID NO: Position relative N M-174 936.3 Antisense name oligonucleotide Antisense oligonucleotide sequence SEQ ID NO: AD-53649.1 A-110542.1 CfgAfgGfaCfgGfCfGfaCfuAfcGfaGfgAfL96 455 461 A-109239.2 uCfcUfcGfuAfgUfcgcCfgUfcCfuCfgsUfsc 1006 AD-53650.1 A-110550.1 GfcCfgGfgGfaUfAfCfcUfcAfcCfaAfgAfL96 456 673 A-109255.2 uCfuUfgGfuGfaGfguaUfcCfcCfgGfcsGfsg 1007 AD-53651.1 A-110558.1 Gf cCfcCfa U fgU fCfGfa Cf u AfcAf u CfgAf L96 457 773 A-109271.2 uCfgAfuGfuAfgUfcgaCfaUfgGfgGfcsAfsa 1008 AD-53652.1 A-110566.1 CfcUfgGfuGfgAfGfGfuGfuAfuCfuCfcUfL96 458 896 A-109287.2 aGfgAfgAfuAfcAfccuCfcAfcCfaGfgsCfsu 1009 AD-53653.1 A-110574.1 U f cCf u Afg Af c Af Cf Cf a G f c Af u Af c Af gAf L9 6 459 913 A-109303.2 uCfuGfuAfuGfcUfgguGfuCfuAfgGfasGfsa 1010 AD-53654.1 A-110582.1 GfcAfgGfgUfcAfUfGfgUfcAfcCfgAfcUfL96 460 955 A-109319.2 a Gf u CfgGf u Gf a Cfca u Gf a CfcCf u Gf csCfsc 1011 AD-53696.1 A-110589.1 CfcUfgCfgCfgUfGfCfuCfaAfcUfgCfcAfL96 461 1109 A-109333.2 u GfgCf a Gf u UfgAfgca CfgCfgCf a GfgsCfsu 1012 AD-53697.1 A-110597.1 UfaGfgCfcUfgGfAfGfuUfuAfuUfcGfgAfL96 462 1159 A-109349.2 uCfcGfaAfuAfaAfcucCfaGfgCfcUfasUfsg 1013 AD-53698.1 A-110605.1 GfgGfaCfgAfuGfCfCfuGfcCfuCfuAfcUfL96 463 1318 A-109365.2 aGfuAfgAfgGfcAfggcAfuCfgUfcCfcsGfsg 1014 AD-53699.1 A-110613.1 GfcAfuUfgCfaGfCfCfaUfgAfuGfcUfgUfL96 464 1543 A-109381.2 aCfaGfcAfuCfaUfggcUfgCfaAfuGfcsCfsa 1015 AD-53700.1 A-110621.1 GfgCfcUfgGfuUfCfCfcUfgAfgGfaCfcAfL96 465 1640 A-109397.2 uGfgUfcCfuCfaGfggaAfcCfaGfgCfcsUfsc 1016 AD-53701.1 A-110629.1 CfgCfuUfuUfgGfGfGfgUfgAfgGfgUfgUfL96 466 1901 A-109413.2 aCfaCfcCfuCfaCfcccCfaAfaAfgCfgsUfsu 1017 AD-48400.1 A-98247.2 UfuUfuCfuAfgAfcCfuGfuUfuUfgCfuUfL96 467 A-93455.4 aAfgCfaAfaAfcAfgGfuCfuAfgAfaAfasGfsu 1018 AD-53656.1 A-110551.1 CfcGfgGfgAfuAfCfCfuCfaCfcAfaGfaUfL96 468 674 A-109257.2 aUfcUfuGfgUfgAfgguAfuCfcCfcGfgsCfsg 1019

- 80 037110

AD-53657.1 A-110559.1 CfcAfuGfuCfgAfCfUfaCfaUfcGfaGfgAfL96 469 776 A-109273.2 uCfcUfcGfaUfgUfagu Cf gAf c Af u G f gs Gf sg 1020 AD-53658.1 A-110567.1 CfuGfgUfgGfaGfGfUfgUfaUfcUfcCfuAfL96 470 897 A-109289.2 uAfgGfaGfaUfaCfaccUfcCfaCfcAfgsGfsc 1021 AD-53659.1 A-110575.1 Af gAf c Af cCf a G f Cf Af u Af c Af gAfg U f gAf L9 6 471 917 A-109305.2 uCfaCfuCfuGfuAfugcUfgGfuGfuCfusAfsg 1022 AD-53660.1 A-110583.1 CfaGfgGfuCfaUfGfGfuCfaCfcGfaCfuUfL96 472 956 A-109321.2 aAfgUfcGfgUfgAfccaUfgAfcCfcUfgsCfsc 1023 AD-53702.1 A-11O59O.1 Cf u Gf cGfcGf u GfCf U fcAf a Cf u Gf cCf a Af L96 473 1110 A-109335.2 uUfgGfcAfgUfuGfagcAfcGfcGfcAfgsGfsc 1024 AD-53703.1 A-110598.1 AfgGfcCfuGfgAfGfUfuUfaUfuCfgGfaAfL96 474 1160 A-109351.2 uUfcCfgAfaUfaAfacuCfcAfgGfcCfusAfsu 1025 AD-53704.1 A-110606.1 CfaAfcUfuUfgGfCfCfgCfuGfuGfuGfgAfL96 475 1421 A-109367.2 u CfcAfcAfcAfgCfggcCf a Afa Gf u U fgsGfs u 1026 AD-53705.1 A-110614.1 GfuUfgAfgGfcAfGfAfgAfcUfgAfuCfcAfL96 476 1592 A-109383.2 uGfgAfuCfaGfuCfucuGfcCfuCfaAfcsUfsc 1027 AD-53706.1 A-110622.1 GfgUfaCfuGfaCfCfCfcCfaAfcCfuGfgUfL96 477 1664 A-109399.2 aCfcAfgGfuUfgGfgggUfcAfgUfaCfcsCfsg 1028 AD-53707.1 A-110630.1 CfuUfuUfgGfgGfGfUfgAfgGfgUfgUfcUfL96 478 1903 A-109415.2 aGfaCfaCfcCfuCfaccCfcCfaAfaAfgsCfsg 1029 AD-53661.1 A-110544.1 AfcCfgCfuGfcGfCfCfaAfgGfaUfcCfgUfL96 479 556 A-109243.2 aCfgGfaUfcCfuUfggcGfcAfgCfgGfusGfsg 1030 AD-53663.1 A-110560.1 UfcGfaCfuAfcAfUfCfgAfgGfaGfgAfcUfL96 480 781 A-109275.2 aGfuCfcUfcCfuCfgauGfuAfgUfcGfasCfsa 1031 AD-53664.1 A-110568.1 GfgUfgGfaGfgUfGfUfaUfcUfcCfuAfgAfL96 481 899 A-109291.2 uCfuAfgGfaGfaUfacaCfcUfcCfaCfcsAfsg 1032 AD-53665.1 A-110576.1 Cfa Cfc AfgCf a U fAf Cfa Gfa Gf u Gf a Cf cAf L96 482 920 A-109307.2 uGfgUfcAfcUfcUfguaUfgCfuGfgUfgsUfsc 1033 AD-53666.1 A-110584.1 GfgUfcAfuGfgUfCfAfcCfgAfcUfuCfgAfL96 483 959 A-109323.2 uCfgAfaGfuCfgGfugaCfcAfuGfaCfcsCfsu 1034 AD-53708.1 A-110591.1 CfgUfgCfuCfaAfCfUfgCfcAfaGfgGfaAfL96 484 1115 A-109337.2 uUfcCfcUfuGfgCfaguUfgAfgCfaCfgsCfsg 1035 AD-53709.1 A-110599.1 GfgCfcUfgGfaGfUfUfuAfuUfcGfgAfaAfL96 485 1161 A-109353.2 uUfuCfcGfaAfuAfaacUfcCfaGfgCfcsUfsa 1036 AD-53710.1 A-110607.1 UfuGfgCfcGfcUfGfUfgUfgGfaCfcUfcUfL96 486 1426 A-109369.2 aGfaGfgUfcCfaCfacaGfcGfgCfcAfasAfsg 1037 AD-53711.1 A-110615.1 UfgAfgGfcAfgAfGfAfcUfgAfuCfcAfcUfL96 487 1594 A-109385.2 aGfuGfgAfuCfaGfucuCfuGfcCfuCfasAfsc 1038 AD-53712.1 A-110623.1 GfuUfgGfcAfgCfUfGfuUfuUfgCfaGfgAfL96 488 1717 A-109401.2 uCfcUfgCfaAfaAfcagCfuGfcCfaAfcsCfsu 1039 AD-53713.1 A-110631.1 UfuUfuGfgGfgGfUfGfaGfgGfuGfuCfuAfL96 489 1904 A-109417.2 u Af gAf c AfcCf c U f ca cCf c Cf c Af a Af a s Gfs c 1040 AD-53667.1 A-110545.1 GfcUfgCfgCfcAfAfGfgAfuCfcGfuGfgAfL96 490 559 A-109245.2 uCfcAfcGfgAfuCfcuuGfgCfgCfaGfcsGfsg 1041 AD-53668.1 A-110553.1 Af u AfcCf u Cfa Cf CfAfa Gfa Uf cCf u Gf cAf L96 491 680 A-109261.2 u Gf c Af gG f a U f c U f u ggU f g Af gG fuAfusCfsc 1042 AD-53669.1 A-110561.1 AfcUfaCfaUfcGfAfGfgAfgGfaCfuCfcUfL96 492 784 A-109277.2 aGfgAfgUfcCfuCfcucGfaUfgUfaGfusCfsg 1043 AD-53670.1 A-110569.1 UfgGfaGfgUfgUfAfUfcUfcCfuAfgAfcAfL96 493 901 A-109293.2 uGfuCfuAfgGfaGfauaCfaCfcUfcCfasCfsc 1044 AD-53671.1 A-110577.1 UfaCfaGfaGfuGfAfCfcAfcCfgGfgAfaAfL96 494 928 A-109309.2 uUfuCfcCfgGfuGfgucAfcUfcUfgUfasUfsg 1045 AD-53672.1 A-110585.1 UfcAfuGfgUfcAfCfCfgAfcUfuCfgAfgAfL96 495 961 A-109325.2 uCfuCfgAfaGfuCfgguGfaCfcAfuGfasCfsc 1046 AD-53714.1 A-110592.1 CfaCfcCfuCfaUfAfGfgCfcUfgGfaGfuUfL96 496 1151 A-109339.2 aAfcUfcCfaGfgCfcuaU fg Af gG fg U f gs Cfs c 1047 AD-53715.1 A-110600.1 GfcCfuGfgAfgUfUfUfaUfuCfgGfaAfaAfL96 497 1162 A-109355.2 uUfuUfcCfgAfaUfaaaCfuCfcAfgGfcsCfsu 1048 AD-53716.1 A-110608.1 UfgGfcCfgCfuGfUfGfuGfgAfcCfuCfuUfL96 498 1427 A-109371.2 a Afg Af gG f u Cf c Af ca c AfgCf gG f cCf a s Afs a 1049 AD-53717.1 A-110616.1 GfaGfgCfaGfaGfAfCfuGfaUfcCfaCfuUfL96 499 1595 A-109387.2 aAfgUfgGfaUfcAfgucUfcUfgCfcUfcsAfsa 1050 AD-53718.1 A-110624.1 UfgGfcAfgCfuGfUfUfuUfgCfaGfgAfcUfL96 500 1719 A-109403.2 aGfuCfcUfgCfaAfaa c AfgCf u G f cCf a s Afs c 1051 AD-53719.1 A-110632.1 GfgGfgUfgAfgGfGfUfgUfcUfaCfgCfcAfL96 501 1909 A-109419.2 u GfgCfgUf a Gfa Cfa ccCf uCf a CfcCf csCfsa 1052 AD-53674.1 A-110554.1 CfaCfcAfaGfaUfCfCfuGfcAfuGfuCfuUfL96 502 686 A-109263.2 aAfgAfcAfuGfcAfggaUfcUfuGfgUfgsAfsg 1053 AD-53675.1 A-110562.1 UfaCfaUfcGfaGfGfAfgGfaCfuCfcUfcUfL96 503 786 A-109279.2 aGfaGfgAfgUfcCfuccUfcGfaUfgUfasGfsu 1054 AD-53676.1 A-11O57O.1 AfgGfuGfuAfuCfUfCfcUfaGfaCfaCfcAfL96 504 904 A-109295.2 uGfgUfgUfcUfaGfgagAfuAfcAfcCfusCfsc 1055 AD-53677.1 A-110578.1 AfcAfgAfgUfgAfCfCfaCfcGfgGfaAfaUfL96 505 929 A-109311.2 aUfuUfcCfcGfgUfgguCfaCfuCfuGfusAfsu 1056 AD-53678.1 A-110586.1 AfgGfaCfgGfgAfCfCfcGfcUfuCfcAfcAfL96 506 994 A-109327.2 uGfuGfgAfaGfcGfgguCfcCfgUfcCfusCfsc 1057 AD-53720.1 A-110593.1 AfcCfcUfcAfuAfGfGfcCfuGfgAfgUfuUfL96 507 1152 A-109341.2 aAfaCfuCfcAfgGfccuAfuGfaGfgGfusGfsc 1058 AD-53721.1 A-110601.1 GfgAfgUfuUfaUfUfCfgGfaAfaAfgCfcAfL96 508 1166 A-109357.2 u GfgCf u Uf u UfcCfga a Ufa Afa Cf u Cf csAfsg 1059 AD-53722.1 A-110609.1 GfgCfcGfcUfgUfGfUfgGfaCfcUfcUfuUfL96 509 1428 A-109373.2 aAfaGfaGfgUfcCfacaCfaGfcGfgCfcsAfsa 1060 AD-53723.1 A-110617.1 GfgCfaGfaGfaCfUfGfaUfcCfaCfuUfcUfL96 510 1597 A-109389.2 aGfaAfgUfgGfaUfcagUfcUfcUfgCfcsUfsc 1061 AD-53724.1 A-110625.1 GfcAfgCfuGfuUfUfUfgCfaGfgAfcUfgUfL96 511 1721 A-109405.2 aCfaGfuCfcUfgCfaaaAfcAfgCfuGfcsCfsa 1062 AD-53725.1 A-110633.1 GfgGfuGfaGfgGfUfGfuCfuAfcGfcCfaUfL96 512 1910 A-109421.2 aUfgGfcGfuAfgAfcacCfcUfcAfcCfcsCfsc 1063 AD-53679.1 A-110547.1 CfuAfcGfuGfgUfGfGfuGfcUfgAfaGfgAfL96 513 593 A-109249.2 uCfcUfuCfaGfcAfccaCfcAfcGfuAfgsGfsu 1064 AD-53680.1 A-110555.1 CfaAfgAfuCfcUfGfCfaUfgUfcUfuCfcAfL96 514 689 A-109265.2 uGfgAfaGfaCfaUfgcaGfgAfuCfuUfgsGfsu 1065 AD-53681.1 A-110563.1 UfcGfaGfgAfgGfAfCfuCfcUfcUfgUfcUfL96 515 790 A-109281.2 aGfaCfaGfaGfgAfgucCfuCfcUfcGfasUfsg 1066 AD-53682.1 A-110571.1 Gf u Af u Cf uCfc UfAfGfa Cfa Cf cAfgCfa U f L96 516 908 A-109297.2 aUfgCfuGfgUfgUfcuaGfgAfgAfuAfcsAfsc 1067 AD-53683.1 A-110579.1 GfaGfuGfaCfcAfCfCfgGfgAfaAfuCfgAfL96 517 932 A-109313.2 uCfgAfuUfuCfcCfgguGfgUfcAfcUfcsUfsg 1068 AD-53684.1 A-110587.1 CfgGfgAfcCfcGfCfUfuCfcAfcAfgAfcAfL96 518 998 A-109329.2 uGfuCfuGfuGfgAfagcGfgGfuCfcCfgsUfsc 1069 AD-53726.1 A-110594.1 CfcCfuCfaUfaGfGfCfcUfgGfaGfuUfuAfL96 519 1153 A-109343.2 uAfaAfcUfcCfaGfgccUfaUfgAfgGfgsUfsg 1070 AD-53727.1 A-110602.1 GfuUfuAfuUfcGfGfAfaAfaGfcCfaGfcUfL96 520 1169 A-109359.2 aGfcUfgGfcUfuUfuccGfaAfuAfaAfcsUfsc 1071 AD-53728.1 A-110610.1 UfgUfgUfgGfaCfCfUfcUfuUfgCfcCfcAfL96 521 1434 A-109375.2 uGfgGfgCfaAfaGfaggUfcCfaCfaCfasGfsc 1072 AD-53729.1 A-110618.1 CfaGfaGfaCfuGfAfUfcCfaCfuUfcUfcUfL96 522 1599 A-109391.2 aGfaGfaAfgUfgGfaucAfgUfcUfcUfgsCfsc 1073 AD-53730.1 A-110626.1 UfcUfgCfcGfgGfCfCfcAfcAfaCfgCfuUfL96 523 1885 A-109407.2 aAfgCfgUfuGfuGfggcCfcGfgCfaGfasCfsc 1074 AD-53731.1 A-110634.1 GfgUfgAfgGfgUfGfUfcUfaCfgCfcAfuUfL96 524 1911 A-109423.2 aAfuGfgCfgUfaGfacaCfcCfuCfaCfcsCfsc 1075 AD-53685.1 A-110548.1 CfcCfgCfcGfgGfGfAfuAfcCfuCfaCfcAfL96 525 670 A-109251.2 uGfgUfgAfgGfuAfuccCfcGfgCfgGfgsCfsa 1076

- 81 037110

AD-53687.1 A-110564.1 Cfg Af gG f a G fg Af Cf U f cCf u Cf u Gf u Cf u U f L9 6 526 791 A-109283.2 a Afg Af c Af g Af gG faguCfcUfcCfuCfgsAfsu 1077 AD-53688.1 A-110572.1 UfaUfcUfcCfuAfGfAfcAfcCfaGfcAfuAfL96 527 909 A-109299.2 uAfuGfcUfgGfuGfucuAfgGfaGfaUfasCfsa 1078 AD-53689.1 A-110580.1 GfgAfaAfuCfgAfGfGfgCfaGfgGfuCfaUfL96 528 944 A-109315.2 aUfgAfcCfcUfgCfccuCfgAfuUfuCfcsCfsg 1079 AD-53690.1 A-110588.1 UfcCfaCfaGfaCfAfGfgCfcAfgCfaAfgUfL96 529 1009 A-109331.2 aCfuUfgCfuGfgCfcugUfcUfgUfgGfasAfsg 1080 AD-53732.1 A-110595.1 CfcUfcAfuAfgGfCfCfuGfgAfgUfuUfaUfL96 530 1154 A-109345.2 aUfaAfaCfuCfcAfggcCfuAfuGfaGfgsGfsu 1081 AD-53733.1 A-110603.1 GfgGfcUfgGfgGfUfCfgUfgCfuGfgUfcAfL96 531 1279 A-109361.2 u Gf a CfcAfgCfa Cfga cCf cCfa GfcCfcs Ufsc 1082 AD-53734.1 A-110611.1 GfgGfaGfgAfcAfUfCfaUfuGfgUfgCfcUfL96 532 1456 A-109377.2 aGfgCfaCfcAfaUfgauGfuCfcUfcCfcsCfsu 1083 AD-53735.1 A-110619.1 AfcUfgAfuCfcAfCfUfuCfuCfuGfcCfaAfL96 533 1604 A-109393.2 uUfgGfcAfgAfgAfaguGfgAfuCfaGfusCfsu 1084 AD-53736.1 A-110627.1 CfuGfcCfgGfgCfCfCfaCfaAfcGfcUfuUfL96 534 1886 A-109409.2 aAfaGfcGfuUfgUfgggCfcCfgGfcAfgsAfsc 1085 AD-53737.1 A-110635.1 AfgGfgUfgUfcUfAfCfgCfcAfuUfgCfcAfL96 535 1915 A-109425.2 uGfgCfaAfuGfgCfguaGfaCfaCfcCfusCfsa 1086 AD-53691.1 A-110549.1 CfcGfcCfgGfgGfAfUfaCfcUfcAfcCfaAfL96 536 671 A-109253.2 uUfgGfuGfaGfgUfaucCfcCfgGfcGfgsGfsc 1087 AD-53692.1 A-110557.1 GfuUfgCfcCfcAfUfGfuCfgAfcUfaCfaUfL96 537 770 A-109269.2 aUfgUfaGfuCfgAfcauGfgGfgCfaAfcsUfsu 1088 AD-53693.1 A-110565.1 GfuAfcCfgGfgCfGfGfaUfgAfaUfaCfcAfL96 538 857 A-109285.2 uGfgUfaUfuCfaUfccgCfcCfgGfuAfcsCfsg 1089 AD-53694.1 A-110573.1 UfcUfcCfuAfgAfCfAfcCfaGfcAfuAfcAfL96 539 911 A-109301.2 uGfuAfuGfcUfgGfuguCfuAfgGfaGfasUfsa 1090 AD-53695.1 A-110581.1 AfaUfcGfaGfgGfCfAfgGfgUfcAfuGfgUfL96 540 947 A-109317.2 aCfcAfuGfaCfcCfugcCfcUfcGfaUfusUfsc 1091 AD-53738.1 A-110596.1 CfuCfaUfaGfgCfCfUfgGfaGfuUfuAfuUfL96 541 1155 A-109347.2 aAfuAfaAfcUfcCfaggCfcUfaU fg Af gsG fsg 1092 AD-53739.1 A-110604.1 GfgUfcAfcCfgCfUfGfcCfgGfcAfaCfuUfL96 542 1295 A-109363.2 aAfgUfuGfcCfgGfcagCfgGfuGfaCfcsAfsg 1093 AD-53740.1 A-110612.1 AfcUfgCfaGfcAfCfCfuGfcUfuUfgUfgUfL96 543 1483 A-109379.2 aCfaCfaAfaGfcAfgguGfcUfgCfaGfusCfsg 1094 AD-53741.1 A-110620.1 AfuCfcAfcUfuCfUfCfuGfcCfaAfaGfaUfL96 544 1608 A-109395.2 aUfcUfuUfgGfcAfgagAfaGfuGfgAfusCfsa 1095 AD-53742.1 A-110628.1 GfcCfcAfcAfaCfGfCfuUfuUfgGfgGfgUfL96 545 1893 A-109411.2 aCfcCfcCfaAfaAfgcgUfuGfuGfgGfcsCfsc 1096 AD-53743.1 A-110636.1 GfuGfuCfuAfcGfCfCfaUfuGfcCfaGfgUfL96 546 1918 A-109427.2 aCfcUfgGfcAfaUfggcGfuAfgAfcAfcsCfsc 1097 AD-53744.1 A-110644.1 GfgAfaUfgCfaAfAfGfuCfaAfgGfaGfcAfL96 547 2180 A-109443.2 uGfcUfcCfuUfgAfcuuUfgCfaUfuCfcsAfsg 1098 AD-53745.1 A-110652.1 UfgAfuGfgCfcCfUfCfaUfcUfcCfaGfcUfL96 548 2906 A-109459.2 aGfcUfgGfaGfaUfgagGfgCfcAfuCfasGfsc 1099 AD-53746.1 A-110660.1 CfuGfaAfgCfcAfAfGfcCfuCfuUfcUfuAfL96 549 3300 A-109475.2 uAfaGfaAfgAfgGfcuuGfgCfuUfcAfgsAfsg 1100 AD-53747.1 A-110668.1 AfcUfgUfcCfcUfCfCfuUfgAfgCfaCfcAfL96 550 3511 A-109491.2 uGfgUfgCfuCfaAfggaGfgGfaCfaGfusUfsg 1101 AD-53748.1 A-110676.1 CfaAfgCfaAfgCfAfGfaCfaUfuUfaUfcUfL96 551 3540 A-109507.2 aGfaUfaAfaUfgUfcugCfuUfgCfuUfgsGfsg 1102 AD-53790.1 A-110683.1 UfaUfcUfuUfuGfGfGfuCfuGfuCfcUfcUfL96 552 3556 A-109521.2 aGfaGfgAfcAfgAfcccAfaAfaGfaUfasAfsa 1103 AD-53791.1 A-110691.1 UfgUfcCfuCfuCfUfGfuUfgCfcUfuUfuUfL96 553 3569 A-109537.2 aAfaAfaGfgCfaAfcagAfgAfgGfaCfasGfsa 1104 AD-53792.1 A-110699.1 UfuGfuAfaCfuUfGfAfaGfaUfaUfuUfaUfL96 554 3620 A-109553.2 aUfaAfaUfaUfcUfucaAfgUfuAfcAfasAfsa 1105 AD-53793.1 A-11O7O7.1 CfuUfuAfcUfcUfGfCfuCfuAfuGfcCfaAfL96 555 3055 A-109569.2 uUfgGfcAfuAfgAfgcaGfaGfuAfaAfgsGfsu 1106 AD-53794.1 A-110715.1 Af gG fgGf a Af c Af CfAfg Af cCf a G fg Af a Af L9 6 556 3370 A-109585.2 uUfuCfcUfgGfuCfuguGfuUfcCfcCfusUfsc 1107 AD-53795.1 A-110723.1 UfuGfgGfuCfuGfUfCfcUfcUfcUfgUfuUfL96 557 3562 A-109601.2 a Afa Cf a Gf a Gf a Gfga cAfgAf cCfcAfa sAfsa 1108 AD-53749.1 A-110637.1 UfgCfaGfcGfuCfCfAfcAfcAfgCfuCfcAfL96 558 1962 A-109429.2 uGfgAfgCfuGfuGfuggAfcGfcUfgCfasGfsu 1109 AD-53750.1 A-110645.1 AfaUfcCfcGfgCfCfCfcUfcAfgGfaGfcAfL96 559 2204 A-109445.2 uGfcUfcCfuGfaGfgggCfcGfgGfaUfusCfsc 1110 AD-53751.1 A-110653.1 UfuUfcUfgGfaUfGfGfcAfuCfuAfgCfcAfL96 560 2974 A-109461.2 uGfgCfuAfgAfuGfccaUfcCfaGfaAfasGfsc 1111 AD-53752.1 A-110661.1 GfaAfgCfcAfaGfCfCfuCfuUfcUfuAfcUfL96 561 3302 A-109477.2 aGfuAfaGfaAfgAfggcUfuGfgCfuUfcsAfsg 1112 AD-53753.1 A-110669.1 CfcAfgCfcCfcAfCfCfcAfaGfcAfaGfcAfL96 562 3529 A-109493.2 uGfcUfuGfcUfuGfgguGfgGfgCfuGfgsUfsg 1113 AD-53754.1 A-110677.1 Af a G f c Af a G f cAf G f Af c Af u UfuAfuCfuUfL96 563 3541 A-109509.2 aAfgAfuAfaAfuGfucuGfcUfuGfcUfusGfsg 1114

- 82 037110

AD-53796.1 A-110684.1 UfcUfuUfuGfgGfUfCfuGfuCfcUfcUfcUfL96 564 3558 A-109523.2 aGfaGfaGfgAfcAfgacCfcAfaAfaGfasUfsa 1115 AD-53797.1 A-110692.1 GfuCfcUfcUfcUfGfUfuGfcCfuUfuUfuAfL96 565 3570 A-109539.2 u Af a Af a AfgGf cAf a ca Gf a Gf a GfgAf csAfsg 1116 AD-53798.1 A-11O7OO.1 UfgUfaAfcUfuGfAfAfgAfuAfuUfuAfuUfL96 566 3621 A-109555.2 aAfuAfaAfuAfuCfuucAfaGfuUfaCfasAfsa 1117 AD-53799.1 A-110708.1 UfuUfaCfuCfuGfCfUfcUfaUfgCfcAfgAfL96 567 3056 A-109571.2 uCfuGfgCfaUfaGfagcAfgAfgUfaAfasGfsg 1118 AD-53800.1 A-110716.1 CfcAfaGfcAfaGfCfAfgAfcAfuUfuAfuUfL96 568 3539 A-109587.2 aAfuAfaAfuGfuCfugcUfuGfcUfuGfgsGfsu 1119 AD-53801.1 A-110724.1 UfgGfgUfcUfgUfCfCfuCfuCfuGfuUfgAfL96 569 3563 A-109603.2 u Cf a Af c Afg Af g Af gga Cf a G f a Cf c Cf a s Af s a 1120 AD-53755.1 A-110638.1 GfcAfuGfgGfgAfCfCfcGfuGfuCfcAfcUfL96 570 1996 A-109431.2 aGfuGfgAfcAfcGfgguCfcCfcAfuGfcsUfsg 1121 AD-53757.1 A-110654.1 UfcUfgGfaUfgGfCfAfuCfuAfgCfcAfgAfL96 571 2976 A-109463.2 uCfuGfgCfuAfgAfugcCfaUfcCfaGfasAfsa 1122 AD-53758.1 A-110662.1 AfaGfcCfaAfgCfCfUfcUfuCfuUfaCfuUfL96 572 3303 A-109479.2 aAfgUfaAfgAfaGfaggCfuUfgGfcUfusCfsa 1123 AD-53759.1 A-110670.1 CfcCfcAfcCfcAfAfGfcAfaGfcAfgAfcAfL96 573 3533 A-109495.2 uGfuCfuGfcUfuGfcuuGfgGfuGfgGfgsCfsu 1124 AD-53760.1 A-110678.1 AfgCfaAfgCfaGfAfCfaUfuUfaUfcUfuUfL96 574 3542 A-109511.2 aAfaGfaUfaAfaUfgucUfgCfuUfgCfusUfsg 1125 AD-53802.1 A-110685.1 UfuUfuGfgGfuCfUfGfuCfcUfcUfcUfgUfL96 575 3560 A-109525.2 a Cf a Gf a Gf a GfgAfcagAf cCfcAfa Afa sGfsa 1126 AD-53803.1 A-110693.1 UfuUfcUfaGfaCfCfUfgUfuUfuGfcUfuUfL96 576 3600 A-109541.2 aAfaGfcAfaAfaCfaggUfcUfaGfaAfasAfsg 1127 AD-53804.1 A-11O7O1.1 AfcCfaAfgGfaGfGfCfaGfgAfuUfcUfuUfL96 577 2815 A-109557.2 aAfaGfaAfuCfcUfgccUfcCfuUfgGfusGfsg 1128 AD-53805.1 A-11O7O9.1 UfcAfgCfcAfaCfCfCfgCfuCfcAfcUfaAfL96 578 3161 A-109573.2 uUfaGfuGfgAfgCfgggUfuGfgCfuGfasGfsa 1129 AD-53806.1 A-110717.1 CfaAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 579 3544 A-109589.2 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1130 AD-53807.1 A-110725.1 GfgGfuCfuGfuCfCfUfcUfcUfgUfuGfcAfL96 580 3564 A-109605.2 uGfcAfaCfaGfaGfaggAfcAfgAfcCfcsAfsa 1131 AD-53761.1 A-110639.1 CfcCfaCfaAfgCfCfGfcCfuGfuGfcUfgAfL96 581 2080 A-109433.2 uCfaGfcAfcAfgGfcggCfuUfgUfgGfgsUfsg 1132 AD-53762.1 A-110647.1 GfcUfgGfgGfcUfGfAfgCfuUfuAfaAfaUfL96 582 2481 A-109449.2 aUfuUfuAfaAfgCfucaGfcCfcCfaGfcsCfsc 1133 AD-53763.1 A-110655.1 GfcUfcUfaUfgCfCfAfgGfcUfgUfgCfuAfL96 583 3064 A-109465.2 uAfgCfaCfaGfcCfuggCfaUfaGfaGfcsAfsg 1134 AD-53764.1 A-110663.1 GfuGfaGfgCfuGfGfGfaAfgGfgGfaAfcAfL96 584 3358 A-109481.2 u Gf u Uf cCfcCf u Uf cccAfgCf cU fcAfcsU fsg 1135 AD-53765.1 A-110671.1 CfcCfaCfcCfaAfGfCfaAfgCfaGfaCfaUfL96 585 3534 A-109497.2 aUfgUfcUfgCfuUfgcuUfgGfgUfgGfgsGfsc 1136 AD-53766.1 A-110679.1 GfcAfgAfcAfuUfUfAfuCfuUfuUfgGfgUfL96 586 3547 A-109513.2 aCfcCfaAfaAfgAfuaaAfuGfuCfuGfcsUfsu 1137 AD-53808.1 A-110686.1 UfuUfgGfgUfcUfGfUfcCfuCfuCfuGfuUfL96 587 3561 A-109527.2 a Af c Afg Af g Af gG f a ca G f a Cf cCf a Af a s Afsg 1138 AD-53809.1 A-110694.1 UfuCfuAfgAfcCfUfGfuUfuUfgCfuUfuUfL96 588 3601 A-109543.2 aAfaAfgCfaAfaAfcagGfuCfuAfgAfasAfsa 1139 AD-53810.1 A-11O7O2.1 GfgAfgGfcAfgGfAfUfuCfuUfcCfcAfuUfL96 589 2820 A-109559.2 aAfuGfgGfaAfgAfaucCfuGfcCfuCfcsUfsu 1140 AD-53811.1 A-11O71O.1 CfcUfgCfcAfaGfCfUfcAfcAfcAfgCfaAfL96 590 3247 A-109575.2 uUfgCfuGfuGfuGfagcUfuGfgCfaGfgsCfsa 1141 AD-53812.1 A-110718.1 Af a G f c Afg Af c Af U f U f u Af u Cf u U f u U f gAf L9 6 591 3545 A-109591.2 uCfaAfaAfgAfuAfaauGfuCfuGfcUfusGfsc 1142 AD-53813.1 A-110726.1 UfcUfaGfaCfcUfGfUfuUfuGfcUfuUfuUfL96 592 3602 A-109607.2 aAfaAfaGfcAfaAfacaGfgUfcUfaGfasAfsa 1143 AD-53767.1 A-110640.1 GfaGfgCfcAfcGfAfGfgUfcAfgCfcCfaAfL96 593 2099 A-109435.2 uUfgGfgCfuGfaCfcucGfuGfgCfcUfcsAfsg 1144 AD-53768.1 A-110648.1 GfgAfgGfuGfcCfAfGfgAfaGfcUfcCfcUfL96 594 2650 A-109451.2 aGfgGfaGfcUfuCfcugGfcAfcCfuCfcsAfsc 1145 AD-53769.1 A-110656.1 CfuCfaGfcCfaAfCfCfcGfcUfcCfaCfuAfL96 595 3160 A-109467.2 uAfgUfgGfaGfcGfgguUfgGfcUfgAfgsAfsc 1146 AD-53770.1 A-110664.1 GfgCfuGfgGfaAfGfGfgGfaAfcAfcAfgAfL96 596 3362 A-109483.2 u Cf u Gf u Gf u Uf cCfccu UfcCf cAfgCf cs Ufsc 1147 AD-53771.1 A-110672.1 CfcAfcCfcAfaGfCfAfaGfcAfgAfcAfuUfL96 597 3535 A-109499.2 aAfuGfuCfuGfcUfugcUfuGfgGfuGfgsGfsg 1148 AD-53772.1 A-110680.1 AfgAfcAfuUfuAfUfCfuUfuUfgGfgUfcUfL96 598 3549 A-109515.2 aGfaCfcCfaAfaAfgauAfaAfuGfuCfusGfsc 1149 AD-53814.1 A-110687.1 GfgUfcUfgUfcCfUfCfuCfuGfuUfgCfcUfL96 599 3565 A-109529.2 aGfgCfaAfcAfgAfgagGfaCfaGfaCfcsCfsa 1150 AD-53815.1 A-110695.1 CfuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 600 3603 A-109545.2 a Cf a Af a Af gCf a Afa a c Af gG f u Cf u Afgs Af sa 1151 AD-53816.1 A-11O7O3.1 GfaGfgCfaGfgAfUfUfcUfuCfcCfaUfgAfL96 601 2821 A-109561.2 uCfaUfgGfgAfaGfaauCfcUfgCfcUfcsCfsu 1152

- 83 037110

AD-53817.1 A-110711.1 CfcAfaGfcUfcAfCfAfcAfgCfaGfgAfaAfL96 602 3251 A-109577.2 uUfuCfcUfgCfuGfuguGfaGfcUfuGfgsCfsa 1153 AD-53818.1 A-110719.1 AfgCfaGfaCfaUfUfUfaUfcUfuUfuGfgAfL96 603 3546 A-109593.2 uCfcAfaAfaGfaUfaaaUfgUfcUfgCfusUfsg 1154 AD-53819.1 A-110727.1 GfuAfaCfuUfgAfAfGfaUfaUfuUfaUfuUfL96 604 3622 A-109609.2 aAfaUfaAfaUfaUfcuuCfaAfgUfuAfcsAfsa 1155 AD-53773.1 A-110641.1 CfaCfgAfgGfuCfAfGfcCfcAfaCfcAfgUfL96 605 2104 A-109437.2 aCfuGfgUfuGfgGfcugAfcCfuCfgUfgsGfsc 1156 AD-53774.1 A-110649.1 AfcUfgUfgGfgGfCfAfuUfuCfaCfcAfuUfL96 606 2676 A-109453.2 aAfuGfgUfgAfaAfugcCfcCfaCfaGfusGfsa 1157 AD-53776.1 A-110665.1 GfaAfgGfgGfaAfCfAfcAfgAfcCfaGfgAfL96 607 3368 A-109485.2 uCfcUfgGfuCfuGfuguUfcCfcCfuUfcsCfsc 1158 AD-53777.1 A-110673.1 CfaCfcCfaAfgCfAfAfgCfaGfaCfaUfuUfL96 608 3536 A-109501.2 aAfaUfgUfcUfgCfuugCfuUfgGfgUfgsGfsg 1159 AD-53778.1 A-110681.1 AfcAfuUfuAfuCfUfUfuUfgGfgUfcUfgUfL96 609 3551 A-109517.2 a Cf a Gf a CfcCf a Af a agAf u Af a Af u Gf usCfs u 1160 AD-53820.1 A-110688.1 GfuCfuGfuCfcUfCfUfcUfgUfuGfcCfuUfL96 610 3566 A-109531.2 aAfgGfcAfaCfaGfagaGfgAfcAfgAfcsCfsc 1161 AD-53821.1 A-110696.1 UfaGfaCfcUfgUfUfUfuGfcUfuUfuGfuAfL96 611 3604 A-109547.2 uAfcAfaAfaGfcAfaaaCfaGfgUfcUfasGfsa 1162 AD-53822.1 A-110704.1 CfuUfuCfuGfgAfUfGfgCfaUfcUfaGfcAfL96 612 2973 A-109563.2 uGfcUfaGfaUfgCfcauCfcAfgAfaAfgsCfsu 1163 AD-53823.1 A-110712.1 AfaGfcUfcAfcAfCfAfgCfaGfgAfaCfuUfL96 613 3253 A-109579.2 aAfgUfuCfcUfgCfuguGfuGfaGfcUfusGfsg 1164 AD-53824.1 A-11O72O.1 GfaCfaUfuUfaUfCfUfuUfuGfgGfuCfuUfL96 614 3550 A-109595.2 aAfgAfcCfcAfaAfagaUfaAfaUfgUfcsUfsg 1165 AD-48400.4 A-98247.3 UfuUfuCfuAfgAfcCfuGfuUfuUfgCfuUfL96 615 A-93455.5 aAfgCfaAfaAfcAfgGfuCfuAfgAfaAfasGfsu 1166 AD-53779.1 A-110642.1 GfgGfaGfgCfcAfGfCfaUfcCfaCfgCfuUfL96 616 2137 A-109439.2 aAfgCfgUfgGfaUfgcuGfgCfcUfcCfcsUfsg 1167 AD-53780.1 A-110650.1 CfcAfcCfaAfgGfAfGfgCfaGfgAfuUfcUfL96 617 2813 A-109455.2 aGfaAfuCfcUfgCfcucCfuUfgGfuGfgsAfsg 1168 AD-53781.1 A-110658.1 GfcCfaAfgCfuCfAfCfaCfaGfcAfgGfaAfL96 618 3250 A-109471.2 uUfcCfuGfcUfgUfgugAfgCfuUfgGfcsAfsg 1169 AD-53782.1 A-110666.1 AfaGfgGfgAfaCfAfCfaGfaCfcAfgGfaAfL96 619 3369 A-109487.2 uUfcCfuGfgUfcUfgugUfuCfcCfcUfusCfsc 1170 AD-53783.1 A-110674.1 AfcCfcAfaGfcAfAfGfcAfgAfcAfuUfuAfL96 620 3537 A-109503.2 uAfaAfuGfuCfuGfcuuGfcUfuGfgGfusGfsg 1171 AD-53784.1 A-110682.1 Ufu Ufa UfcUfu UfUfGfgGf uCfuGfuCfcUfL96 621 3554 A-109519.2 a G fg Af c Af gAf cCf ca a Af a Gf a U f a Af a s U f sg 1172 AD-53825.1 A-110689.1 UfcUfgUfcCfuCfUfCfuGfuUfgCfcUfuUfL96 622 3567 A-109533.2 a Af a G fgCf a Af c Afga g Af gG f a Cf a G f a sCf s c 1173 AD-53826.1 A-110697.1 UfuUfuGfuAfaCfUfUfgAfaGfaUfaUfuUfL96 623 3618 A-109549.2 aAfaUfaUfcUfuCfaagUfuAfcAfaAfasGfsc 1174 AD-53827.1 A-11O7O5.1 UfuCfuGfgAfuGfGfCfaUfcUfaGfcCfaAfL96 624 2975 A-109565.2 uUfgGfcUfaGfaUfgccAfuCfcAfgAfasAfsg 1175 AD-53828.1 A-110713.1 UfgAfaGfcCfaAfGfCfcUfcUfuCfuUfaAfL96 625 3301 A-109581.2 uUfaAfgAfaGfaGfgcuUfgGfcUfuCfasGfsa 1176 AD-53829.1 A-110721.1 UfuAfuCfuUfuUfGfGfgUfcUfgUfcCfuUfL96 626 3555 A-109597.2 aAfgGfaCfaGfaCfccaAfaAfgAfuAfasAfsu 1177 AD-53830.1 A-110872.1 UfuUfuCfuAfgAfCfCfuGfuUfuUfgCfuUfL96 627 A-110873.1 a AfgCf a Af a Af c Afgg u Cf u Af gAf a Af a sG fs u 1178 AD-53785.1 A-110643.1 AfuCfcAfcGfcUfUfCfcUfgCfuGfcCfaUfL96 628 2148 A-109441.2 aUfgGfcAfgCfaGfgaaGfcGfuGfgAfusGfsc 1179 AD-53786.1 A-110651.1 CfaCfcAfaGfgAfGfGfcAfgGfaUfuCfuUfL96 629 2814 A-109457.2 aAfgAfaUfcCfuGfccuCfcUfuGfgUfgsGfsa 1180 AD-53787.1 A-110659.1 CfaAfgCfuCfaCfAfCfaGfcAfgGfaAfcUfL96 630 3252 A-109473.2 aGfuUfcCfuGfcUfgugUfgAfgCfuUfgsGfsc 1181 AD-53788.1 A-110667.1 GfgGfaAfcAfcAfGfAfcCfaGfgAfaGfcUfL96 631 3372 A-109489.2 aGfcUfuCfcUfgGfucuGfuGfuUfcCfcsCfsu 1182 AD-53789.1 A-110675.1 Cf cCf a AfgCf a Af G f Cf a G f a Cf a U f u U f a U f L9 6 632 3538 A-109505.2 aUfaAfaUfgUfcUfgcuUfgCfuUfgGfgsUfsg 1183 AD-53831.1 A-110690.1 CfuGfuCfcUfcUfCfUfgUfuGfcCfuUfuUfL96 633 3568 A-109535.2 aAfaAfgGfcAfaCfagaGfaGfgAfcAfgsAfsc 1184 AD-53832.1 A-110698.1 UfuUfgUfaAfcUfUfGfaAfgAfuAfuUfuAfL96 634 3619 A-109551.2 uAfaAfuAfuCfuUfcaaGfuUfaCfaAfasAfsg 1185 AD-53833.1 A-110706.1 CfuGfgAfuGfgCfAfUfcUfaGfcCfaGfaAfL96 635 2977 A-109567.2 uUfcUfgGfcUfaGfaugCfcAfuCfcAfgsAfsa 1186 AD-53834.1 A-110714.1 AfgUfgAfgGfcUfGfGfgAfaGfgGfgAfaAfL96 636 3357 A-109583.2 uUfuCfcCfcUfuCfccaGfcCfuCfaCfusGfsu 1187 AD-53835.1 A-110722.1 AfuCfuUfuUfgGfGfUfcUfgUfcCfuCfuUfL96 637 3557 A-109599.2 a Afg Af gG faCfaGfaccCfaAfaAfgAfusAfsa 1188 AD-48399.1 A-100981.1 CfaCfuUfaCfgCfuGfaGfuAfcUfuCfgAfL96 638 A-100982.1 uCfgAfaGfuAfcUfcAfgCfgUfaAfgUfgsAfsu 1189 AD-53815.5 A-110695.11 CfuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 639 3603 A-109545.18 aCfaAfaAfgCfaAfaacAfgGfuCfuAfgsAfsa 1190 AD-53815.4 A-110695.4 CfuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 640 3603 A-109545.5 aCfaAfaAfgCfaAfaacAfgGfuCfuAfgsAfsa 1191 AD-56633.1 A-115520.2 cuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 641 3603 A-109545.6 aCfaAfaAfgCfaAfaacAfgGfuCfuAfgsAfsa 1192 AD-56617.1 A-115535.1 CfuagAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 642 3603 A-109545.7 a Cf a Af a AfgCf a Afa a c Af gG f u Cf u Afgs Af sa 1193 AD-56623.1 A-115536.1 CfuagAfcCfuGfUfUfuUfgcuUfuUfguL96 643 3603 A-109545.8 a Cf a Af a AfgCf a Afa a c Af gG f u Cf u Afgs Af sa 1194 AD-56629.1 A-115537.1 CfuagAfccuGfUfUfuUfgcuUfuUfguL96 644 3603 A-109545.9 aCfaAfaAfgCfaAfaacAfgGfuCfuAfgsAfsa 1195 AD-56635.1 A-115538.1 CfuagAfccuGfUfUfuugcuUfuuguL96 645 3603 A-109545.10 a Cf a Af a AfgCf a Afa a c Af gG f u Cf u Afgs Af sa 1196 AD-56641.1 A-115539.1 CfuagaccuGfUfUfuugcuuuuguL96 646 3603 A-109545.11 aCfaAfaAfgCfaAfaacAfgGfuCfuAfgsAfsa 1197 AD-56625.1 A-115542.1 CfuAfGfAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 647 3603 A-109545.12 a Cf a Af a AfgCf a Afa a c Af gG f u Cf u Afgs Af sa 1198 AD-56631.1 A-115543.1 CfuAfGfAfcCfuGfUfUfuUfGfCfuUfuUfgUfL96 648 3603 A-109545.13 a Cf a Af a AfgCf a Afa a c Af gG f u Cf u Afgs Af sa 1199 AD-56637.1 A-115544.1 CfuAfGfAfcCfuGfUfUfuUfGfCfuUfUfUfgUfL96 649 3603 A-109545.14 aCfaAfaAfgCfaAfaacAfgGfuCfuAfgsAfsa 1200 AD-56643.1 A-115545.1 CfuAfGfAfCfCfuGfUfUfuUfGfCfuUfUfUfGfUfL96 650 3603 A-109545.15 a Cf a Af a AfgCf a Afa a c Af gG f u Cf u Afgs Af sa 1201 AD-56649.1 A-115546.1 CfUfAfGfAfCfCfuGfUfUfuUfGfCfUfUfUfUfGfUfL 96 651 3603 A-109545.16 aCfaAfaAfgCfaAfaacAfgGfuCfuAfgsAfsa 1202 AD-56655.1 A-115547.1 CfUfAfGfAfCfCfUfGfUfUfUfUfGfCfUfUfUfUfGfUf L96 652 3603 A-109545.17 a Cf a Af a AfgCf a Afa a c Af gG f u Cf u Afgs Af sa 1203 AD-56615.1 A-110695.5 CfuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 653 3603 A-115519.1 acaAfaAfgcaAfaacAfgGfuCfuAfgsAfsa 1204 AD-56621.1 A-115520.1 cuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 654 3603 A-115519.2 acaAfaAfgcaAfaacAfgGfuCfuAfgsAfsa 1205 AD-56627.1 A-115521.1 cuAfgAfcCfuGfUfUfuugCfuUfuugUfL96 655 3603 A-115519.3 acaAfaAfgcaAfaacAfgGfuCfuAfgsAfsa 1206 AD-56639.1 A-115520.3 cuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 656 3603 A-115522.1 ACfaAfaAfgCfaAfaacAfgGfuCfuAfgsAfsa 1207

- 84 037110

AD-56645.1 A-110695.6 CfuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 657 3603 A-115522.2 ACfaAfaAfgCfaAfaacAfgGfuCfuAfgsAfsa 1208 AD-56651.1 A-115523.1 (iC) uAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 658 3603 A-115524.1 (iA) CfaAfaAfgCfaAfaacAfgGfuCfuAfgsAfs (iA) 1209 AD-56610.1 A-115523.2 (iC) uAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 659 3603 A-115525.1 a Cf a Af a AfgCf a Af a a cAfgGf u Cf u Afgs Afs (i A) 1210 AD-56616.1 A-115523.3 (iC) uAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 660 3603 A-115526.1 acaAfaAfgcaAfaacAfgGfuCfuAfgsAfs (iA) 1211 AD-56622.1 A-115527.1 (iC) uAfgAfcCfuGfUfUfuUfgCfuUfuugUfL96 661 3603 A-115526.2 acaAfaAfgcaAfaacAfgGfuCfuAfgsAfs (iA) 1212 AD-56628.1 A-115527.2 (iC) uAfgAfcCfuGfUfUfuUfgCfuUfuugUfL96 662 3603 A-115528.1 (iA) caAfaAfgcaAfaacAfgGfuCfuAfgsAfs (iA) 1213 AD-56634.1 A-115529.1 Cbu AfgAfcCf uGfUf Ufu UfgCf u Uf u UfgUfL96 663 3603 A-115530.1 AbCfaAfaAfgCfaAfaacAfgGfuCfuAfgsAfsAb 1214 AD-56640.1 A-115529.2 Cbu AfgAfcCf uGfUf Ufu UfgCf u Uf u UfgUfL96 664 3603 A-115531.1 aCfaAfaAfgCfaAfaacAfgGfuCfuAfgsAfsAb 1215 AD-56646.1 A-115529.3 Cbu AfgAfcCf uGfUf Ufu UfgCf u Uf u UfgUfL96 665 3603 A-115532.1 acaAfaAfgcaAfaacAfgGfuCfuAfgsAfsAb 1216 AD-56652.1 A-115533.1 Cbu AfgAfcCf uGfUf Ufu UfgCf u Ufu ugUfL96 666 3603 A-115532.2 acaAfaAfgcaAfaacAfgGfuCfuAfgsAfsAb 1217 AD-56611.1 A-115533.2 Cbu AfgAfcCf uGfUf Ufu UfgCf u Ufu ugUfL96 667 3603 A-115534.1 (iA) caAfaAfgcaAfaacAfgGfuCfuAfgsAfsAb 1218 AD-56647.1 A-110695.7 CfuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 668 3603 A-115540.1 a Cf a a a AfgCf a Afa a c Af gG fuCfuAfgsasa 1219 AD-56653.1 A-115535.2 CfuagAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 669 3603 A-115540.2 aCfaaaAfgCfaAfaacAfgGfuCfuAfgsasa 1220 AD-56612.1 A-115536.2 CfuagAfcCfuGfUfUfuUfgcuUfuUfguL96 670 3603 A-115540.3 aCfaaaAfgCfaAfaacAfgGfuCfuAfgsasa 1221 AD-56618.1 A-115537.2 CfuagAfccuGfUfUfuUfgcuUfuUfguL96 671 3603 A-115540.4 a Cf a a a AfgCf a Afa a c Af gG fuCfuAfgsasa 1222 AD-56624.1 A-115538.2 CfuagAfccuGfUfUfuugcuUfuuguL96 672 3603 A-115540.5 a Cf a a a AfgCf a Afa a c Af gG fuCfuAfgsasa 1223 AD-56630.1 A-115539.2 CfuagaccuGfUfUfuugcuuuuguL96 673 3603 A-115540.6 aCfaaaAfgCfaAfaacAfgGfuCfuAfgsasa 1224 AD-56636.1 A-110695.8 CfuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 674 3603 A-115541.1 a Cf a a a AfgCf a Afa a c Af gg u Cf u Afgs a s a 1225 AD-56642.1 A-115535.3 CfuagAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 675 3603 A-115541.2 aCfaaaAfgCfaAfaa c Af gg uCfuAfgsasa 1226 AD-56648.1 A-115536.3 CfuagAfcCfuGfUfUfuUfgcuUfuUfguL96 676 3603 A-115541.3 a Cf a a a AfgCf a Afa a c Af gg u Cf u Afgs a s a 1227 AD-56654.1 A-115537.3 CfuagAfccuGfUfUfuUfgcuUfuUfguL96 677 3603 A-115541.4 a Cf a a a AfgCf a Afa a c Af gg u Cf u Afgs a s a 1228 AD-56613.1 A-115538.3 CfuagAfccuGfUfUfuugcuUfuuguL96 678 3603 A-115541.5 aCfaaaAfgCfaAfaa c Af gg uCfuAfgsasa 1229 AD-56619.1 A-115539.3 CfuagaccuGfUfUfuugcuuuuguL96 679 3603 A-115541.6 a Cf a a a AfgCf a Afa a c Af gg u Cf u Afgs a s a 1230 AD-56614.1 A-110695.9 CfuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 680 3603 A-115548.1 aCfaAfAfAfgCfaAfaacAfgGfUfCfuAfgsAfsa 1231 AD-56620.1 A-115542.2 CfuAfGfAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 681 3603 A-115548.2 a Cf a Af Af Af gCf a Afa a c Af gG f U f Cf u Af gs Af s a 1232 AD-56626.1 A-115543.2 CfuAfGfAfcCfuGfUfUfuUfGfCfuUfuUfgUfL96 682 3603 A-115548.3 aCfaAfAfAfgCfaAfaacAfgGfUfCfuAfgsAfsa 1233 AD-56632.1 A-115544.2 CfuAfGfAfcCfuGfUfUfuUfGfCfuUfUfUfgUfL96 683 3603 A-115548.4 a Cf a Af Af Af gCf a Afa a c Af gG f U f Cf u Af gs Af s a 1234 AD-56638.1 A-115545.2 CfuAfGfAfCfCfuGfUfUfuUfGfCfuUfUfUfGfUfL96 684 3603 A-115548.5 aCfaAfAfAfgCfaAfaacAfgGfUfCfuAfgsAfsa 1235 AD-56644.1 A-115546.2 CfUfAfGfAfCfCfuGfUfUfuUfGfCfUfUfUfUfGfUfL 96 685 3603 A-115548.6 a Cf a Af Af Af gCf a Afa a c Af gG f U f Cf u Af gs Af s a 1236 AD-56650.1 A-115547.2 CfUfAfGfAfCfCfUfGfUfUfUfUfGfCfUfUfUfUfGfUf L96 686 3603 A-115548.7 a Cf a Af Af Af gCf a Afa a c Af gG f U f Cf u Af gs Af s a 1237 AD-56656.1 A-11O695.1O CfuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 687 3603 A-115549.1 aCfaAfAfAfGfCfaAfaacAfgGfUfCfuAfgsAfsa 1238 AD-56662.1 A-115542.3 CfuAfGfAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 688 3603 A-115549.2 aCfaAfAfAfGfCfaAfaacAfgGfUfCfuAfgsAfsa 1239 AD-56668.1 A-115543.3 CfuAfGfAfcCfuGfUfUfuUfGfCfuUfuUfgUfL96 689 3603 A-115549.3 aCfaAfAfAfGfCfaAfaacAfgGfUfCfuAfgsAfsa 1240 AD-56673.1 A-115544.3 CfuAfGfAfcCfuGfUfUfuUfGfCfuUfUfUfgUfL96 690 3603 A-115549.4 aCfaAfAfAfGfCfaAfaacAfgGfUfCfuAfgsAfsa 1241 AD-56678.1 A-115545.3 CfuAfGfAfCfCfuGfUfUfuUfGfCfuUfUfUfGfUfL96 691 3603 A-115549.5 aCfaAfAfAfGfCfaAfaacAfgGfUfCfuAfgsAfsa 1242 AD-56683.1 A-115546.3 CfUfAfGfAfCfCfuGfUfUfuUfGfCfUfUfUfUfGfUfL 692 3603 A-115549.6 aCfaAfAfAfGfCfaAfaacAfgGfUfCfuAfgsAfsa 1243 96 AD-56688.1 A-115547.3 CfUfAfGfAfCfCfUfGfUfUfUfUfGfCfUfUfUfUfGfUf L96 693 3603 A-115549.7 aCfaAfAfAfGfCfaAfaacAfgGfUfCfuAfgsAfsa 1244 AD-56657.1 A-115550.1 CfuAfgAfcCfuGfUfUfuUfgCfuUfuugUfL96 694 3603 A-115551.1 aCfAfAfaAfgCfaAfaacAfgGfuCfuAfgsAfsa 1245 AD-56663.1 A-115552.1 Cf u Af gAf cCf u GfUfUfuUfgCfuuuUfgUfL96 695 3603 A-115553.1 aCfaAfAfAfgCfaAfaacAfgGfuCfuAfgsAfsa 1246 AD-56669.1 A-115554.1 CfuAfgAfcCfuGfUfUfuUfgcuUfuUfgUfL96 696 3603 A-115555.1 aCfaAfaAfGfCfaAfaacAfgGfuCfuAfgsAfsa 1247 AD-56674.1 A-115556.1 CfuAfgAfcCfuGfUfUfuugCfuUfuUfgUfL96 697 3603 A-115557.1 aCfaAfaAfgCfAfAfaacAfgGfuCfuAfgsAfsa 1248 AD-56679.1 A-115558.1 CfuAfgAfccuGfUfUfuUfgCfuUfuUfgUfL96 698 3603 A-115559.1 aCfaAfaAfgCfaAfaacAfGfGfuCfuAfgsAfsa 1249 AD-56684.1 A-115560.1 CfuAfgacCfuGfUfUfuUfgCfuUfuUfgUfL96 699 3603 A-115561.1 a Cf a Af a AfgCf a Afa a c Af gG f U f Cf u Af gs Afs a 1250 AD-56689.1 A-115535.4 CfuagAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 700 3603 A-115562.1 a Cf a Af a AfgCf a Afa a c Af gG f u Cf U f Af gs Af sa 1251 AD-56693.1 A-115520.4 cuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 701 3603 A-115563.1 aCfaAfaAfgCfaAfaacAfgGfuCfuAfGfsAfsa 1252 AD-56658.1 A-115564.1 CfuAfgAfcCfuGfUfUfuUfgCfuUfUfUfgUfL96 702 3603 A-115565.1 a Cf a a a AfgCf a Afa a c Af gG f u Cf u Afgs Afs a 1253 AD-56664.1 A-115566.1 CfuAfgAfcCfuGfUfUfuUfgCfUfUfuUfgUfL96 703 3603 A-115567.1 aCfaAfaagCfaAfaacAfgGfuCfuAfgsAfsa 1254 AD-56670.1 A-115568.1 CfuAfgAfcCfuGfUfUfuUfGfCfuUfuUfgUfL96 704 3603 A-115569.1 aCfaAfaAfgcaAfaacAfgGfuCfuAfgsAfsa 1255 AD-56680.1 A-115572.1 CfuAfgAfcCfUfGfUfUfuUfgCfuUfuUfgUfL96 705 3603 A-115573.1 a Cf a Af a AfgCf a AfaacagGfuCfuAfgsAfsa 1256 AD-56685.1 A-115574.1 CfuAfgAfCfCfuGfUfUfuUfgCfuUfuUfgUfL96 706 3603 A-115575.1 a Cf a Af a AfgCf a Afa a c Af gg u Cf u Afgs Afs a 1257 AD-56690.1 A-115542.4 CfuAfGfAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 707 3603 A-115576.1 aCfaAfaAfgCfaAfaacAfgGfucuAfgsAfsa 1258 AD-56694.1 A-115577.1 CfUfAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 708 3603 A-115578.1 a Cf a Af a AfgCf a Afa a c Af gG fuCfuagsAfsa 1259 AD-56659.1 A-110695.12 CfuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 709 3603 A-115579.1 aCfaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1260

- 85 037110

AD-56665.1 A-115580.1 AfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 710 3605 A-115581.1 aCfaAfaAfgCfaAfaacAfgGfuCfusAfsg 1261 AD-56671.1 A-115582.1 AfgAfcCfuGfUfUfuUfgCfuUfuugUfL96 711 3605 A-115583.1 aCfAfAfaAfgCfaAfaacAfgGfuCfusAfsg 1262 AD-56676.1 A-115584.1 AfgAfcCfuGfUfUfuUfgCfuuuUfgUfL96 712 3605 A-115585.1 aCfaAfAfAfgCfaAfaacAfgGfuCfusAfsg 1263 AD-56681.1 A-115586.1 AfgAfcCfuGfUfUfuUfgcuUfuUfgUfL96 713 3605 A-115587.1 aCfaAfaAfGfCfaAfaacAfgGfuCfusAfsg 1264 AD-56686.1 A-115588.1 AfgAfcCf u Gf Uf U f u ugCf u U f u U fgU f L96 714 3605 A-115589.1 aCfaAfaAfgCfAfAfaacAfgGfuCfusAfsg 1265 AD-56691.1 A-115590.1 AfgAfccuGfUfUfuUfgCfuUfuUfgUfL96 715 3605 A-115591.1 aCfaAfaAfgCfaAfaacAfGfGfuCfusAfsg 1266 AD-56695.1 A-115592.1 AfgacCfuGfUfUfuUfgCfuUfuUfgUfL96 716 3605 A-115593.1 aCfaAfaAfgCfaAfaacAfgGfUfCfusAfsg 1267 AD-56660.1 A-115594.1 agAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 717 3605 A-115595.1 a Cf a Af a Af gCf a Afa a c Af gG fuCfUfsAfsg 1268 AD-56666.1 A-115596.1 AfgAfcCfuGfUfUfuUfgCfuUfUfUfgUfL96 718 3605 A-115597.1 a Cf a a a Af gCf a Af a a c Af gG f u Cf u s Af sg 1269 AD-56672.1 A-115598.1 AfgAfcCfuGfUfUfuUfgCfUfUfuUfgUfL96 719 3605 A-115599.1 aCfaAfaagCfaAfaa c Af gG f u Cf u s Af sg 1270 AD-56677.1 A-115600.1 AfgAfcCfuGfUfUfuUfGfCfuUfuUfgUfL96 720 3605 A-115601.1 aCfaAfaAfgcaAfaacAfgGfuCfusAfsg 1271 AD-56682.1 A-115602.1 AfgAfcCfuGfUfUfUfUfgCfuUfuUfgUfL96 721 3605 A-115603.1 a Cf a Af a Af gCf a a a a c Af gG f u Cf u s Af sg 1272 AD-56687.1 A-115604.1 AfgAfcCfUfGfUfUfuUfgCfuUfuUfgUfL96 722 3605 A-115605.1 aCfaAfaAfgCfaAfaacagGfuCfusAfsg 1273 AD-56692.1 A-115606.1 AfgAfCfCfuGfUfUf u UfgCf u Uf u UfgUf L96 723 3605 A-115607.1 a Cf a Af a Af gCf a Afa a c Af gg u Cf u s Afs g 1274 AD-56696.1 A-115608.1 AfGfAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 724 3605 A-115609.1 aCfaAfaAfgCfaAfaacAfgGfucusAfsg 1275 AD-56661.1 A-115580.2 AfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 725 3605 A-115610.1 a Cf a Af a Af gCf a Afa a c Af gG fuCfusasg 1276 AD-56667.1 A-115611.1 gAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 726 3605 A-115612.1 aCfaAfaAfgCfaAfaacAfgGfuCfausa 1277 AD-53806.11 A-11O717.1O CfaAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 727 3544 A-109589.15 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1278 AD-53806.13 A-110717.11 CfaAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 728 3544 A-109589.10 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1279 AD-53806.12 A-110717.12 CfaAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 729 3544 A-109589.22 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1280 AD-53806.5 A-110717.4 CfaAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 730 3544 A-109589.5 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1281 AD-53806.6 A-110717.5 CfaAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 731 3544 A-109589.7 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1282 AD-53806.7 A-110717.6 CfaAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 732 3544 A-109589.8 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1283 AD-53806.8 A-110717.7 CfaAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 733 3544 A-109589.9 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1284 AD-53806.9 A-110717.8 CfaAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 734 3544 A-109589.9 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1285 AD-53806.10 A-110717.9 CfaAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 735 3544 A-109589.9 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1286 AD-56979.1 A-116393.1 caAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 736 3544 A-109589.6 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1287 AD-56979.2 A-116393.2 caAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 737 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1288 AD-56975.3 A-116394.1 (iC) aAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 738 3544 A-109589.9 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1289 AD-56975.4 A-116394.2 (iC) aAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 739 3544 A-109589.15 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1290 AD-56975.5 A-116394.3 (iC) aAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 740 3544 A-109589.22 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1291 AD-56975.1 A-116394.4 (iC) aAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 741 3544 A-109589.5 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1292 AD-56975.2 A-116394.5 (iC) aAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 742 3544 A-109589.6 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1293 AD-56983.1 A-116400.1 CbaAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 743 3544 A-109589.7 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1294 AD-56983.2 A-116400.2 CbaAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 744 3544 A-109589.8 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1295 AD-56983.3 A-116400.3 CbaAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 745 3544 A-109589.9 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1296 AD-56983.4 A-116400.4 CbaAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 746 3544 A-109589.9 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1297 AD-56983.5 A-116400.5 CbaAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 747 3544 A-109589.15 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1298

- 86 037110

AD-56977.3 A-116406.1 CfaagCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 748 3544 A-109589.10 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1299 AD-56977.1 A-116406.2 CfaagCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 749 3544 A-109589.11 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1300 AD-56977.2 A-116406.3 CfaagCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 750 3544 A-109589.18 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1301 AD-56976.1 A-116407.1 CfaagCfaGfaCfAfUfuUfaucUfuUfuUfL96 751 3544 A-109589.11 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1302 AD-56976.2 A-116407.2 CfaagCfaGfaCfAfUfuUfaucUfuUfuUfL96 752 3544 A-109589.12 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1303 AD-56980.1 A-116408.1 CfaagCfagaCfAfUfuUfaucUfuUfuUfL96 753 3544 A-109589.12 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1304 AD-56980.2 A-116408.2 CfaagCfagaCfAfUfuUfaucUfuUfuUfL96 754 3544 A-109589.13 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1305 AD-56984.1 A-116409.1 CfaagCfagaCfAfUfuUfaucUfuuuUfL96 755 3544 A-109589.13 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1306 AD-56984.2 A-116409.2 CfaagCfagaCfAfUfuUfaucUfuuuUfL96 756 3544 A-109589.14 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1307 AD-56987.1 A-116410.1 CfaagCfagaCfAfUfuUfaucUfuuuuL96 757 3544 A-109589.14 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1308 AD-56987.2 A-116410.2 CfaagCfagaCfAfUfuUfaucUfuuuuL96 758 3544 A-109589.9 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1309 AD-56991.1 A-116415.1 CfaagCfagaCfAfUfuUfaucuuuuuL96 759 3544 A-109589.15 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1310 AD-56993.1 A-116416.1 CfaagcagaCfAfUfuUfaucuuuuuL96 760 3544 A-109589.16 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1311 AD-56995.1 A-116417.1 CfaagcagaCfAfUfuuaucuuuuuL96 761 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1312 AD-56978.1 A-116418.1 CfaAfGfCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 762 3544 A-109589.18 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1313 AD-56978.2 A-116418.2 CfaAfGfCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 763 3544 A-109589.17 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1314 AD-56981.1 A-116419.1 CfaAfGfCfaGfaCfAfUfuUfAfUfcUfuUfuUfL96 764 3544 A-109589.19 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1315 AD-56985.1 A-116420.1 CfaAfGfCfaGfaCfAfUfuUfAfUfCfUfuUfuUfL96 765 3544 A-109589.20 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1316 AD-56988.1 A-116421.1 CfaAfGfCfAfGfaCfAfUfuUfAfUfCfUfuUfuUfL96 766 3544 A-109589.21 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1317 AD-56988.2 A-116421.2 CfaAfGfCfAfGfaCfAfUfuUfAfUfCfUfuUfuUfL96 767 3544 A-109589.9 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1318 AD-56988.3 A-116421.3 CfaAfGfCfAfGfaCfAfUfuUfAfUfCfUfuUfuUfL96 768 3544 A-109589.15 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1319 AD-56982.1 A-116426.1 CfaAfgcaGfaCfAfUfuUfaUfcUfuUfuUfL96 769 3544 A-109589.19 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1320 AD-56982.2 A-116426.2 CfaAfgcaGfaCfAfUfuUfaUfcUfuUfuUfL96 770 3544 A-109589.23 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1321 AD-56986.1 A-116428.1 CfaAfgCfagaCfAfUfuUfaUfcUfuUfuUfL96 771 3544 A-109589.20 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1322 AD-56986.2 A-116428.2 CfaAfgCfagaCfAfUfuUfaUfcUfuUfuUfL96 772 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1323 AD-56989.1 A-116430.1 CfaAfgCfaGfacAfUfuUfaUfcUfuUfuUfL96 773 3544 A-109589.21 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1324 AD-56990.1 A-116432.1 CfaAfgCfaGfaCfAfuuUfaUfcUfuUfuUfL96 774 3544 A-109589.9 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1325 AD-56992.1 A-116434.1 CfaAfgCfaGfaCfAfUfuUfaucUfuUfuUfL96 775 3544 A-109589.15 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1326 AD-56992.2 A-116434.2 CfaAfgCfaGfaCfAfUfuUfaucUfuUfuUfL96 776 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1327 AD-56994.1 A-116436.1 CfaAfgCfaGfaCfAfUfuUfaUfcUfuuuUfL96 777 3544 A-109589.22 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1328 AD-56994.2 A-116436.2 CfaAfgCfaGfaCfAfUfuUfaUfcUfuuuUfL96 778 3544 A-109589.23 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1329 AD-56996.1 A-116438.1 caagCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 779 3544 A-109589.17 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1330 AD-57001.1 A-116440.1 CfaAfgcagaCfAfUfuUfaUfcUfuUfuUfL96 780 3544 A-109589.17 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1331 AD-57007.1 A-116442.1 Cfa AfgCfaGfaCfAfu u ua UfcUfu Ufu Uf L96 781 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1332 AD-57013.1 A-116444.1 CfaAfgCfaGfaCfAfUfuUfaucuuUfuUfL96 782 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1333 AD-57019.1 A-116446.1 CfaAfgCfaGfaCfAfUfuUfaUfcUfuuuuL96 783 3544 A-109589.17 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1334 AD-57022.1 A-116448.1 CfaAfgCfaGfaCfAfUfuUfaUfcUfUfUfuUfL96 784 3544 A-109589.23 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1335 AD-57025.1 A-116449.1 CfaAfgCfaGfaCfAfUfuUfaUfCfUfuUfuUfL96 785 3544 A-109589.23 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1336

- 87 037110

AD-56997.1 A-116450.1 CfaAfgCfaGfaCfAfUfuUfAfUfcUfuUfuUfL96 786 3544 A-109589.17 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1337 AD-57002.1 A-116452.1 CfaAfgCfaGfaCfAfUfUfUfaUfcUfuUfuUfL96 787 3544 A-109589.17 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1338 AD-57008.1 A-116453.1 CfaAfgCfaGfAfCfAfUfuUfaUfcUfuUfuUfL96 788 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1339 AD-57014.1 A-116454.1 CfaAfgCfAfGfAfCfAfUfuUfaUfcUfuUfuUfL96 789 3544 A-109589.17 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1340 AD-57020.1 A-116455.1 CfAfAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 790 3544 A-109589.23 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1341 AD-57020.2 A-116455.2 CfAfAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 791 3544 A-109589.23 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1342 AD-57026.1 A-116457.1 CfaAfgCfaGfaCfAfUfuUfaUfcuuUfuUfL96 792 3544 A-109589.23 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1343 AD-57003.1 A-116460.1 CfaAfgCfaGfaCfAfUfuuaUfcUfuUfuUfL96 793 3544 A-109589.17 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1344 AD-57009.1 A-116462.1 CfaAfgCfaGfaCfauuUfaUfcUfuUfuUfL96 794 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1345 AD-57015.1 A-116464.1 CfaAfgCfaGfacaUfuUfaUfcUfuUfuUfL96 795 3544 A-109589.17 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1346 AD-57023.1 A-116467.1 CfaAfgCfaGfaCfAfUfuUfaucUfUfUfuUfL96 796 3544 A-109589.23 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1347 AD-57027.1 A-116469.1 CfaAfgCfaGfaCfAfUfuuaUfcUfUfUfuUfL96 797 3544 A-109589.23 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1348 AD-56998.1 A-116471.1 CfaAfgCfagaCfAfUfuUfaUfcUfUfUfuUfL96 798 3544 A-109589.17 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1349 AD-57004.1 A-116473.1 CfaAfgcaGfaCfAfUfuUfaUfcUfUfUfuUfL96 799 3544 A-109589.17 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1350 AD-57010.1 A-116475.1 CfaagCfaGfaCfAfUfuUfaUfcUfUfUfuUfL96 800 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1351 AD-57016.1 A-116477.1 caAfgCfaGfaCfAfUfuUfaUfcUfUfUfuUfL96 801 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1352 AD-56999.2 A-116479.1 CfaAfgCfaGfaCfAfUfuUfAfUfcUfUfUfuUfL96 802 3544 A-109589.17 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1353 AD-56999.1 A-116479.2 CfaAfgCfaGfaCfAfUfuUfAfUfcUfUfUfuUfL96 803 3544 A-109589.17 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1354 AD-57021.1 A-116481.1 CfaAfgCfAfGfaCfAfUfuUfaUfcUfUfUfuUfL96 804 3544 A-109589.23 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1355 AD-57024.1 A-116483.1 CfaAfGfCfaGfaCfAfUfuUfaUfcUfUfUfuUfL96 805 3544 A-109589.23 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1356 AD-57005.1 A-116486.1 CfaAfgCfaGfaCfAfUfuUfaUfCfUfuuuUfL96 806 3544 A-109589.17 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1357 AD-57011.1 A-116488.1 CfaAfgCfaGfaCfAfUfuuaUfCfUfuUfuUfL96 807 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1358 AD-57017.1 A-116490.1 CfaAfGfCfagaCfAfUfuUfaUfcUfuUfuUfL96 808 3544 A-109589.17 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1359 AD-57000.2 A-116492.1 Cf (Aeo) Af (Geo) CfaGfaCfAfUfuUfaUfcUf (Teo) Uf ( Teo) UfL96 809 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1360 AD-57000.3 A-116492.2 Cf (Aeo) Af (Geo) CfaGfaCfAfUfuUfaUfcUf (Teo) Uf ( Teo) UfL96 810 3544 A-109589.23 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1361 AD-57000.1 A-116492.3 Cf (Aeo) Af (Geo) CfaGfaCfAfUfuUfaUfcUf (Teo) Uf ( Teo) UfL96 811 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1362 AD-57006.2 A-116494.1 Cf (Aeo) Af (Geo) CfaGfaCfAfUfuUf (Aeo) Uf (m5Ce o) Uf (Teo) Uf (Teo) UfL96 812 3544 A-109589.23 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1363 AD-57006.3 A-116494.2 Cf (Aeo) Af (Geo) CfaGfaCfAfUfuUf (Aeo) Uf (m5Ce o) Uf (Teo) Uf (Teo) UfL96 813 3544 A-109589.23 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1364 AD-57006.1 A-116494.3 Cf (Aeo) Af (Geo) CfaGfaCfAfUfuUf (Aeo) Uf (m5Ce o) Uf (Teo) Uf (Teo) UfL96 814 3544 A-109589.17 a Af a Af a G f a U f a Af a ug U f c U f gCf u U f gs Cfs u 1365 AD-57012.1 A-116498.1 Cf (Aeo) Af (Geo) CfaGfaCfAfUfuUfaUfcUf (Teo) Uf ( Teo) UbL96 815 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1366 AD-57018.1 A-116500.1 Cf (Aeo) Af (Geo) CfaGfaCfAfUfuUf (Aeo) Uf (m5Ce 816 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcUfgCfuUfgsCfsu 1367 o) Uf (Teo) Uf (Teo) UbL96 AD-53815.1 CfuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 817 3601 aCfaAfaAfgCfaAfaacAfgGfuCfuAfgsAfsa 1368 AD-57928.40 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 818 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1369 AD-59182.5 CfsusAfgAfcCfuGfUfUfuugCfuuuuguL96 819 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1370 AD-59184.3 CfsusAfgAfcCfuGfuUfuugCfuuuuguL96 820 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1371 AD-59186.3 CfsusAfgAfcCfuGfUfuuugCfuuuuguL96 821 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1372 AD-59171.13 Cfs us AfgAfcCf u Gf u u u ugCf u u u ugu L96 822 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1373 AD-59176.7 CfsusAfgAfcCfuGfuuuugcuuuuguL96 823 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1374 AD-59170.7 CfsusagacCfuGfuuuugCfuuuuguL96 824 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1375 AD-59175.7 CfsusagacCfuGfuuuugcuuuuguL96 825 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1376 AD-59179.7 csusagacCfuGfuuuugcuuuuguL96 826 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1377 AD-59218.1 Cfs us AfgAfcCf u Gf u u u ugCf u u u ugu L96 827 3601 asCfsaAfaAfgCfaAfAfAfcAfgGfuCfuAfgsasa 1378 AD-59222.1 Cfs us AfgAfcCf u GfuuuugcuuuuguL96 828 3601 asCfsaAfaAfgCfaAfAfAfcAfgGfuCfuAfgsasa 1379 AD-59226.1 CfsusagacCfuGfuuuugCfuuuuguL96 829 3601 asCfsaAfaAfgCfaAfAfAfcAfgGfuCfuAfgsasa 1380 AD-59230.1 CfsusagacCfuGfuuuugcuuuuguL96 830 3601 asCfsaAfaAfgCfaAfAfAfcAfgGfuCfuAfgsasa 1381 AD-59235.1 csusagacCfuGfuuuugcuuuuguL96 831 3601 asCfsaAfaAfgCfaAfAfAfcAfgGfuCfuAfgsasa 1382 AD-59207.1 Cfs us AfgAfcCf u Gf u u u ugCf u u u ugu L96 832 3601 asCfsaAfAfAfgCfaAfaAfcAfgGfuCfuagsasa 1383 AD-59211.1 Cfs us AfgAfcCf u GfuuuugcuuuuguL96 833 3601 a s Cfs a Af Af Af gCf a AfaAfcAfgGfuCfuagsasa 1384 AD-59215.1 CfsusagacCfuGfuuuugCfuuuuguL96 834 3601 asCfsaAfAfAfgCfaAfaAfcAfgGfuCfuagsasa 1385

- 88 037110

AD-59219.1 CfsusagacCfuGfuuuugcuuuuguL96 835 3601 a s Cfs a Af Af Af gCf a AfaAfcAfgGfuCfuagsasa 1386 AD-59223.1 csusagacCfuGfuuuugcuuuuguL96 836 3601 a s Cfs a Af Af Af gCf a AfaAfcAfgGfuCfuagsasa 1387 AD-59181.5 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgsUfL96 837 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1388 AD-59172.5 Cfs us AfgAfcCf u Gf U f Uf u U fgCf u Uf u Ufsgs Uf L96 838 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1389 AD-59177.5 CfsusAfgAfcCfuGfUfUfuUfgCfsuUfsuUfsgsUfL9 6 839 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1390 AD-59180.5 CfsusAfgAfcCfuGfUfUfuUfgCfsuUfsuUfsgsUfsL 96 840 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1391 AD-59183.5 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfsgsUfsL96 841 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1392 AD-59185.5 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfsL96 842 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1393 AD-59173.5 CfsusAfgAfcCfuGfUfUfuugCfuuuugsuL96 843 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1394 AD-59232.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 844 3600 PasCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1395 AD-59236.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 845 3601 asCfsaAfaAfsgCfaAfaacAfgGfuCfsuAfgsasa 1396 AD-59216.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgsUfL96 846 3601 a s Cfs a Af a Af sgCf a Af a a c Af gG fuCfsuAfgsasa 1397 AD-59220.1 Cfs us AfgAfcCf u Gf U f Uf u U fgCfu Ufu Ufsgs UfL96 847 3601 asCfsaAfaAfsgCfaAfaacAfgGfuCfsuAfgsasa 1398 AD-59224.1 CfsusAfgAfcCfuGfUfUfuUfgCfsuUfsuUfsgsUfL9 6 848 3601 a s Cfs a Af a Af sgCf a Af a a c Af gG fuCfsuAfgsasa 1399 AD-59228.1 CfsusAfgAfcCfuGfUfUfuUfgCfsuUfsuUfsgsUfsL 96 849 3601 a s Cfs a Af a Af sgCf a Af a a c Af gG fuCfsuAfgsasa 1400 AD-59233.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfsgsUfsL96 850 3601 asCfsaAfaAfsgCfaAfaacAfgGfuCfsuAfgsasa 1401 AD-59237.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfsL96 851 3601 asCfsaAfaAfsgCfaAfaacAfgGfuCfsuAfgsasa 1402 AD-59209.1 CfsusAfgAfcCfuGfUfUfuugCfuuuugsuL96 852 3601 a s Cfs a Afa Af sgCf a Afa a c Af gG fuCfsuAfgsasa 1403 AD-59208.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 853 3601 asCfsaAfaAfsgCfaAfaacAfgGfuCfsusAfgsasa 1404 AD-59212.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 854 3600 PasCfsaAfaAfsgCfaAfaacAfgGfuCfsuAfgsas a 1405 AD-59210.1 csusAGAccuGuuuuGcuuuuGuL96 855 3601 AscsAAAAGcAAAAcAGGucuAGsasa 1406 AD-59214.1 AsGsAccuGuuuuGcuuuuGuL96 856 3603 AscsAAAAGcAAAAcAGGucusAsG 1407 AD-59227.1 CfsusAfGfAfccuGfuuuuGfcuuuuGfuL96 857 3601 asCfsAfAfAfAfGfcAfAfAfAfcAfGfGfucuAfGfs asa 1408 AD-59231.1 CfsusAfGfAfccuGfuuuuGfcuuuuGfuL96 858 3601 asCfsAfAfAfAfGfcAfAfaacAfGfGfucuAfGfsa sa 1409 AD-59198.3 (C3m) usAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 859 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1410 AD-59200.3 (C3m) (U3m) AfgAfcCfuGfUfUfuUfgCfuUfuUfgU fL96 860 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1411 AD-59203.3 (m5Cam) usAfgAfcCfuGfUfUfuUfgCfuUfuUfgUf L96 861 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1412 AD-59204.3 (m5Cam) (Tam) AfgAfcCfuGfUfUfuUfgCfuUfuUf gUfL96 862 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1413 AD-59188.3 (m5Cams) (Tams) AfgAfcCfuGfUfUfuUfgCfuUfu UfgUfL96 863 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1414 AD-59191.3 (m5Cams) usAfgAfcCfuGfUfUfuUfgCfuUfuUfgU fL96 864 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1415 AD-59213.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 865 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgs (A3m) a 1416 AD-59217.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 866 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAf (G3m) (A 3m) a 1417 AD-59221.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 867 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgs (Aam) a 1418 AD-59225.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 868 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAf (Gam) (A am) a 1419 AD-59229.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 869 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgs (Aams ) a 1420 AD-59234.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 870 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAf (Gams) (Aams) a 1421 AD-59238.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 871 3601 (A3 m) Cfs a Afa Af gCf a Afa a c Af gG f u Cf u Afgs as a 1422 AD-59241.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 872 3601 as (C3m) aAfa Af gCf a Afa a c Af gG fuCfuAfgsasa 1423

- 89 037110

AD-59245.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 873 3601 (Aa m) Cfs a Afa Af gCf a Afa a c Af gG f u Cf u Afgs as a 1424 AD-59250.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 874 3601 as (m5Cam) a Afa Af gCf a Afa a c Af gG f u Cf u Afgs asa 1425 AD-59246.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 875 3602 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfsgsa 1426 AD-59253.2 usAfsgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 876 3602 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfsgsa 1427 AD-59242.1 AfsgsAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 877 3602 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfsgsa 1428 AD-59253.1 usAfsgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 878 3602 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfsgsa 1429 AD-59258.1 usasgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 879 3602 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfsgsa 1430 AD-59251.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 880 3603 asCfsaAfaAfgCfaAfaacAfgGfuCfusAfsg 1431 AD-59256.1 usAfsgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 881 3604 asCfsaAfaAfgCfaAfaacAfgGfuCfsusAf 1432 AD-59260.1 AfsgsAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 882 3605 asCfsaAfaAfgCfaAfaacAfgGfusCfsu 1433 AD-59248.1 gs AfscCf u Gf U f Uf u UfgCf u U f u U fgU f L96 883 3605 asCfsaAfaAfgCfaAfaacAfgGfusCfsu 1434 AD-59247.1 gs AfscCf u Gf U fUfu UfgCf u U f u U fgU f L96 884 3604 asCfsaAfaAfgCfaAfaacAfgGfuCfsusa 1435 AD-59252.1 AfsgsAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 885 3604 a s Cfs a Afa Af gCf a Afa a c Af gGf u Cf s u sa 1436 AD-59257.1 usAfsgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 886 3604 a s Cfs a Afa Af gCf a Afa a c Af gGf u Cf s u sa 1437 AD-59261.1 AfsgsAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 887 3603 asCfsaAfaAfgCfaAfaacAfgGfuCfusasg 1438 AD-59262.1 usAfsgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 888 3603 a s Cfs a Afa Af gCf a Afa a c Af gGf u Cf u s a sg 1439 AD-59265.1 csusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 889 3603 asCfsaAfaAfgCfaAfaacAfgGfuCfusasg 1440 AD-59196.13 usAfsgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 890 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1441 AD-59189.11 AfsgsAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 891 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1442 AD-59190.3 usCfsuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 892 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1443 AD-59192.3 UfsusCfuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL9 6 893 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1444 AD-59240.1 Cfs us AfgAfcCf u Gf u u u ugCf u u u ugu L96 894 3601 a s Cfs a Af a Af sgCf a Af a a c Af gG f u Cf u Afgs (A3 m ) a 1445 AD-59244.1 Cfs us AfgAfcCf u Gf u u u ugCf u u u ugu L96 895 3601 a s Cfs a Af a Af sgCf a Af a a c Af gG f u Cf u Afgs as a 1446 AD-59202.7 (C3m) usagaccuguuuugcuuuuguL96 896 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1447 AD-59195.5 (C3m) usAfgAfcCfuGfuuuugCfuuuuguL96 897 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1448 AD-59249.1 Cfs us AfgAfcCf u Gf Uf Uf u ugCf u u u ugu L9 6 898 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgs (A3m) a 1449 AD-59254.1 Cfs us AfgAfcCf u Gf u u u ugCf u u u ugu L96 899 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgs (A3m) a 1450 AD-59259.1 (C3m) usAfgAfcCfuGfuuuugCfuuuuguL96 900 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgs (A3m) a 1451 AD-59264.1 (C3m) usagaccuguuuugcuuuuguL96 901 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgs (A3m) a 1452 AD-59264.2 (C3m) usagaccuguuuugcuuuuguL96 902 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgs (A3m) 1453 a AD-59255.1 CsusagaccuGfUfUfuugcuuuuguL96 903 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgs (A3m) a 1454 AD-57928.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 904 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1455 AD-58893.1 CfsuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 905 3601 asCfaAfaAfgCfaAfaacAfgGfuCfuAfgasa 1456 AD-58894.1 CfusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 906 3601 a Cfsa Afa AfgCfa Afa a cAfgGf u Cf u Afgsa a 1457 AD-58895.1 CfuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 907 3601 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1458 AD-58896.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 908 3601 a Cf a Af a AfgCfa Afa a c Af gG fuCfuAfgaa 1459 AD-58897.1 CfsusAfsgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 909 3601 asCfsasAfaAfgCfaAfaacAfgGfuCfuAfsgsasa 1460 AD-58898.1 CfsusAfsgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 910 3601 asCfsaAfaAfgCfsaAfaacAfsgGfuCfuAfsgsasa 1461 AD-58899.1 CfsusAfsgAfcCfuGfUfUfuUfgCfuUfuUfsgUfL96 911 3601 asCfsaAfaAfgCfsaAfaacAfsgGfuCfuAfsgsasa 1462 AD-58900.1 CfsasAfgCfaGfaCfAfUfuUfaUfcUfuUfuUfL96 912 NA asAfsaAfaGfaUfaAfaugUfcUfgCfuUfgscsu 1463 AD-58902.1 UfsusUfuCfuAfgAfCfCfuGfuUfuUfgCfuUfL96 913 3597 a sAf sgCf a Afa Af c Af gg u Cf u Afg Af a Af a sgs u 1464 (A3mx) (G3mx) AfcCfuGfUfUfuUfgCfuUfuUfgUfL 96 914 a s Cfs a Afa AfgCfa Afa a c Af gGf u Cf u s a sg 1465 (A3mx) (G3mx) AfcCfuGfUfUfuUfgCfuUfuUfgUfL 96 915 (A3 m x) Cf a Afa AfgCfa Afa a c AfgG f u Cf u s a sg 1466 (A3mx) (G3mx) AfcCfuGfUfUfuUfgCfuUfuUfgUfL 96 916 (A3mx) CfaAfaAfgCfaAfaacAfgGfuCfu (A3mx) g 1467

- 90 037110

(A3mx) gAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 917 a s Cfs a Afa Af gCf a Afa a c Af gGf u Cf u s a sg 1468 (A3mx) gAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 918 (A3mx) CfaAfaAfgCfaAfaacAfgGfuCfusasg 1469 (A3mx) gAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 919 (A3mx) CfaAfaAfgCfaAfaacAfgGfuCfu (A3mx) g 1470 (C3mx) (U3mx) AfgAfcCfuGfUfUfuUfgCfuUfuUfg UfL96 920 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1471 (C3mx) (U3mx) AfgAfcCfuGfUfUfuUfgCfuUfuUfg UfL96 921 (A3mx) CfaAfaAfgCfaAfaacAfgGfuCfuAf (G3 mx) (A3mx) a 1472 (C3mx) uAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 922 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1473 (C3mx) uAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 923 (A3mx) CfaAfaAfgCfaAfaacAfgGfuCfuAfgsas a 1474 (C3mx) uAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 924 (A3mx) CfaAfaAfgCfaAfaacAfgGfuCfuAfg (A3 mx) a 1475 (C3mx) uAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 925 (A3mx) CfaAfaAfgCfaAfaacAfgGfuCfuAf (G3 mx) (A3mx) a 1476 (C3mx) usAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 926 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1477 (Chd) susAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 927 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1478 (phe) CfsuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL9 6 928 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1479 (phe) CfuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 929 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1480 (pshe) CfsuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL9 6 930 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1481 (pshe) CfuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL9 6 931 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1482 AfsgsAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 932 (A3mx) CfaAfaAfgCfaAfaacAfgGfuCfusasg 1483 AfsgsAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 933 (A3mx) CfaAfaAfgCfaAfaacAfgGfuCfu (A3mx) g 1484 Cfs (Uhd) sAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL9 6 934 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1485 CfsusAfgAf (Chd) CfuGfUfUfuUfgCfuUfuUfgUfL9 6 935 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1486 CfsusAfgAfc (Chd) uGfUfUfuUfgCfuUfuUfgUfL96 936 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1487 CfsusAfgAfcCf (Uhd) GfUfUfuUfgCfuUfuUfgUfL9 6 937 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1488 CfsusAfgAfcCfuGfUfUf (Uhd) UfgCfuUfuUfgUfL9 6 938 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1489 CfsusAfgAfcCfuGfUfUfuUf (Ggn) CfuUfuUfgUfL9 6 939 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1490 CfsusAfgAfcCfuGfUfUfuUfg (Cgn) uUfuUfgUfL96 940 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1491 CfsusAfgAfcCfuGfUfUfuUfg (Chd) uUfuUfgUfL96 941 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1492 CfsusAfgAfcCfuGfUfUfuUfgCf (Tgn) UfuUfgUfL96 942 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1493 CfsusAfgAfcCfuGfUfUfuUfgCf (Uhd) UfuUfgUfL9 6 943 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1494 CfsusAfgAfcCfuGfUfUfuUfgCfu (Tgn) uUfgUfL96 944 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1495 CfsusAfgAfcCfuGfUfUfuUfgCfuUf (Tgn) UfgUfL96 945 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1496 Cfs us AfgAfcCf u Gf U f Uf u U fgCf u Uf (U hd) UfgUf L9 6 946 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1497 Cfs us AfgAfcCf u Gf U f Uf u U fgCf u Uf u (Tgn) gUfL96 947 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1498 CfsusAfgAfcCfuGfUfUfuUfgCfuUfu (Uhd) gUfL96 948 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1499 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUf (Ggn) UfL9 6 949 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1500 Cfs us AfgAfcCf u Gf U f Uf u U fgCf u Uf u Ufg (Tgn) L96 950 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1501 Cfs us AfgAfcCf u Gf U f Uf u U fgCf u Uf u Ufg (U hd) L96 951 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1502 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 952 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1503 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 953 (Agn) CfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1504 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 954 (Agn) CfaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1505 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 955 P (Agn) CfaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1506

- 91 037110

CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 956 as (Cgn) aAfa Af gCf a Afa a c Af gGf u Cf u Af gs a s a 1507 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 957 a s Cfs (Agn) Af a Af gCf a Afa a c Af gG f u Cf u Afgs a s a 1508 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 958 asCfsa (Agn) aAfgCfaAfaacAfgGfuCfuAfgsasa 1509 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 959 asCfsaAf (Agn) AfgCfaAfaacAfgGfuCfuAfgsas a 1510 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 960 asCfsaAfa (Agn) gCfaAfaacAfgGfuCfuAfgsasa 1511 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 961 asCfsaAfaAf (Ggn) CfaAfaacAfgGfuCfuAfgsas a 1512 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 962 a s Cfs a Afa Af g (Cg n) a Af a a c Af gG fuCfuAfgsasa 1513 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 963 asCfsaAfaAfgCf (Agn) AfaacAfgGfuCfuAfgsas a 1514 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 964 asCfsaAfaAfgCfa (Agn) aacAfgGfuCfuAfgsasa 1515 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 965 a s Cfs a Afa Af gCf a Af (Ag n) a c Af gG f u Cf u Afgs a s a 1516 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 966 a s Cfs a Afa Af gCf a Afa (Agn) c Af gG f u Cf u Afgs a s a 1517 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 967 asCfsaAfaAfgCfaAfaa (Cgn) AfgGfuCfuAfgsas a 1518 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 968 asCfsaAfaAfiCfaAfaacAfiGfuCfuAfisasa 1519 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 969 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfg (A3mx) a 1520 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 970 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgs (A3mx) a 1521 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 971 asCfsaAfaAfgCfaAfaacAfgGfuCfuAf (G3mx) (A 3mx) a 1522 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 972 (A3mx) CfaAfaAfgCfaAfaacAfgGfuCfuAfgsas a 1523 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 973 (A3mx) CfsaAfaAfgCfaAfaacAfgGfuCfuAfgsas a 1524 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 974 P (A3mx) CfaAfaAfgCfaAfaacAfgGfuCfuAfgsa sa 1525 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 975 a (C3mx) aAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1526 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 976 a s (C3 m x) a Af a Af gCf a Afa a c Af gG f u Cf u Afgs a s a 1527 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 977 (A3mx) (C3mx) aAfaAfgCfaAfaacAfgGfuCfuAf gsasa 1528 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 978 (A3mx) CfaAfaAfgCfaAfaacAfgGfuCfuAfg (A3 1529 mx) a CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 979 (A3mx) CfsaAfaAfgCfaAfaacAfgGfuCfuAfgs (A 3mx) a 1530 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 980 (A3mx) CfaAfaAfgCfaAfaacAfgGfuCfuAf (G3 mx) (A3mx) a 1531 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 981 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgasas (ph e) 1532 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 982 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgaas (phe) 1533 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 983 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgaa (phe) 1534 CfsusAfgAfcCf uGfUf Ufu UfgCf u Uf u UfgUfL96 984 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsas (phe) 1535 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 985 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgas (phe) 1536 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 986 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfga (phe) 1537 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 987 asCfsaAfaAfgCfaAfaacAfgGf (Uhd) CfuAfgsas a 1538 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 988 asCfsaAfaAfgCfaAfaacAfgGfuCf (Uhd) Afgsas a 1539 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 989 asCfsaAfaAfg (Chd) aAfaacAfgGfuCfuAfgsasa 1540

- 92 037110

CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 990 asCfsaAfaagCfaAfaa c Af gG f u c u Af gsa s a 1541 Cfs us AfgAfcCf u Gf U f Uf u U fgCf u Uf u Ufgu L96 991 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1542 Cfs us AfgAfcCf u Gf U f Uf u U fgCf u Uf u Ufgu L9 6 992 asCfsaAfaagCfaAfaacAfgGfucuAfgsasa 1543 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuugUfL96 993 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1544 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuugUfL96 994 asCfsaAfaagCfaAfaacAfgGfucuAfgsasa 1545 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuuguL96 995 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1546 Cfs us AfgAfcCf u Gf U f Uf u U fgCf u UfuuguL96 996 asCfsaAfaagCfaAfaa c Af gG f u c u Af gsa s a 1547 CfsusAfgAfcCfuGfUfUfuUfgcuuuugUfL96 997 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1548 CfsusAfgAfcCfuGfUfUfuUfgcuuuugUfL96 998 asCfsaAfaagCfaAfaa c Af gG f u c u Af gsa s a 1549 CfsusAfgAfcCfuGfUfUfuUfgcuuuuguL96 999 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1550 CfsusAfgAfcCfuGfUfUfuUfgcuuuuguL96 1000 asCfsaAfaagCfaAfaa c Af gG f u c u Af gsa s a 1551 CfsusAfgAfcCfuGfUfUfuUfgUfuUfuUfgUfL96 1001 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1552 CfsusAfgAfcCfuGfUfUfuUfiCfuUfuUfiUfL96 1002 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1553 CfsusAfgAfcCfuGfUfUfuUfiCfuUfuUfiUfL96 1003 asCfsaAfaAfiCfaAfaacAfgGfuCfuAfgsasa 1554 CfsusAfgAfcCfuGfUfUfuUfiCfuUfuUfiUfL96 1004 asCfsaAfaAfiCfaAfaacAfiGfuCfuAfisasa 1555 CfsusAfiAfcCfuGfUfUfuUfiCfuUfuUfiUfL96 1005 asCfsaAfaAfiCfaAfaacAfiGfuCfuAfisasa 1556

Example 2. Testing in vitro and in vivo.

A subset of these duplexes were evaluated for efficacy in assays with free uptake of a single dose by hepatocytes of cynomolgus monkeys. Briefly, primary hepatocytes of cynomolgus monkeys (PCH) were treated with conjugated modified siRNA duplexes at three concentrations, 500, 100 and 10 nM. Free uptake assays at concentrations of 100 and 10 nM were performed in duplicate and data were presented as the remaining mean amount of transcript relative to control ± standard deviation (SD). The 500 nM test was performed once. Table 3 shows the results of these analyzes.

Table 3. Test for efficacy against PCSK9 by free uptake by primary hepatocytes of cynomolgus monkeys

Duplex ID PCH, 500 nM PCH, 100 nM, average. PCH, 10 nM, average PCH, 100 nM, SD PCH, 10 nM, SD AD-48399 1.08 1.03 0.98 0.09 0.02 AD-48399 0.97 0.95 1.10 0.03 0.09 AD-48399 0.89 0.98 1.02 0.06 0.06 AD-48399 1.04 1.00 1.01 0.02 0.08 AD-48399 0.92 1.03 0.96 0.02 0.09 AD-48399 1.13 1.03 0.96 0.05 0.01 AD-48400 0.48 0.63 0.90 0.04 0.00 AD-48400.4 0.65 0.78 0.89 0.14 0.13 AD-53649.1 0.96 0.96 1.14 0.02 0.07 AD-53650.1 0.97 0.92 1.15 0.01 0.06 AD-53651.1 1.02 0.98 1.15 0.13 0.10 AD-53652.1 0.83 0.89 1.14 0.20 0.05 AD-53653.1 0.85 0.95 1.26 0.04 0.07 AD-53654.1 0.84 0.93 1.19 0.02 0.13 AD-53656.1 0.92 0.92 1.07 0.05 0.03 AD-53657.1 0.92 0.89 1.02 0.05 0.03 AD-53658.1 0.89 0.83 0.97 0.04 0.14 AD-53659.1 0.79 0.82 1.05 0.06 0.13 AD-53660.1 0.89 0.86 0.98 0.07 0.07 AD-53661.1 0.92 1.03 1.07 0.02 0.04 AD-53663.1 0.88 0.90 1.08 0.03 0.02

- 93 037110

AD-53664.1 0.95 0.86 1.00 0.09 0.13 AD-53665.1 0.92 0.91 1.05 0.01 0.13 AD-53666.1 0.73 0.80 0.95 0.08 0.02 AD-53667.1 0.95 0.96 1.12 0.06 0.03 AD-53668.1 1.03 0.89 1.17 0.03 0.12 AD-53669.1 1.12 0.90 1.05 0.01 0.15 AD-53670.1 0.85 0.88 1.00 0.06 0.06 AD-53671.1 0.87 0.90 0.93 0.02 0.04 AD-53672.1 0.87 0.86 0.95 0.04 0.16 AD-53674.1 0.69 0.75 0.92 0.08 0.02 AD-53675.1 0.99 0.92 1.17 0.11 0.06 AD-53676.1 0.90 0.87 1.10 0.03 0.08 AD-53677.1 1.22 0.86 1.12 0.10 0.04 AD-53678.1 1.01 0.98 1.03 0.03 0.12 AD-53679.1 0.96 0.85 1.02 0.04 0.11 AD-53680.1 1.21 0.94 0.99 0.03 0.01 AD-53681.1 1.02 0.94 1.01 0.01 0.11 AD-53682.1 0.98 0.90 1.01 0.06 0.11 AD-53683.1 0.95 0.90 1.01 0.02 0.08 AD-53684.1 1.14 1.01 1.01 0.09 0.07 AD-53685.1 0.96 0.92 1.03 0.00 0.07 AD-53687.1 1.31 0.91 1.02 0.02 0.11 AD-53688.1 0.90 0.95 0.96 0.03 0.03 AD-53689.1 0.97 0.95 1.05 0.04 0.07 AD-53690.1 0.82 0.97 0.99 0.13 0.08 AD-53691.1 0.99 1.01 0.97 0.01 0.12 AD-53692.1 1.11 0.91 1.00 0.04 0.03 AD-53693.1 1.02 0.96 1.02 0.04 0.10 AD-53694.1 1.12 0.98 0.97 0.07 0.06 AD-53695.1 0.97 1.04 0.94 0.11 0.08 AD-53696.1 0.85 0.91 1.23 0.10 0.01 AD-53697.1 0.89 0.91 1.06 0.03 0.00 AD-53698.1 0.90 0.86 1.15 0.06 0.01 AD-53699.1 0.84 0.85 1.07 0.00 0.03 AD-53700.1 0.93 1.02 1.21 0.02 0.15

- 94 037110

AD-53701.1 1.01 0.96 1.12 0.00 0.17 AD-53702.1 0.95 0.94 1.06 0.05 0.15 AD-53703.1 0.82 0.85 1.04 0.07 0.13 AD-53704.1 0.92 0.97 0.94 0.04 0.02 AD-53705.1 0.96 0.98 1.00 0.11 0.15 AD-53706.1 0.90 0.97 1.03 0.01 0.20 AD-53707.1 0.86 0.98 1.11 0.14 0.24 AD-53708.1 1.10 0.94 1.05 0.02 0.15 AD-53709.1 0.79 0.84 1.08 0.01 0.18 AD-53710.1 1.03 0.91 1.06 0.01 0.09 AD-53711.1 0.90 0.90 0.99 0.00 0.28 AD-53712.1 0.97 0.92 0.97 0.00 0.12 AD-53713.1 0.98 0.93 1.07 0.01 0.16 AD-53714.1 1.09 0.86 0.99 0.03 0.09 AD-53715.1 1.04 0.83 0.94 0.06 0.06 AD-53716.1 0.82 0.85 1.02 0.05 0.14 AD-53717.1 0.98 0.94 0.98 0.11 0.12 AD-53718.1 0.89 1.04 1.01 0.18 0.01 AD-53719.1 0.98 1.05 1.05 0.06 0.17 AD-53720.1 1.02 0.88 1.08 0.01 0.15 AD-53721.1 0.88 0.95 1.03 0.07 0.11 AD-53722.1 0.98 0.95 1.01 0.06 0.12 AD-53723.1 0.89 0.89 1.02 0.10 0.06 AD-53724.1 0.98 0.93 1.00 0.13 0.01 AD-53725.1 1.04 1.05 1.09 0.19 0.11 AD-53726.1 0.87 0.88 0.88 0.00 0.02 AD-53727.1 0.82 0.92 1.02 0.05 0.13 AD-53728.1 0.86 0.93 1.06 0.03 0.08 AD-53729.1 0.86 0.81 1.02 0.12 0.03 AD-53730.1 1.01 0.95 1.02 0.07 0.01 AD-53731.1 0.99 0.98 1.00 0.08 0.07 AD-53732.1 0.93 0.86 1.01 0.12 0.11 AD-53733.1 1.06 1.02 1.08 0.05 0.06 AD-53734.1 0.95 0.93 1.04 0.12 0.05 AD-53735.1 1.00 0.93 1.01 0.02 0.06

- 95 037110

AD-53736.1 0.90 1.09 1.16 0.05 0.01 AD-53737.1 0.94 0.93 1.00 0.02 0.09 AD-53738.1 0.93 0.79 0.93 0.03 0.01 AD-53739.1 1.11 0.90 0.90 0.05 0.00 AD-53740.1 0.86 0.92 0.97 0.08 0.01 AD-53741.1 0.96 0.84 0.92 0.00 0.07 AD-53742.1 1.03 0.93 1.03 0.04 0.06 AD-53743.1 0.92 0.98 1.05 0.08 0.14 AD-53744.1 0.95 1.02 1.03 0.08 0.12 AD-53745.1 0.81 0.99 1.11 0.10 0.18 AD-53746.1 0.65 0.83 1.04 0.07 0.16 AD-53747.1 0.82 0.88 1.02 0.05 0.13 AD-53748.1 0.46 0.59 0.72 0.06 0.07 AD-53749.1 0.93 0.90 1.04 0.12 0.16 AD-53750.1 0.90 1.02 0.97 0.02 0.10 AD-53751.1 0.92 0.87 1.02 0.19 0.16 AD-53752.1 0.73 0.88 0.99 0.06 0.18 AD-53753.1 0.87 0.97 1.06 0.07 0.19 AD-53754.1 0.43 0.58 0.72 0.10 0.05 AD-53755.1 1.01 0.99 1.03 0.03 0.02 AD-53757.1 0.98 0.91 1.07 0.05 0.13 AD-53758.1 0.63 0.73 0.92 0.05 0.00 AD-53759.1 0.91 0.92 0.99 0.02 0.08 AD-53760.1 0.51 0.67 0.80 0.03 0.12 AD-53761.1 0.89 1.07 1.10 0.11 0.18 AD-53762.1 1.06 1.00 0.96 0.12 0.10 AD-53763.1 0.95 1.10 1.00 0.07 0.09 AD-53764.1 0.99 0.94 0.99 0.05 0.16 AD-53765.1 0.92 0.87 0.86 0.09 0.11 AD-53766.1 0.75 0.78 0.86 0.09 0.14 AD-53767.1 1.01 1.02 0.97 0.05 0.18 AD-53768.1 0.89 1.07 0.97 0.09 0.15 AD-53769.1 0.89 1.11 0.95 0.05 0.11 AD-53770.1 0.76 1.01 0.98 0.01 0.12 AD-53771.1 0.70 0.74 0.84 0.06 0.12

- 96 037110

AD-53772.1 0.72 0.83 0.85 0.04 0.11 AD-53773.1 0.96 1.00 0.98 0.05 0.07 AD-53774.1 0.75 0.92 1.01 0.06 0.14 AD-53776.1 0.78 0.94 0.97 0.11 0.08 AD-53777.1 0.67 0.68 0.74 0.11 0.01 AD-53778.1 0.74 0.73 0.92 0.13 0.14 AD-53779.1 1.00 0.98 0.95 0.14 0.04 AD-53780.1 0.90 0.92 0.98 0.12 0.05 AD-53781.1 0.84 0.95 1.00 0.17 0.06 AD-53782.1 0.87 0.92 0.90 0.11 0.02 AD-53783.1 0.71 0.79 0.78 0.14 0.03 AD-53784.1 0.68 0.82 0.86 0.10 0.10 AD-53785.1 1.10 0.96 0.96 0.09 0.07 AD-53786.1 0.98 0.89 0.95 0.20 0.14 AD-53787.1 1.23 0.93 1.00 0.11 0.21 AD-53788.1 0.95 0.90 0.94 0.17 0.08 AD-53789.1 0.55 0.60 0.78 0.09 0.08 AD-53790.1 0.70 0.91 1.04 0.08 0.16 AD-53791.1 0.47 0.67 0.92 0.12 0.09 AD-53792.1 0.52 0.75 0.89 0.06 0.04 AD-53793.1 0.88 1.03 1.07 0.20 0.09 AD-53794.1 0.85 1.00 1.09 0.17 0.22 AD-53795.1 0.58 0.71 1.00 0.10 0.12 AD-53796.1 0.62 0.78 0.96 0.07 0.12 AD-53797.1 0.72 0.78 0.93 0.12 0.10 AD-53798.1 0.50 0.55 0.76 0.08 0.03 AD-53799.1 0.98 0.92 1.10 0.11 0.21 AD-53800.1 0.59 0.65 0.87 0.15 0.14 AD-53801.1 0.81 0.84 1.05 0.14 0.18 AD-53802.1 0.68 0.79 1.03 0.13 0.13 AD-53803.1 0.51 0.53 0.77 0.09 0.05 AD-53804.1 0.94 0.86 1.05 0.15 0.15 AD-53805.1 0.95 0.93 1.03 0.12 0.19 AD-53806.1 0.38 0.45 0.78 0.05 0.12 AD-53807.1 0.85 0.95 1.15 0.09 0.24

- 97 037110

AD-53808.1 0.81 0.85 0.93 0.08 0.11 AD-53809.1 0.50 0.62 0.77 0.00 0.12 AD-53810.1 0.84 0.82 0.98 0.16 0.22 AD-53811.1 0.94 0.95 1.00 0.10 0.11 AD-53812.1 0.61 0.76 0.97 0.14 0.22 AD-53813.1 0.67 0.76 0.94 0.01 0.15 AD-53814.1 0.58 0.67 0.84 0.11 0.19 AD-53815.1 0.49 0.50 0.72 0.09 0.17 AD-53816.1 0.82 0.91 0.93 0.08 0.10 AD-53817.1 0.92 0.94 1.07 0.13 0.36 AD-53818.1 0.83 0.99 0.99 0.07 0.41 AD-53819.1 0.61 0.75 0.88 0.24 0.16 AD-53820.1 0.71 0.81 0.92 0.17 0.04 AD-53821.1 0.56 0.54 0.68 0.13 0.05 AD-53822.1 1.24 0.88 1.05 0.12 0.17 AD-53823.1 1.03 0.86 0.99 0.11 0.18 AD-53824.1 0.76 0.73 0.93 0.16 0.11 AD-53825.1 0.57 0.63 0.82 0.18 0.04 AD-53826.1 0.54 0.51 0.78 0.08 0.07 AD-53827.1 0.99 0.91 1.05 0.12 0.08 AD-53828.1 0.69 0.77 0.87 0.09 0.16 AD-53829.1 0.72 0.91 0.95 0.11 0.16 AD-53830.1 0.48 0.73 0.76 0.11 0.01 AD-53831.1 0.97 0.92 1.00 0.22 0.25 AD-53832.1 0.68 0.63 0.81 0.15 0.02 AD-53833.1 0.92 0.90 0.84 0.20 0.03 AD-53834.1 1.15 0.93 0.86 0.16 0.02 AD-53835.1 0.88 0.79 0.81 0.18 0.03 PBS 0.90 1.02 0.99 0.04 0.15

Modified and conjugated siRNA duplexes to PCSK9 were also evaluated for efficacy using transfection assays on three human cell lines. siRNA to PCSK9 was transfected into three different cell lines, HeLa, Hep3B and HepG2, at two doses, 10 and 0.1 nM. The results of these analyzes are shown in table. 4, and data are expressed as a fraction of the remaining amount of transcript relative to the control.

FIG. 1 shows that there is a general reproducibility of duplex silencing activity for PCSK9 between free uptake assays and transfection assays.

IC ₅₀ values for selected duplexes upon free uptake by cynomolgus cells and upon transfection of Hep3B cells are shown in Table 1. five.

- 98 037110

Table 4. Test for efficacy against PCSK9 by transfection of human cell lines

Duplex ID Hela, 10 nM Hela, 0.1 nM NEPH, 10 nM Nep3, 0.1 nM HepG2, 10 nM HepG2, 0.1 nM AD-48399 0.94 0.90 1.18 1.03 1.34 1.05 AD-48399 0.90 1.03 0.87 0.88 0.84 0.91 AD-48399 0.88 1.14 0.90 0.99 0.92 1.04 AD-48399 1.22 0.97 0.95 0.98 0.81 0.92 AD-48399 1.04 0.81 1.01 1.10 1.03 1.09 AD-48399 1.06 1.20 1.14 1.04 1.16 1.01 AD-48400 0.05 0.63 0.10 0.51 0.17 0.69 AD-48400.4 0.06 0.28 0.14 0.31 0.13 0.32 AD-53649.1 0.84 1.05 1.07 0.94 0.97 1.11 AD-53650.1 0.16 0.87 0.41 0.87 0.52 1.12 AD-53651.1 0.47 0.86 0.49 0.92 0.71 1.08 AD-53652.1 0.34 0.93 0.50 0.96 0.40 1.21 AD-53653.1 0.36 0.99 0.43 1.01 0.52 1.13 AD-53654.1 0.85 1.06 0.99 0.92 0.95 1.06 AD-53656.1 0.46 0.92 0.78 0.98 0.80 0.74 AD-53657.1 0.71 0.97 0.75 1.01 0.81 0.94 AD-53658.1 0.32 0.97 0.50 0.91 0.58 1.05 AD-53659.1 0.11 0.86 0.24 0.93 0.22 0.94 AD-53660.1 0.35 1.12 0.43 0.99 0.44 1.31 AD-53661.1 0.94 1.07 0.85 0.95 0.88 0.92 AD-53663.1 0.82 1.03 0.74 1.06 1.04 1.04 AD-53664.1 0.60 0.94 0.61 1.06 0.85 1.28 AD-53665.1 0.33 1.00 0.55 1.01 0.45 1.12

- 99 037110

AD-53666.1 0.09 0.98 0.22 0.97 0.21 1.08 AD-53667.1 0.94 1.07 0.95 0.96 0.95 1.02 AD-53668.1 0.27 0.88 0.36 1.07 0.35 1.13 AD-53669.1 0.81 1.02 0.93 1.08 1.35 1.24 AD-53670.1 0.55 0.94 0.52 0.48 0.45 1.13 AD-53671.1 0.68 1.07 0.78 1.02 0.82 1.27 AD-53672.1 0.22 1.04 0.38 1.06 0.34 1.15 AD-53674.1 0.08 0.67 0.15 0.85 0.15 0.80 AD-53675.1 0.25 1.04 0.43 0.95 0.38 1.04 AD-53676.1 0.81 0.94 0.90 1.14 0.98 1.06 AD-53677.1 0.45 0.90 0.70 0.98 0.70 1.14 AD-53678.1 0.41 1.02 0.72 1.04 0.70 1.15 AD-53679.1 0.44 0.93 0.58 0.88 0.50 0.95 AD-53680.1 0.36 0.99 0.55 0.98 0.52 0.96 AD-53681.1 0.33 0.93 0.57 1.12 0.54 1.11 AD-53682.1 0.84 0.94 0.85 1.06 0.93 1.13 AD-53683.1 0.65 0.78 0.95 1.05 0.73 1.06 AD-53684.1 0.57 0.98 0.79 0.92 0.62 1.08 AD-53685.1 0.85 0.90 0.94 0.95 0.69 0.98 AD-53687.1 0.15 0.83 0.39 1.09 0.34 1.23 AD-53688.1 0.45 0.89 0.72 1.01 0.57 1.19 AD-53689.1 0.56 0.93 1.04 1.14 0.59 1.24 AD-53690.1 0.45 0.79 0.53 1.26 0.41 1.22 AD-53691.1 0.82 1.03 0.91 1.22 0.57 1.05 AD-53692.1 0.68 0.81 0.81 0.89 0.82 1.05 AD-53693.1 0.61 0.92 0.85 0.81 0.53 1.03 AD-53694.1 0.59 0.87 0.58 1.01 0.53 0.82 AD-53695.1 0.91 0.78 1.02 1.23 1.14 1.11 AD-53696.1 0.57 0.98 0.82 1.01 0.68 1.05 AD-53697.1 0.31 1.04 0.40 0.95 0.24 0.90 AD-53698.1 0.17 0.97 0.31 0.92 0.32 0.84 AD-53699.1 0.29 1.00 0.47 0.90 0.47 1.23 AD-53700.1 0.81 1.07 0.94 0.99 0.97 1.08 AD-53701.1 0.89 1.07 0.96 0.84 0.65 0.93 AD-53702.1 0.45 1.03 0.84 1.08 0.72 0.99

- 100 037110

AD-53703.1 0.18 0.79 0.28 0.97 0.29 0.90 AD-53704.1 0.77 0.80 0.88 1.06 0.91 0.95 AD-53705.1 0.63 0.89 0.81 1.06 0.76 0.97 AD-53706.1 0.39 0.82 0.41 1.00 0.48 0.88 AD-53707.1 0.42 0.97 0.60 0.83 0.54 0.80 AD-53708.1 0.49 0.95 0.82 0.96 1.07 1.09 AD-53709.1 0.19 0.90 0.43 0.85 0.38 1.05 AD-53710.1 0.66 1.00 0.82 0.85 0.69 1.08 AD-53711.1 0.40 0.90 0.45 0.95 0.23 1.03 AD-53712.1 0.47 0.99 0.51 0.94 0.62 0.97 AD-53713.1 0.52 1.05 0.69 0.83 0.79 0.94 AD-53714.1 0.43 1.01 0.71 1.11 0.75 1.12 AD-53715.1 0.23 0.99 0.58 1.24 0.58 1.09 AD-53716.1 0.39 1.00 0.52 0.98 0.51 0.80 AD-53717.1 0.20 0.84 0.33 1.02 0.41 1.09 AD-53718.1 0.35 1.08 0.33 1.02 0.45 0.97 AD-53719.1 0.58 0.96 0.74 0.84 0.79 1.01 AD-53720.1 0.31 1.00 0.55 1.09 0.48 1.24 AD-53721.1 0.26 1.02 0.62 0.92 0.49 0.94 AD-53722.1 0.50 0.99 0.86 0.99 0.87 1.26 AD-53723.1 0.28 0.86 0.37 0.92 0.54 1.11 AD-53724.1 0.18 1.11 0.20 0.98 0.36 1.05 AD-53725.1 0.47 1.00 0.63 0.95 0.60 1.04 AD-53726.1 0.19 1.01 0.42 0.96 0.41 1.21 AD-53727.1 0.55 0.82 0.77 1.08 0.68 1.35 AD-53728.1 0.44 0.92 0.65 1.11 0.68 1.44 AD-53729.1 0.11 0.92 0.25 0.94 0.11 1.01 AD-53730.1 0.31 0.91 0.51 1.05 0.59 1.34 AD-53731.1 0.26 0.63 0.42 0.95 0.44 1.07 AD-53732.1 0.17 0.87 0.29 0.99 0.36 0.98 AD-53733.1 1.06 0.72 1.21 1.14 1.07 1.28 AD-53734.1 0.79 0.92 0.93 0.98 0.90 1.33 AD-53735.1 0.54 0.87 0.83 1.12 0.66 1.24 AD-53736.1 0.40 0.69 0.76 1.09 0.76 1.11 AD-53737.1 0.29 0.82 0.41 1.04 0.39 0.96

- 101 037110

AD-53738.1 0.19 0.70 0.24 1.09 0.28 1.10 AD-53739.1 0.91 0.94 0.72 1.07 0.78 1.09 AD-53740.1 0.17 1.06 0.42 1.07 0.32 1.05 AD-53741.1 0.17 0.91 0.32 0.99 0.41 1.05 AD-53742.1 0.55 1.07 0.69 0.97 0.72 1.08 AD-53743.1 0.71 0.99 0.75 0.76 0.58 1.08 AD-53744.1 0.13 0.86 0.50 0.69 0.36 0.87 AD-53745.1 0.46 0.91 0.78 0.72 0.87 0.94 AD-53746.1 0.13 0.82 0.23 0.50 0.28 0.90 AD-53747.1 0.29 1.08 0.54 0.77 0.50 1.07 AD-53748.1 0.04 0.22 0.12 0.21 0.20 0.32 AD-53749.1 0.56 0.76 0.48 0.81 0.53 0.85 AD-53750.1 0.61 0.75 0.69 0.81 0.81 1.07 AD-53751.1 0.25 0.69 0.37 0.72 0.26 0.77 AD-53752.1 0.11 0.43 0.13 0.40 0.16 0.61 AD-53753.1 0.70 0.76 0.75 0.92 0.63 1.09 AD-53754.1 0.06 0.31 0.10 0.34 0.12 0.40 AD-53755.1 0.46 0.91 0.66 0.84 0.56 0.79 AD-53757.1 0.61 0.90 0.50 0.89 0.44 0.91 AD-53758.1 0.11 0.31 0.11 0.29 0.11 0.60 AD-53759.1 0.61 0.87 0.57 0.84 0.56 0.98 AD-53760.1 0.05 0.36 0.14 0.42 0.12 0.53 AD-53761.1 0.95 0.99 0.76 0.72 0.55 0.61 AD-53762.1 0.58 1.18 0.74 0.88 0.69 0.88 AD-53763.1 0.16 0.86 0.19 0.64 0.21 0.75 AD-53764.1 0.70 0.91 0.54 0.85 0.59 0.94 AD-53765.1 0.16 0.63 0.38 0.64 0.30 0.87 AD-53766.1 0.09 0.72 0.16 0.67 0.18 0.63 AD-53767.1 0.30 1.14 0.69 0.83 0.71 0.83 AD-53768.1 0.50 0.98 0.75 0.98 0.52 1.06 AD-53769.1 0.36 1.07 0.26 0.62 0.39 0.83 AD-53770.1 0.27 1.08 0.45 1.00 0.44 1.25 AD-53771.1 0.18 0.62 0.19 0.44 0.21 0.65 AD-53772.1 0.12 0.75 0.30 0.66 0.18 0.85 AD-53773.1 0.39 0.98 0.60 0.84 0.19 1.00

- 102 037110

AD-53774.1 0.07 0.54 0.25 0.40 0.20 0.71 AD-53776.1 0.33 0.97 0.45 0.94 0.34 0.95 AD-53777.1 0.06 0.39 0.18 0.30 0.11 0.41 AD-53778.1 0.09 0.72 0.24 0.69 0.23 0.78 AD-53779.1 0.47 0.66 0.68 0.67 0.57 0.81 AD-53780.1 0.29 0.93 0.61 0.71 0.42 0.92 AD-53781.1 0.41 0.99 0.38 0.87 0.28 1.09 AD-53782.1 0.56 0.47 0.56 0.89 0.41 1.16 AD-53783.1 0.16 0.68 0.32 0.46 0.34 0.61 AD-53784.1 0.15 0.71 0.27 0.72 0.25 0.80 AD-53785.1 0.17 0.90 0.57 0.71 0.29 0.64 AD-53786.1 0.11 0.78 0.28 0.48 0.24 0.74 AD-53787.1 0.34 0.72 0.56 1.04 0.46 0.81 AD-53788.1 0.36 0.83 0.46 0.95 0.32 0.65 AD-53789.1 0.09 0.43 0.18 0.42 0.12 0.47 AD-53790.1 0.10 0.74 0.30 0.65 0.31 0.81 AD-53791.1 0.07 0.51 0.20 0.30 0.16 0.58 AD-53792.1 0.05 0.40 0.11 0.30 0.17 0.64 AD-53793.1 0.23 1.19 0.42 0.84 0.45 1.12 AD-53794.1 0.43 1.15 0.65 0.67 0.42 0.95 AD-53795.1 0.08 0.37 0.15 0.34 0.12 0.48 AD-53796.1 0.07 0.33 0.19 0.49 0.15 0.58 AD-53797.1 0.10 0.43 0.16 0.39 0.20 0.62 AD-53798.1 0.04 0.31 0.09 0.29 0.16 0.60 AD-53799.1 0.22 0.71 0.30 0.85 0.27 0.85 AD-53800.1 0.09 0.34 0.16 0.35 0.14 0.51 AD-53801.1 0.09 0.28 0.25 0.55 0.20 0.54 AD-53802.1 0.10 0.31 0.20 0.40 0.15 0.72 AD-53803.1 0.07 0.27 0.08 0.21 0.14 0.29 AD-53804.1 0.18 0.57 0.29 0.47 0.27 0.79 AD-53805.1 0.69 0.85 0.68 0.85 0.48 1.01 AD-53806.1 0.07 0.38 0.18 0.43 0.13 0.50 AD-53807.1 0.29 0.61 0.26 0.71 0.28 0.68 AD-53808.1 0.15 0.68 0.26 0.50 0.28 0.72 AD-53809.1 0.04 0.23 0.17 0.22 0.12 0.31

- 103 037110

AD-53810.1 0.31 0.88 0.30 0.55 0.36 0.85 AD-53811.1 0.28 0.77 0.33 0.57 0.39 0.87 AD-53812.1 0.12 0.69 0.16 0.62 0.22 0.79 AD-53813.1 0.11 0.33 0.18 0.26 0.17 0.40 AD-53814.1 0.12 0.59 0.57 0.60 0.29 0.57 AD-53815.1 0.03 0.27 0.11 0.18 0.18 0.33 AD-53816.1 0.16 0.89 0.24 0.62 0.32 0.75 AD-53817.1 0.26 0.98 0.44 0.69 0.44 1.18 AD-53818.1 0.12 0.71 0.21 0.55 0.21 0.70 AD-53819.1 0.09 0.52 0.12 0.45 0.12 0.46 AD-53820.1 0.20 0.96 0.27 0.67 0.34 0.74 AD-53821.1 0.04 0.29 0.10 0.23 0.13 0.29 AD-53822.1 0.54 1.05 0.60 0.91 0.48 0.96 AD-53823.1 0.21 0.76 0.41 0.59 0.33 0.85 AD-53824.1 0.16 0.78 0.40 0.51 0.36 0.70 AD-53825.1 0.05 0.40 0.12 0.31 0.24 0.73 AD-53826.1 0.04 0.34 0.10 0.21 0.20 0.34 AD-53827.1 0.40 1.11 0.40 0.84 0.31 1.15 AD-53828.1 0.17 0.51 0.23 0.55 0.17 1.14 AD-53829.1 0.06 0.71 0.21 0.58 0.24 1.21 AD-53830.1 0.07 0.27 0.06 0.30 0.15 0.43 AD-53831.1 0.09 0.56 0.21 0.39 0.16 0.95 AD-53832.1 0.08 0.52 0.26 0.31 0.11 0.76 AD-53833.1 1.04 1.05 0.74 1.24 0.60 1.58 AD-53834.1 0.70 1.14 0.71 0.85 0.38 1.47 AD-53835.1 0.11 0.43 0.33 0.35 0.09 0.53 PBS 0.67 1.13 0.90 0.90 0.99 0.99

Table 5. IC ₅₀ values for PCSK9 for selected duplexes upon free uptake by cynomolgus cells and upon transfection in human Hep3B cell line

Transfection Free absorption Duplex IC50, nM IC50, n Μ AD-53806.1 0.07 18.00 AD-53748.1 0.06 16.88 AD-53815.1 0.05 39.21 AD-53809.1 0.05 571.00 AD-53821.1 0.05 55.41 AD-53830.1 0.08 undefined AD-53754.1 0.25 67.42 AD-53800.1 0.30 undefined AD-53798.1 0.04 undefined AD-53789.1 0.37 undefined AD-48400.4 0.23 undefined

AD-48400 was also evaluated for in vivo efficacy in female mice carrying a human PCSK9 transgene randomly inserted into the genome without disrupting the endogenous PCSK9 gene. Briefly, mice were injected subcutaneously with a single dose of 20 mg / kg on day 0, a single dose of 100 mg / kg on day 0.

- 104 037110 and five doses of 20 mg / kg on days 0, 1, 2, 3, 4 and 5. Serum was collected at -6, -3, 0, 1, 2, 3, 4 and 7 days and the amount of PCSK9 protein was determined by ELISA assay. The results of these analyzes are shown in FIG. 2, and they show that for AD-48400 conjugated with GalNAc, at all three studied doses, there is a dose-dependent effect.

The six most potent duplexes, as determined by the in vitro assays described above, were evaluated for efficacy and duration of in vivo response. PCSK9 transgenic mice were injected on days 0, 1, 2, 3 and 4 with either 5 mg / kg or 25 mg / kg AD-48400, AD-53830, AD53806, AD-53815, AD-53748 or AD-53798. Serum PCSK9 protein levels were determined by ELISA at -3, 0, 1, 2, 3, 4, 8, 11, 15, 18, 22, 26, 31 and 36 days. The results are shown in FIG. 3A and 3B.

Example 3. Optimization of the prototype.

Based on the efficacy assays described in Example 2 above, the anti-PCSK9 siRNAs based on the parental sequences AD-53815 and AD-53806, with a number of chemical modifications, were evaluated for efficacy in assays with free uptake by primary hepatocytes of cynomolgus monkeys (PCS) at 200, 20, 2 and 0.2 nM. For all doses except the 0.2 nM dose, analyzes were performed in duplicate and data were expressed as the average fraction of the remaining transcript relative to the control. The 0.2 nM dose was assessed once. The results of these analyzes are shown in table. 6.

Table 6. Efficacy tests for optimization of prototype AD-53815 and AD-53806 by free uptake by hepatocytes of cynomolgus monkeys

Original duplex Duplex ID 200 nm, average 20 nM, average. 2 nM, average 0.2 nM-384 200 nM, SD 20 nM, SD 2 nM, SD AD-53815 AD-53815.5 0.45 0.48 0.74 0.95 0.05 0.00 0.05 AD-53815 AD-53815.4 0.43 0.54 0.84 0.83 0.00 0.04 0.10 AD-53815 AD-56633.1 0.33 0.52 0.82 0.88 0.04 0.01 0.10 AD-53815 AD-56617.1 0.40 0.65 0.91 1.06 0.03 0.02 0.03 AD-53815 AD-56623.1 0.52 0.61 0.87 1.05 0.03 0.04 0.21 AD-53815 AD-56629.1 0.50 0.62 0.87 1.05 0.04 0.13 0.17 AD-53815 AD-56635.1 0.45 0.71 0.92 1.03 0.03 0.02 0.03 AD-53815 AD-56641.1 0.47 0.73 0.84 1.04 0.04 0.00 0.17 AD-53815 AD-56625.1 0.49 0.55 0.82 1.12 0.01 0.16 0.16 AD-53815 AD-56631.1 0.48 0.57 0.82 1.05 0.04 0.11 0.06 AD-53815 AD-56637.1 0.48 0.58 0.76 1.01 0.01 0.14 0.13 AD-53815 AD-56643.1 0.59 0.77 0.93 1.04 0.05 0.01 0.04 AD-53815 AD-56649.1 0.76 0.87 0.95 1.06 0.02 0.07 0.14 AD-53815 AD-56655.1 0.73 0.86 0.85 0.96 0.01 0.04 0.11 AD-53815 AD-56615.1 0.58 0.70 0.92 0.98 0.00 0.02 0.03 AD-53815 AD-56621.1 0.71 0.76 0.93 0.95 0.18 0.07 0.07 AD-53815 AD-56627.1 0.58 0.72 0.93 0.94 0.01 0.08 0.02 AD-53815 AD-56639.1 0.52 0.57 0.72 0.94 0.16 0.00 0.04 AD-53815 AD-56645.1 0.32 0.49 0.74 0.88 0.03 0.03 0.14 AD-53815 AD-56651.1 0.71 0.94 0.88 0.88 0.08 0.29 0.12 AD-53815 AD-56610.1 0.31 0.57 0.82 0.93 0.02 0.01 0.04 AD-53815 AD-56616.1 0.47 0.68 0.70 1.01 0.06 0.08 0.34 AD-53815 AD-56622.1 0.47 0.66 0.88 0.95 0.06 0.10 0.10 AD-53815 AD-56628.1 1.02 1.15 1.04 0.99 0.00 0.12 0.02 AD-53815 AD-56634.1 0.75 0.90 0.97 1.03 0.11 0.04 0.07 AD-53815 AD-56640.1 0.58 0.76 0.81 1.01 0.10 0.05 0.12 AD-53815 AD-56646.1 0.77 0.94 0.82 0.99 0.09 0.12 0.14 AD-53815 AD-56652.1 0.61 0.74 0.78 0.89 0.00 0.00 0.03

- 105 037110

AD-53815 AD-56611.1 0.93 1.02 1.16 0.89 0.05 0.15 0.05 AD-53815 AD-56647.1 0.38 0.58 0.79 0.94 0.05 0.08 0.00 AD-53815 AD-56653.1 0.47 0.46 0.63 0.84 0.12 0.04 0.04 AD-53815 AD-56612.1 0.41 0.61 0.88 0.85 0.03 0.09 0.09 AD-53815 AD-56618.1 0.64 0.60 1.03 1.08 0.21 0.09 0.01 AD-53815 AD-56624.1 0.46 0.61 0.85 1.05 0.04 0.17 0.15 AD-53815 AD-56630.1 0.49 0.69 0.87 1.01 0.01 0.00 0.15 AD-53815 AD-56636.1 0.49 0.57 0.82 1.13 0.01 0.05 0.03 AD-53815 AD-56642.1 0.43 0.55 0.82 1.09 0.00 0.08 0.03 AD-53815 AD-56648.1 0.48 0.66 0.80 0.96 0.00 0.04 0.08 AD-53815 AD-56654.1 0.43 0.53 0.72 0.84 0.01 0.00 0.07 AD-53815 AD-56613.1 0.54 0.61 0.81 0.91 0.16 0.08 0.19 AD-53815 AD-56619.1 0.55 0.67 1.02 1.06 0.04 0.07 0.07 AD-53815 AD-56614.1 0.42 0.56 0.86 0.90 0.05 0.04 0.10 AD-53815 AD-56620.1 0.41 0.52 0.85 0.84 0.01 0.12 0.08 AD-53815 AD-56626.1 0.59 0.68 0.90 1.12 0.01 0.03 0.10 AD-53815 AD-56632.1 0.60 0.73 0.91 1.05 0.04 0.09 0.10 AD-53815 AD-56638.1 0.68 0.89 0.94 1.19 0.03 0.03 0.18 AD-53815 AD-56644.1 0.84 0.89 1.09 1.09 0.08 0.08 0.06 AD-53815 AD-56650.1 0.86 0.95 1.05 1.05 0.10 0.01 0.10 AD-53815 AD-56656.1 0.53 0.64 0.92 0.88 0.09 0.04 0.14 AD-53815 AD-56662.1 0.55 0.61 0.96 1.03 0.02 0.09 0.01 AD-53815 AD-56668.1 0.76 0.79 0.99 1.10 0.07 0.11 0.06 AD-53815 AD-56673.1 0.81 0.87 1.12 1.09 0.01 0.15 0.13 AD-53815 AD-56678.1 0.84 0.76 1.12 1.05 0.04 0.24 0.05 AD-53815 AD-56683.1 0.88 0.93 1.08 1.06 0.05 0.10 0.06 AD-53815 AD-56688.1 0.80 0.86 0.93 0.99 0.10 0.11 0.19 AD-53815 AD-56657.1 0.45 0.63 0.84 0.88 0.20 0.04 0.09 AD-53815 AD-56663.1 0.35 0.49 0.77 1.03 0.00 0.07 0.04 AD-53815 AD-56669.1 0.53 0.68 0.99 1.11 0.00 0.18 0.03 AD-53815 AD-56674.1 0.44 0.64 0.84 1.03 0.06 0.01 0.17 AD-53815 AD-56679.1 0.52 0.67 0.77 1.01 0.01 0.06 0.14 AD-53815 AD-56684.1 0.43 0.59 0.84 1.08 0.01 0.03 0.04 AD-53815 AD-56689.1 0.55 0.57 0.73 0.95 0.09 0.01 0.11 AD-53815 AD-56693.1 0.45 0.48 0.65 0.84 0.04 0.02 0.11

- 106 037110

AD-53815 AD-56658.1 0.46 0.55 0.85 0.84 0.21 0.09 0.07 AD-53815 AD-56664.1 0.35 0.60 0.80 0.91 0.13 0.03 0.14 AD-53815 AD-56670.1 0.62 0.61 0.90 1.11 0.17 0.06 0.00 AD-53815 AD-56680.1 0.74 0.90 1.00 0.91 0.05 0.01 0.05 AD-53815 AD-56685.1 0.64 0.64 0.77 1.07 0.15 0.01 0.15 AD-53815 AD-56690.1 0.39 0.61 0.75 0.97 0.13 0.03 0.08 AD-53815 AD-56694.1 0.41 0.53 0.67 0.94 0.01 0.00 0.04 AD-53815 AD-56659.1 0.57 0.58 0.84 0.95 0.25 0.09 0.05 AD-53815 AD-56665.1 0.38 0.51 0.78 1.01 0.05 0.07 0.17 AD-53815 AD-56671.1 0.32 0.45 0.78 0.94 0.03 0.05 0.01 AD-53815 AD-56676.1 0.31 0.55 0.81 1.02 0.03 0.13 0.02 AD-53815 AD-56681.1 0.54 0.75 0.88 1.02 0.02 0.07 0.11 AD-53815 AD-56686.1 0.50 0.74 0.86 1.03 0.01 0.10 0.10 AD-53815 AD-56691.1 0.44 0.56 0.79 1.03 0.01 0.00 0.05 AD-53815 AD-56695.1 0.37 0.70 0.67 0.89 0.01 0.29 0.11 AD-53815 AD-56660.1 0.36 0.73 0.83 0.93 0.02 0.22 0.10 AD-53815 AD-56666.1 0.39 0.47 0.74 0.94 0.02 0.05 0.13 AD-53815 AD-56672.1 0.63 0.55 0.87 1.03 0.25 0.10 0.04 AD-53815 AD-56677.1 0.54 0.70 0.85 0.99 0.24 0.11 0.00 AD-53815 AD-56682.1 0.48 0.57 0.90 0.96 0.11 0.09 0.05 AD-53815 AD-56687.1 0.81 0.94 1.06 1.08 0.07 0.02 0.05 AD-53815 AD-56692.1 0.45 0.64 0.73 0.95 0.03 0.13 0.05 AD-53815 AD-56696.1 0.40 0.48 0.66 0.95 0.01 0.04 0.06 AD-53815 AD-56661.1 0.52 0.54 0.75 0.98 0.22 0.06 0.04 AD-53815 AD-56667.1 0.40 0.68 0.87 1.03 0.03 0.03 0.11 AD-53806 AD-53806.11 0.28 0.44 0.74 0.98 0.05 0.01 0.13 AD-53806 AD-53806.13 0.31 0.36 0.65 0.92 0.01 0.08 0.06 AD-53806 AD-53806.12 0.53 0.56 0.70 1.04 0.00 0.01 0.15 AD-53806 AD-53806.5 0.34 0.54 0.85 0.87 0.01 0.00 0.10 AD-53806 AD-53806.6 0.41 0.51 0.77 0.91 0.05 0.04 0.08 AD-53806 AD-53806.7 0.39 0.58 0.75 0.97 0.02 0.16 0.14 AD-53806 AD-53806.8 0.35 0.49 0.69 0.91 0.06 0.03 0.09 AD-53806 AD-53806.9 0.36 0.55 0.77 1.01 0.04 0.07 0.13 AD-53806 AD-53806.10 0.29 0.44 0.73 0.93 0.04 0.10 0.14 AD-53806 AD-56979.1 0.43 0.50 0.78 0.96 0.01 0.03 0.11

- 107 037110

AD-53806 AD-56979.2 0.32 0.47 0.65 1.02 0.02 0.11 0.05 AD-53806 AD-56975.3 0.27 0.57 0.72 0.83 0.01 0.16 0.08 AD-53806 AD-56975.4 0.55 0.67 0.81 0.92 0.11 0.10 0.04 AD-53806 AD-56975.5 0.34 0.54 0.71 0.94 0.04 0.22 0.10 AD-53806 AD-56975.1 0.38 0.53 0.74 0.93 0.13 0.14 0.02 AD-53806 AD-56975.2 0.50 0.62 0.82 0.98 0.09 0.16 0.11 AD-53806 AD-56983.1 0.49 0.72 0.89 1.11 0.10 0.09 0.21 AD-53806 AD-56983.2 0.74 0.89 1.14 1.16 0.10 0.06 0.02 AD-53806 AD-56983.3 0.91 1.05 1.02 1.04 0.09 0.10 0.08 AD-53806 AD-56983.4 0.40 0.57 0.83 1.05 0.03 0.02 0.08 AD-53806 AD-56983.5 0.33 0.51 0.83 0.90 0.03 0.04 0.03 AD-53806 AD-56977.3 0.44 0.49 0.62 0.95 0.17 0.16 0.06 AD-53806 AD-56977.1 0.27 0.58 0.81 0.88 0.06 0.07 0.08 AD-53806 AD-56977.2 0.41 0.60 0.81 0.90 0.01 0.07 0.12 AD-53806 AD-56976.1 0.40 0.64 0.85 0.90 0.14 0.21 0.01 AD-53806 AD-56976.2 0.37 0.47 0.70 1.01 0.09 0.10 0.13 AD-53806 AD-56980.1 0.47 0.54 0.83 0.97 0.12 0.02 0.14 AD-53806 AD-56980.2 0.44 0.55 0.81 1.08 0.15 0.11 0.08 AD-53806 AD-56984.1 0.41 0.63 0.81 1.08 0.04 0.07 0.14 AD-53806 AD-56984.2 0.32 0.58 0.86 1.04 0.02 0.17 0.07 AD-53806 AD-56987.1 0.37 0.63 0.82 1.11 0.08 0.08 0.05 AD-53806 AD-56987.2 0.33 0.59 0.79 1.02 0.05 0.05 0.13 AD-53806 AD-56991.1 0.36 0.57 0.73 1.08 0.01 0.07 0.18 AD-53806 AD-56993.1 0.41 0.54 0.75 0.99 0.12 0.09 0.06 AD-53806 AD-56995.1 0.35 0.45 0.67 1.00 0.07 0.02 0.12 AD-53806 AD-56978.1 0.35 0.67 0.88 0.91 0.04 0.22 0.05 AD-53806 AD-56978.2 0.47 0.55 0.78 1.12 0.03 0.01 0.07 AD-53806 AD-56981.1 0.45 0.65 0.86 1.08 0.01 0.16 0.15 AD-53806 AD-56985.1 0.53 0.61 1.08 1.14 0.02 0.09 0.07 AD-53806 AD-56988.1 0.62 0.81 0.91 1.13 0.01 0.05 0.20 AD-53806 AD-56988.2 0.76 0.94 0.85 1.14 0.17 0.10 0.11 AD-53806 AD-56988.3 0.55 0.79 0.86 1.19 0.04 0.05 0.16 AD-53806 AD-56982.1 0.40 0.65 0.84 1.07 0.04 0.10 0.09 AD-53806 AD-56982.2 0.38 0.50 0.70 1.01 0.03 0.03 0.08 AD-53806 AD-56986.1 0.45 0.57 0.80 1.12 0.02 0.11 0.15

- 108 037110

AD-53806 AD-56986.2 0.49 0.59 0.79 1.04 0.01 0.05 0.17 AD-53806 AD-56989.1 0.69 0.84 0.95 1.12 0.08 0.06 0.12 AD-53806 AD-56990.1 0.49 0.56 0.79 1.08 0.03 0.02 0.13 AD-53806 AD-56992.1 0.61 0.70 0.90 1.14 0.01 0.04 0.14 AD-53806 AD-56992.2 0.48 0.63 0.87 0.99 0.05 0.10 0.07 AD-53806 AD-56994.1 0.88 0.89 0.97 1.11 0.02 0.06 0.13 AD-53806 AD-56994.2 0.34 0.42 0.73 0.98 0.01 0.05 0.05 AD-53806 AD-56996.1 0.50 0.59 0.77 0.95 0.07 0.12 0.10 AD-53806 AD-57001.1 0.44 0.54 0.77 1.08 0.01 0.05 0.12 AD-53806 AD-57007.1 0.62 0.68 0.91 1.11 0.04 0.02 0.19 AD-53806 AD-57013.1 0.65 0.78 0.94 1.17 0.05 0.04 0.22 AD-53806 AD-57019.1 0.57 0.74 0.87 1.14 0.01 0.09 0.13 AD-53806 AD-57022.1 0.46 0.48 0.72 0.98 0.14 0.01 0.17 AD-53806 AD-57025.1 0.37 0.47 0.68 0.92 0.04 0.11 0.06 AD-53806 AD-56997.1 0.41 0.56 0.77 0.88 0.00 0.10 0.09 AD-53806 AD-57002.1 0.46 0.58 0.81 1.04 0.03 0.03 0.08 AD-53806 AD-57008.1 0.68 0.75 0.91 1.13 0.02 0.03 0.15 AD-53806 AD-57014.1 0.80 0.82 0.99 1.17 0.02 0.01 0.12 AD-53806 AD-57020.1 0.51 0.53 0.81 1.07 0.17 0.03 0.07 AD-53806 AD-57020.2 0.37 0.46 0.68 1.02 0.04 0.07 0.13 AD-53806 AD-57026.1 0.34 0.51 0.68 0.97 0.01 0.08 0.06 AD-53806 AD-57003.1 0.76 0.90 0.94 1.11 0.02 0.16 0.11 AD-53806 AD-57009.1 0.81 0.88 0.93 0.98 0.01 0.03 0.10 AD-53806 AD-57015.1 0.72 0.92 0.90 1.04 0.01 0.05 0.15 AD-53806 AD-57023.1 0.41 0.50 0.75 1.00 0.08 0.07 0.06 AD-53806 AD-57027.1 0.38 0.46 0.68 0.93 0.11 0.00 0.07 AD-53806 AD-56998.1 0.45 0.57 0.94 0.98 0.01 0.06 0.11 AD-53806 AD-57004.1 0.39 0.61 0.80 1.13 0.03 0.04 0.13 AD-53806 AD-57010.1 0.43 0.64 0.81 1.00 0.01 0.07 0.15 AD-53806 AD-57016.1 0.44 0.71 0.80 0.97 0.01 0.25 0.05 AD-53806 AD-56999.2 0.49 0.60 0.69 1.04 0.04 0.02 0.16 AD-53806 AD-56999.1 0.39 0.55 0.68 0.96 0.01 0.09 0.10 AD-53806 AD-57021.1 0.40 0.58 0.71 1.02 0.03 0.03 0.11 AD-53806 AD-57024.1 0.41 0.49 0.68 1.02 0.14 0.00 0.10 AD-53806 AD-57005.1 0.45 0.56 0.87 1.06 0.03 0.03 0.20 AD-53806 AD-57011.1 0.53 0.63 0.92 1.02 0.02 0.07 0.10 AD-53806 AD-57017.1 0.48 0.60 0.81 1.07 0.00 0.01 0.12 AD-53806 AD-57000.2 0.50 0.60 0.74 0.93 0.04 0.01 0.02 AD-53806 AD-57000.3 0.54 0.49 0.72 0.97 0.22 0.08 0.00 AD-53806 AD-57000.1 0.70 0.76 0.80 0.95 0.02 0.05 0.04 AD-53806 AD-57006.2 0.48 0.75 0.76 0.94 0.00 0.31 0.12 AD-53806 AD-57006.3 0.45 0.57 0.71 0.98 0.08 0.09 0.12 AD-53806 AD-57006.1 0.64 0.76 0.84 0.97 0.00 0.11 0.10 AD-53806 AD-57012.1 0.53 0.83 0.79 0.93 0.04 0.42 0.02 AD-53806 AD-57018.1 0.67 0.73 0.72 0.93 0.07 0.04 0.03

109 037110 siRNAs with a number of chemical modifications based on the original sequences AD-53815 and AD-53806 were also screened for in vitro efficacy by transfection of Hep3B cells at 10 and 0.1 nM. The results of this test for structural and functional relationship are shown in table. 7, and they are expressed as the average fraction of the remaining amount of transcript relative to the control ± SD.

Table 7. Efficacy Tests for Optimization of Prototype AD-53815 and AD-53806 by Transfection of Human Cells

Original duplex Duplex ID Trans., 10 nM, medium. Trans., 10 nM, SD Trans., 0.1 nM, mean. Trans., 0.1 nM, SD AD-53815 AD-53815.5 0.14 0.05 0.24 undefined AD-53815 AD-53815.4 0.18 0.07 0.38 undefined AD-53815 AD-56633.1 0.18 0.10 0.24 undefined AD-53815 AD-56617.1 0.13 0.06 0.25 undefined AD-53815 AD-56623.1 0.14 0.05 0.24 undefined AD-53815 AD-56629.1 0.14 0.02 0.17 undefined AD-53815 AD-56635.1 0.12 0.02 0.22 undefined AD-53815 AD-56641.1 0.15 0.01 0.16 undefined AD-53815 AD-56625.1 0.12 0.03 0.29 undefined AD-53815 AD-56631.1 0.13 0.01 0.20 undefined AD-53815 AD-56637.1 0.22 0.14 0.16 undefined

- 110 037110

AD-53815 AD-56643.1 0.18 0.08 0.16 undefined AD-53815 AD-56649.1 0.16 0.00 0.19 undefined AD-53815 AD-56655.1 0.24 0.11 0.24 undefined AD-53815 AD-56615.1 0.15 0.00 0.32 undefined AD-53815 AD-56621.1 0.20 0.07 0.41 undefined AD-53815 AD-56627.1 0.17 0.04 0.31 undefined AD-53815 AD-56639.1 0.19 0.08 0.24 undefined AD-53815 AD-56645.1 0.19 0.09 0.27 undefined AD-53815 AD-56651.1 0.29 0.09 0.68 undefined AD-53815 AD-56610.1 0.21 0.11 0.23 undefined AD-53815 AD-56616.1 0.16 0.04 0.29 undefined AD-53815 AD-56622.1 0.18 0.07 0.36 undefined AD-53815 AD-56628.1 0.28 0.07 0.60 undefined AD-53815 AD-56634.1 0.16 0.04 0.29 undefined AD-53815 AD-56640.1 0.21 0.09 0.26 undefined AD-53815 AD-56646.1 0.27 0.21 0.37 undefined AD-53815 AD-56652.1 0.26 0.08 0.29 undefined AD-53815 AD-56611.1 0.35 0.11 0.96 undefined AD-53815 AD-56647.1 0.17 0.09 0.13 undefined AD-53815 AD-56653.1 0.17 0.09 0.28 undefined AD-53815 AD-56612.1 0.17 0.07 0.24 undefined AD-53815 AD-56618.1 0.14 0.00 0.26 undefined AD-53815 AD-56624.1 0.15 0.02 0.27 undefined AD-53815 AD-56630.1 0.13 0.01 0.24 undefined AD-53815 AD-56636.1 0.17 0.08 0.22 undefined AD-53815 AD-56642.1 0.12 0.03 0.13 undefined AD-53815 AD-56648.1 0.15 0.05 0.21 undefined AD-53815 AD-56654.1 0.22 0.10 0.24 undefined AD-53815 AD-56613.1 0.17 0.07 0.40 undefined AD-53815 AD-56619.1 0.21 0.12 0.30 undefined AD-53815 AD-56614.1 0.12 0.01 0.23 undefined AD-53815 AD-56620.1 0.12 0.02 0.15 undefined AD-53815 AD-56626.1 0.14 0.03 0.20 undefined AD-53815 AD-56632.1 0.12 0.02 0.21 undefined AD-53815 AD-56638.1 0.15 0.10 0.23 undefined

- 111 037110

AD-53815 AD-56644.1 0.23 0.11 0.17 undefined AD-53815 AD-56650.1 0.13 0.03 0.20 undefined AD-53815 AD-56656.1 0.26 0.03 0.27 undefined AD-53815 AD-56662.1 0.13 0.06 0.18 undefined AD-53815 AD-56668.1 0.19 0.05 0.20 undefined AD-53815 AD-56673.1 0.18 0.05 0.21 undefined AD-53815 AD-56678.1 0.17 0.00 0.20 undefined AD-53815 AD-56683.1 0.29 0.22 0.27 undefined AD-53815 AD-56688.1 0.19 0.02 0.18 undefined AD-53815 AD-56657.1 0.18 0.14 0.34 undefined AD-53815 AD-56663.1 0.11 0.04 0.18 undefined AD-53815 AD-56669.1 0.11 0.02 0.31 undefined AD-53815 AD-56674.1 0.14 0.00 0.21 undefined AD-53815 AD-56679.1 0.14 0.05 0.19 undefined AD-53815 AD-56684.1 0.14 0.03 0.19 undefined AD-53815 AD-56689.1 0.18 0.09 0.18 undefined AD-53815 AD-56693.1 0.19 0.11 0.21 undefined AD-53815 AD-56658.1 0.19 0.13 0.30 undefined AD-53815 AD-56664.1 0.15 0.07 0.20 undefined AD-53815 AD-56670.1 0.18 0.10 0.26 undefined AD-53815 AD-56680.1 0.27 0.05 0.31 undefined AD-53815 AD-56685.1 0.14 0.02 0.28 undefined AD-53815 AD-56690.1 0.10 0.03 0.18 undefined AD-53815 AD-56694.1 0.15 0.06 0.17 undefined AD-53815 AD-56659.1 0.16 0.04 0.27 undefined AD-53815 AD-56665.1 0.14 0.06 0.26 undefined AD-53815 AD-56671.1 0.11 0.01 0.29 undefined AD-53815 AD-56676.1 0.14 0.06 0.20 undefined AD-53815 AD-56681.1 0.15 0.03 0.30 undefined AD-53815 AD-56686.1 0.15 0.03 0.26 undefined AD-53815 AD-56691.1 0.11 0.02 0.16 undefined AD-53815 AD-56695.1 0.14 0.06 0.24 undefined AD-53815 AD-56660.1 0.10 0.03 0.37 undefined AD-53815 AD-56666.1 0.18 0.13 0.22 undefined AD-53815 AD-56672.1 0.14 0.02 0.35 undefined

- 112 037110

AD-53815 AD-56677.1 0.15 0.04 0.23 undefined AD-53815 AD-56682.1 0.14 0.06 0.28 undefined AD-53815 AD-56687.1 0.24 0.01 0.53 undefined AD-53815 AD-56692.1 0.09 0.01 0.36 undefined AD-53815 AD-56696.1 0.16 0.09 0.26 undefined AD-53815 AD-56661.1 0.21 0.15 0.48 undefined AD-53815 AD-56667.1 0.22 0.16 0.26 undefined AD-53806 AD-53806.11 0.19 0.05 0.25 0.06 AD-53806 AD-53806.13 0.21 0.07 0.21 0.16 AD-53806 AD-53806.12 0.21 0.08 0.21 0.02 AD-53806 AD-53806.5 0.22 0.01 0.29 0.06 AD-53806 AD-53806.6 0.24 0.07 0.33 0.12 AD-53806 AD-53806.7 0.19 0.02 0.24 0.11 AD-53806 AD-53806.8 0.20 0.01 0.23 0.05 AD-53806 AD-53806.9 0.22 0.01 0.19 0.06 AD-53806 AD-53806.10 0.17 0.01 0.21 0.07 AD-53806 AD-56979.1 0.18 0.00 0.29 0.14 AD-53806 AD-56979.2 0.24 0.11 0.24 0.12 AD-53806 AD-56975.3 0.26 0.09 0.28 0.18 AD-53806 AD-56975.4 0.35 0.02 0.50 0.23 AD-53806 AD-56975.5 0.17 0.01 0.21 0.18 AD-53806 AD-56975.1 0.24 0.09 0.32 0.12 AD-53806 AD-56975.2 0.19 0.04 0.16 0.02 AD-53806 AD-56983.1 0.17 0.01 0.32 0.18 AD-53806 AD-56983.2 0.28 0.07 0.63 0.15 AD-53806 AD-56983.3 1.22 0.61 0.83 0.02 AD-53806 AD-56983.4 0.25 0.10 0.24 0.10 AD-53806 AD-56983.5 0.17 0.01 0.26 0.15 AD-53806 AD-56977.3 0.31 0.11 0.28 0.23 AD-53806 AD-56977.1 0.22 0.04 0.34 0.12 AD-53806 AD-56977.2 0.22 0.05 0.29 0.16 AD-53806 AD-56976.1 0.21 0.09 0.34 0.20 AD-53806 AD-56976.2 0.17 0.03 0.25 0.04 AD-53806 AD-56980.1 0.22 0.04 0.20 0.02 AD-53806 AD-56980.2 0.19 0.01 0.20 0.06

- 113 037110

AD-53806 AD-56984.1 0.24 0.11 0.22 0.10 AD-53806 AD-56984.2 0.19 0.01 0.21 0.10 AD-53806 AD-56987.1 0.19 0.05 0.29 0.19 AD-53806 AD-56987.2 0.24 0.03 0.24 0.09 AD-53806 AD-56991.1 0.17 0.01 0.17 0.08 AD-53806 AD-56993.1 0.14 0.09 0.22 0.06 AD-53806 AD-56995.1 0.19 0.07 0.27 0.13 AD-53806 AD-56978.1 0.27 0.12 0.36 0.12 AD-53806 AD-56978.2 0.24 0.03 0.20 0.01 AD-53806 AD-56981.1 0.22 0.03 0.28 0.17 AD-53806 AD-56985.1 0.21 0.00 0.28 0.04 AD-53806 AD-56988.1 0.20 0.02 0.24 0.02 AD-53806 AD-56988.2 0.20 0.03 0.27 0.13 AD-53806 AD-56988.3 0.23 0.03 0.27 0.01 AD-53806 AD-56982.1 0.23 0.06 0.24 0.00 AD-53806 AD-56982.2 0.21 0.06 0.18 0.07 AD-53806 AD-56986.1 0.23 0.05 0.20 0.06 AD-53806 AD-56986.2 0.24 0.04 0.25 0.13 AD-53806 AD-56989.1 0.31 0.02 0.43 0.00 AD-53806 AD-56990.1 0.27 0.00 0.28 0.10 AD-53806 AD-56992.1 0.27 0.06 0.31 0.01 AD-53806 AD-56992.2 0.22 0.10 0.30 0.14 AD-53806 AD-56994.1 0.97 0.05 0.85 0.09 AD-53806 AD-56994.2 0.22 0.09 0.26 0.01 AD-53806 AD-56996.1 0.18 0.04 0.31 0.08 AD-53806 AD-57001.1 0.24 0.09 0.23 0.08 AD-53806 AD-57007.1 0.25 0.01 0.27 0.03 AD-53806 AD-57013.1 0.30 0.08 0.33 0.02 AD-53806 AD-57019.1 0.29 0.03 0.28 0.02 AD-53806 AD-57022.1 0.20 0.06 0.21 0.05 AD-53806 AD-57025.1 0.23 0.12 0.25 0.15 AD-53806 AD-56997.1 0.20 0.05 0.25 0.11 AD-53806 AD-57002.1 0.21 0.07 0.28 0.01 AD-53806 AD-57008.1 0.26 0.01 0.31 0.01 AD-53806 AD-57014.1 0.32 0.03 0.43 0.05

- 114 037110

AD-53806 AD-57020.1 0.19 0.00 0.23 0.01 AD-53806 AD-57020.2 0.20 0.08 0.28 0.22 AD-53806 AD-57026.1 0.34 0.24 0.37 0.24 AD-53806 AD-57003.1 0.34 0.04 0.45 0.15 AD-53806 AD-57009.1 0.30 0.07 0.40 0.02 AD-53806 AD-57015.1 0.32 0.01 0.47 0.04 AD-53806 AD-57023.1 0.17 0.06 0.27 0.13 AD-53806 AD-57027.1 0.20 0.03 0.19 0.11 AD-53806 AD-56998.1 0.23 0.09 0.29 0.24 AD-53806 AD-57004.1 0.24 0.13 0.30 0.12 AD-53806 AD-57010.1 0.23 0.09 0.23 0.11 AD-53806 AD-57016.1 0.21 0.03 0.23 0.06 AD-53806 AD-56999.2 0.25 0.10 0.35 0.05 AD-53806 AD-56999.1 0.24 0.08 0.28 0.21 AD-53806 AD-57021.1 0.18 0.04 0.29 0.17 AD-53806 AD-57024.1 0.20 0.09 0.28 0.11 AD-53806 AD-57005.1 0.18 0.10 0.29 0.17 AD-53806 AD-57011.1 0.21 0.07 0.26 0.12 AD-53806 AD-57017.1 0.20 0.07 0.29 0.21 AD-53806 AD-57000.2 0.20 0.04 0.29 0.21 AD-53806 AD-57000.3 0.22 0.11 0.30 0.16 AD-53806 AD-57000.1 0.25 0.14 0.38 0.33 AD-53806 AD-57006.2 0.22 0.14 0.31 0.18 AD-53806 AD-57006.3 0.19 0.09 0.31 0.25 AD-53806 AD-57006.1 0.20 0.12 0.41 0.29 AD-53806 AD-57012.1 0.16 0.05 0.36 0.17 AD-53806 AD-57018.1 0.20 0.37 0.10 0.14

In order to determine whether any of the siRNAs from the in vitro SAR assay is more effective at silencing PCSK9 than the parental PCSK9 siRNA (AD-53815), transgenic mice were dosed with a single dose of 3 mg / kg siRNA as shown in FIG. ... 4, and 72 hours after dosing, PCSK9 protein levels were determined by ELISA. The results shown in FIG. 5 indicate that AD-57928 is surprisingly effective at silencing PCSK9. FIG. 6 shows that not only did a single dose of AD-57928 effectively knock down PCSK9 protein expression, but there was also a dose-dependent effect with AD-57928.

Example 4 A Split Dose Study Using AD-57928.

The ability of AD-57928 to suppress the expression of the PCSK9 protein was assessed by measuring the levels of human PCSK9 protein (hPCSK9) in the serum of hPCSK9 transgenic mice after AD-57928 administration. AD-57928 was administered subcutaneously using six different dosing regimens that included a saturation phase during the first week (one dose of 0.5, 1 or 2 mg / kg daily for 5 consecutive days) followed by a maintenance phase (once or twice every week was administered a dose of either 0.5, 1 or 2 mg / kg for 5 weeks), which are described in table. 8 below. The last dose was administered on day 38. Each dosing regimen was tested using a group of 3 mice, which included two males and one female. The control group received PBS injections.

- 115 037110

Table 8. Dosing regimens for administration of AD-57928

Object under study 1 Week 2-6 weeks Saturation dose (mg / kg) Total dose (mg / kg) Maintenance dose (mg / kg) Total weekly dose (mg / kg) PBS 5x 0 2x 0 AD-57928 5x2 ten 2x2 four AD-57928 5x2 ten 1x2 2 AD-57928 5x1 five 2x1 2 AD-57928 5x1 five 1x1 one AD-57928 5x0.5 2.5 2x0.5 one AD-57928 5x0.5 2.5 1x0.5 0.5

Serum was collected 3 days before the first dose and 1, 4, 7, 10, 14, 17, 21, 24, 28, 31, 35, 38, 42, 45, 52, 59 and 65 days after the first dose. Serum PCSK9 protein levels were assessed using ELISA assay. The results are shown in FIG. 6, 7 and 8.

A decrease in hPCSK9 serum protein levels was observed 72 hours after the first dose and lasted until day 38. Administration of AD-57928 at the saturation dose level of 5x2, 5x1 and 5x0.5 mg / kg resulted in ~ 90%, ~ 70% and ~ 60% reductions in hPCSK9 whey protein levels, respectively (see FIGS. 6-8). In the 2x maintenance dosing regimen, decreased hPCSK9 levels lasted 1 week longer than the 1x maintenance dosing group, and returned to baseline 4 weeks after the last dose (see . fig. 6-8).

Example 5. Phosphothioate titration.

In order to determine the effect of the number and position of phosphorothioate modifications on the ability of dsRNAs to inhibit PCSK9 expression, a number of siRNAs were obtained and examined based on the original sequences AD-57928, AD-53806 and AD-53830, which are shown in Table. 9. To determine if any of the siRNAs are more effective at silencing PCSK9 than AD-57928, PCSK9 transgenic mice were dosed with a single dose of 0.3 mg / kg siRNA from Table 1. 9 and 72 hours after dosing, PCSK9 protein levels were determined by ELISA assay. The results shown in FIG. 9 indicate that AD-57928 is surprisingly effective at silencing PCSK9. AD-58893, AD-58894, AD-58896, AD-58897, AD-58898 and AD-58899 were also able to silence PCSK9 compared to control.

Table 9. SiRNAs Used in Phosphorothioate Titration Experiment

Duplex ID Sequence of meaning SEQ ID NO: Antisense sequence SEQ ID NO: Chemical structure AD- 57928 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgU fL96 1557 a s Cfs a Afa Af gCf a Afa a c Af gGf u Cf u Afgs asa 1567 TOFFEE with 6 PS and ZOMe at the 3'end AS AD- 58893 CfsuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUf L96 1558 asCfaAfaAfgCfaAfaacAfgGfuCfuAfgas a 1568 TOFFEE with 3 external PS AD- CfusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUf 1559 aCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsa 1569 TOFFEE with 3

- 116 037110

58894 L96 a internal PS AD- 58895 CfuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL 96 1560 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgs asa 1570 TOFFEE only c 4 PS in antisense threads AD- 58896 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgU fL96 1561 a Cf a Af a Af gCf a AfaacAfgGfuCfuAfgaa 1571 TOFFEE only with 2 PS in a semantic thread AD- 58897 CfsusAfsgAfcCfuGfUfUfuUfgCfuUfuUfg UfL96 1562 asCfsasAfaAfgCfaAfaacAfgGfuCfuAfsg sasa 1572 TOFFEE with 9 PS AD- 58898 CfsusAfsgAfcCfuGfUfUfuUfgCfuUfuUfg UfL96 1563 asCfsaAfaAfgCfsaAfaacAfsgGfuCfuAfs gsasa 1573 TOFFEE with 10 PS AD- 58899 CfsusAfsgAfcCfuGfUfUfuUfgCfuUfuUfsg UfL96 1564 asCfsaAfaAfgCfsaAfaacAfsgGfuCfuAfs gsasa 1574 TOFFEE with 11 PS AD- 58900 CfsasAfgCfaGfaCfAfUfuUfaUfclIfuUfuU fL96 1565 a s Af sa Af a G f a U f a Afa u gU f c U fgCf u U f gs csu 1575 6P5-version AD- 53806 AD- 58902 U fs us U f u Cf u Afg Af CfCf u Gf u U f u U fgCf u U fL96 1566 a s Af sg Cf a Af a Af c Af gg u Cf u Afg Afa Afa s gsu 1576 6P5-version AD- 53830

Example 6 Liver Drug Levels AD-57928 and AD-58895.

The objective of this study was to quantify the levels of siRNA in the liver of wild-type mice in order to determine the appropriate test conditions for drug levels. The siRNAs used in the experiment were AD-57928 and AD-58895 (which did not cause a decrease in PCSK9 protein in Example 5). AD-58895 was used as a comparator to determine the points in time at which there was a difference in drug level, reflecting efficacy.

A total of 33 female C57B6 mice were used in the experiment (3 mice per group). These mice were injected with a single subcutaneous dose of either AD-57928, AD-58895, or PBS as a control. Livers were harvested at 4, 24, 48, 72, 96 and 168 hours after dosing. Two tissue aliquots per sample were collected and the liver siRNA concentration was measured using a qRT-PCR assay specific for the newly constructed antisense sequence. The measured amount of AD-57928 and AD-58895 per gram of liver over time is shown in FIG. 10, and the amount of AD-57928 and AD-58895, expressed as a percentage of the total theoretical dose, is shown in FIG. 11. The limit of detection (LOD) of the qRT-PCR assay was ~ 1 ng / g liver and the assay showed good productivity and accurate duplicate reproducibility. The results show that AD-57928 is more stable in the liver and AD-58895 is less stable, and both can be detected at all time points. On day 7 post-dose, AD-57928 was> 100 times the LOD of the qRT-PCR assay and AD-58895 was> 10 times the LOD. On average, there is a> 10-fold difference between the concentrations of AD-57928 and AD-58895 according to their predicted stability and observed efficacy. Times from 72 to 120 hours after dosing may be appropriate for tests based on siRNA concentration.

Example 7. Optimization of AD-57928.

To increase the activity and stability of AD-57928 in vivo, additional mRNA agents based on the parental sequences of AD-57928 were prepared and examined (Table 10; the sense sequences in Table 10 are disclosed as SEQ ID NO: 1653-1658, respectively, in order of occurrence, and antisense sequences are disclosed as SEQ ID NO: 1659-1664, respectively, in order of occurrence; the same sense and antisense sequences disclosed in Table 10 are also disclosed in Fig. 12A).

The unmodified sense and antisense sequences for AD-60212 are as follows:

sense - 5'-CUAGACCUGUTUUGCUUUUGU-3 '(A-122088.3; SEQ III NO: 1665); and antisense - 5'-ACAAAAGCAAAACAGGUCUAGAA-3 '(A-120190.19; SEQ ID NO: 1666).

In general, these compounds contained fewer 2'-fluoro modifications and the fluoro-modified uridines were removed. The in vitro efficacy of these duplexes was investigated by transfection of HeLa and Hep3b cells. As shown in FIG. 12V, AD-59849, AD-59228 and AD-60212

- 117 037110 had IC50 values comparable to baseline (AD-57928).

The ability of these duplexes to persist in vivo in the liver was also determined by administering 1 mg / kg of each duplex to wild-type mice and determining the siRNA level by quantitative PCR.

As shown in FIG. 13, all duplexes showed greater stability in the liver than the original duplex starting at 120 h after administration.

The ability of these duplexes to suppress the expression of the PCSK9 protein was also assessed in vivo by measuring the levels of PCSK9 protein, LDL, HDL, total cholesterol (Tc), triglycerides (Tg), alanine transaminase (ALT), aspartate aminotransferase (AST), and alkaline phosphatase (ALP) in serum of low primates (NHP). The presence of a reaction at the injection site was also monitored. Duplexes were administered using a dosing regimen that included a saturation phase during the first week (one dose of 2 mg / kg daily for 5 consecutive days, xqdx5) followed by a maintenance phase (three weekly doses of 2 mg / kg for 3 weeks, qwx3) , which are described in table. 11 below.

Table 10. Additional funds representing mRNA

Duplex Semantic ID Semantic ID antisense Antisense AD-57928 (parent) A-117428 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 A-117429 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa AD-59849 A-121244 CfsusAfgAfcCfuGfUfUfuUfgcuuuuguL96 A-121239 asCfsaAfaagCfaAfaacAfgGfucuAfgsasa AD-60688 A-120188 csusagacCfuGfuuuugcuuuuguL96 A-121239 asCfsaAfaagCfaAfaacAfgGfucuAfgsasa AD-59223 A-120188 csusagacCfuGfuuuugcuuuuguL96 A-120190 asCfsaAfAfAfgCfaAfaAfcAfgGfuCfuagsasa AD-60212 A-122088 csusagacCfuGfudTuugcuuuuguL96 A-120190 asCfsaAfAfAfgCfaAfaAfcAfgGfuCfuagsasa AD-59228 A-120197 CfsusAfgAfcCfuGfUfUfuUfgCfsuUfsuUfsgsUfsL96 A-120202 asCfsaAfaAfsgCfaAfaacAfgGfuCfsuAfgsasa

Table 11. Dosing regimens

Investigating the object Group number N Level doses (mg / kg) Dose frequency Cumulative dose (mg / kg) AD-57928 one 3 females 2 qdx5 + qwx3, 8 doses 16 AD-59849 2 2 qdx5 + qwx3, 8 doses 16 AD-60688 3 2 qdx5 + qwx3, 8 doses 16 AD-59223 four 2 qdx5 + qwx3, 8 doses 16 AD-60212 five 2 qdx5 + qwx3, 8 doses 16 AD-59228 6 2 qdx5 + qwx3, 8 doses 16

Blood: days: -9, -6, -3, 4, 7, 10, 14, 17, 21,24, 28, 31, 35, 42, 49, 56, 63 (first dose, 1 day)

Injection site monitoring: Yes

Indicators: protein PCSK9, LDL, HDL, Tc, Trig, ALT, AST, ALP

As shown in FIG. 14A and 14B, for all compounds, except for AD-60688, PCSK9 silencing reached more than 80%, and in some animals in the AD-60212 group, PCSK9 silencing reached more than 90%. FIG. 15 shows that in the absence of a statin for all compounds, except for AD60688, the LDL cholesterol level decreased by 60%, and in some animals in the AD-59223 group, the LDL cholesterol level decreased by up to 77%. Surprisingly, and as shown in FIG. 18, these agents continued to lower cholesterol levels for 46 days after the last dose of these agents. Even more surprisingly, as shown in FIG. 19, AD-60212 and AD-59849 continued to lower LDL cholesterol levels by up to 60% for at least 120 days (93 days after the last dose) longer than any effect observed for an RNAi agent in vivo. which indicates that after the saturation phase, these compounds can be administered at a frequency of once a month, once every two months, once every three months, once every four months, once every five months, or once every six months for during the maintenance phase.

Example 8 Preparation of Additional AD-57928 Based Sequences for PCSK9.

Additional mRNA agents were prepared based on the parental sequences of AD-57928 (see Table 12 below) and tested in vitro for efficacy by transfecting HeLa and Hep3B cells with these agents. IC ₅₀ values for these agents are shown in table. thirteen.

Table 12. Sequences to PCSK9

ID Smyslov Semantic (from 5 'to 3 ¹ ) SEQ ID Antismys Antisense (5 'to 3 ¹ ) SEQ ID duplex i thread NO: love NO: AD- 57928.45 A-117428.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1577 A-117429.1 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1605 AD-60928.1 A-122701.2 Cfs us AfgAfcCf u Gf U f Uf u U fgCf u Uf u UfgAf L96 1578 A-122702.2 usCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1606 AD-60929.1 A-122703.2 GfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1579 A-122704.2 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfcsusu 1607 AD-60930.1 A-122705.2 GfsasAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1580 A-122706.2 asCfsaAfaAfgCfaAfaacAfgGfuCfuUfcsusu 1608 AD-60931.1 A-122707.3 GfsasUfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1581 A-122708.2 asCfsaAfaAfgCfaAfaacAfgGfuCfaUfcsusu 1609 AD-60932.1 A-122707.4 GfsasUfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1582 A-122709.2 a s Cfs a Afa AfgCf a Afa a c Af gGf u Cf a U f csa s a 1610 AD-60933.1 A-122710.2 CfsasUfcAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1583 A-122711.2 asCfsaAfaAfgCfaAfaacAfgGfuGfaUfgsasa 1611 AD-60934.1 A-122712.2 CfsusUfcUfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1584 A-122713.2 a s Cfs a Afa AfgCf a Afa a c Af gGf a GfaAfgsasa 1612 AD-60927.1 A-122714.2 CfsusAfcUfgCfuGfUfUfuUfgCfuUfuUfgUfL96 1585 A-122715.2 asCfsaAfaAfgCfaAfaacAfgCfaGfuAfgsasa 1613 AD-60906.1 A-117428.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1587 A-122309.1 asCfsaAfaAfgCf (Ayh) AfaacAfgGfuCfuAfgsasa 1615 AD-60907.1 A-117428.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1588 A-122310.1 asCfsaAfaAfgCfa (Ayh) aacAfgGfuCfuAfgsasa 1616 AD-60908.1 A-117428.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1589 A-122311.1 asCfsaAfaAfgCfaAf (Ayh) acAfgGfuCfuAfgsasa 1617 AD-60909.1 A-117428.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1590 A-122312.1 asCfsaAfaAfgCfaAfa (Ayh) cAfgGfuCfuAfgsasa 1618 AD-60910.1 A-117428.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1591 A-122313.1 asCfsaAfaAfgCf (Ayh) AfaacAf (Gyh) GfuCf (Uyh) Afg sasa 1619 AD-60911.1 A-122307.1 Cfsus (Ayh) (Gyh) (Ayh) (Cyh) CfuGfUfUfuUf (Gyh) Cf (Uyh) Uf (Uyh) Uf (Gyh) UfL96 1592 A-117429.1 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1620 AD-60912.1 A-122308.1 (Cyh) u (Ayh) (Gyh) (Ayh) (Cyh) CfuGfUfUfuUf (Gyh) Cf (Uyh) Uf (Uyh) Uf (Gyh) UfL96 1593 A-117429.1 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1621 AD-60913.1 A-122307.1 Cfsus (Ayh) (Gyh) (Ayh) (Cyh) CfuGfUfUfuUf (Gyh) Cf (Uyh) Uf (Uyh) Uf (Gyh) UfL96 1594 A-122309.1 asCfsaAfaAfgCf (Ayh) AfaacAfgGfuCfuAfgsasa 1622 AD-60914.1 A-122307.1 Cfsus (Ayh) (Gyh) (Ayh) (Cyh) CfuGfUfUfuUf (Gyh) Cf (Uyh) 1595 A-122310.1 asCfsaAfaAfgCfa (Ayh) aacAfgGfuCfuAfgsasa 1623 AD-60915.1 A-122307.1 Uf (Uyh) Uf (Gyh) UfL96 Cfsus (Ayh) (Gyh) (Ayh) (Cyh) CfuGfUfUfuUf (Gyh) Cf (Uyh) Uf (Uyh) Uf (Gyh) UfL96 1596 A-122311.1 asCfsaAfaAfgCfaAf (Ayh) acAfgGfuCfuAfgsasa 1624 AD- 57928.45 A-117428.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1597 A-117429.1 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1625 AD-60916.1 A-122307.1 Cfsus (Ayh) (Gyh) (Ayh) (Cyh) CfuGfUfUfuUf (Gyh) Cf (Uyh) Uf (Uyh) Uf (Gyh) UfL96 1598 A-122312.1 asCfsaAfaAfgCfaAfa (Ayh) cAfgGfuCfuAfgsasa 1626 AD-60918.1 A-122308.1 (Cyh) u (Ayh) (Gyh) (Ayh) (Cyh) CfuGfUfUfuUf (Gyh) Cf (Uyh) Uf (Uyh) Uf (Gyh) UfL96 1600 A-122309.1 asCfsaAfaAfgCf (Ayh) AfaacAfgGfuCfuAfgsasa 1628 AD-60919.1 A-122308.1 (Cyh) u (Ayh) (Gyh) (Ayh) (Cyh) CfuGfUfUfuUf (Gyh) Cf (Uyh) Uf (Uyh) Uf (Gyh) UfL96 1601 A-122310.1 asCfsaAfaAfgCfa (Ayh) aacAfgGfuCfuAfgsasa 1629 AD-60920.1 A-122308.1 (Cyh) u (Ayh) (Gyh) (Ayh) (Cyh) CfuGfUfUfuUf (Gyh) Cf (Uyh) Uf (Uyh) Uf (Gyh) UfL96 1602 A-122311.1 asCfsaAfaAfgCfaAf (Ayh) acAfgGfuCfuAfgsasa 1630 AD-60921.1 A-122308.1 (Cyh) u (Ayh) (Gyh) (Ayh) (Cyh) CfuGfUfUfuUf (Gyh) Cf (Uyh) Uf (Uyh) Uf (Gyh) UfL96 1603 A-122312.1 asCfsaAfaAfgCfaAfa (Ayh) cAfgGfuCfuAfgsasa 1631 AD-60922.1 A-122308.1 (Cyh) u (Ayh) (Gyh) (Ayh) (Cyh) CfuGfUfUfuUf (Gyh) Cf (Uyh) Uf (Uyh) Uf (Gyh) UfL96 1604 A-122313.1 asCfsaAfaAfgCf (Ayh) AfaacAf (Gyh) GfuCf (Uyh) Afg sasa 1632

- 119 037110

Table 13. IC50 values for the mRNA agents defined in the table. 12

Duplex ID Hela, IC ₅₀ (nM) Ner3, IC ₅₀ (nM) AD-57928.47 0.0026 0.0005 AD-60928.1 0.0000 0.0009 AD-60929.1 0.0010 0.0027 AD-60930.1 0.0055 0.0019 AD-60931.1 0.0028 0.0019 AD-60932.1 0.0039 0.0036 AD-60933.1 0.0349 0.1518 AD-60934.1 0.2115 0.5420 AD-60927.1 > 10 - AD-57928.45 <3.57225e-005 0.0007 AD-60906.1 0.0048 0.0007 AD-60907.1 0.0001 <3.57225e-005 AD-60908.1 0.0003 0.0072 AD-60909.1 - 0.0142 AD-60910.1 0.0001 0.0030 AD-60911.1 0.0955 0.1935 AD-60912.1 0.1834 0.4106 AD-60913.1 0.2693 0.5715 AD-60914.1 0.2292 0.4319 AD-60915.1 0.2069 0.3185 AD-57928.45 0.0057 0.0027 AD-60916.1 0.0802 0.2040 AD-60917.1 0.1420 0.0976 AD-60918.1 0.4101 0.3268 AD-60919.1 0.3202 0.5143 AD-60920.1 0.5199 0.5978 AD-60921.1 0.7969 2.0875 AD-60922.1 1.1078 1.0307

Example 9. Efficacy of a repeated dose of AD-57928.

The efficacy of a repeated dose of AD-57928 in suppressing the expression of the PCSK9 protein was assessed in vivo by measuring the levels of PCSK9 protein, LDL, HDL, total cholesterol (Tc), triglycerides (Tg), alanine transaminase (ALT), aspartate aminotransferase (AST) and alkaline phosphatase (ALP) in serum of lower primates (NHP). The presence of a reaction at the injection site was also monitored. Duplexes AD57928 were administered subcutaneously using the dosing regimens described in Table 1. 14 below. Groups of 5 animals were re-administered with a single dose of 25 mg / kg on day 92. One additional group of animals received a single dose of 25 mg / kg. 2xw means twice a week; q2w means once every two weeks; and q1w means once a week.

- 120 037110

Table 14. Dosing regimens

Object under study Cruzza room N Dose level (mg / kg) Dose frequency Cumulative dose (mg) one one 2xw, 12 doses 12 2 2 2xw, 12 doses 24 3 one q2w, 6 doses 6 AD-57928 four 3 2 q2w, 6 doses 12 females five 0.5 q1w, 6 doses 3 6 one q1w, 10 doses ten 7 2 q1w, 10 doses twenty

Blood: days -9, -6, -3, 1 (pre-drawn blood). 3-129 (efficacy in blood samples)

Injection site monitoring: yes

Indicators: protein PCSK9, LDL, HDL, Tc, Trig, ALT, AST, ALP

As shown in FIG. 14A and 14B, for all compounds, except for AD-60688, PCSK9 silencing reached more than 80%, and in some animals in the AD-60212 group, PCSK9 silencing reached more than 90%. FIG. 15 shows that in the absence of a statin for all compounds, except for AD60688, the LDL cholesterol level decreased by 60%, and in some animals in the AD-59223 group, the LDL cholesterol level decreased by up to 77%.

As shown in FIG. 16A, the most effective regimen for lowering LDL was the twice weekly (2xw) regimen, in which the reduction in LDL levels reached about 60%. The same cumulative dose, administered less frequently, was less effective than the twice-weekly regimen. FIG. 16B shows that in 2xw mode, PCSK9 silenced over 80%.

FIG. 17A and 17B show that a single dose of AD-57928 25 mg / kg has the same onset of decline in LDL and PCSK9, the same low level with a decline in PCSK9 and LDL, and an equivalent rate of decline in LDL as the lower multiple dose AD -57928 2 mg / kg given twice weekly (2xw). It can also be seen from these graphs that there is a tendency for a faster decrease in PCSK9 levels at a single dose of 25 mg / kg, and that for a single dose of 25 mg / kg, both PCSK9 and LDL levels begin to recover approximately 20 days after reaching the lowest level (7 day). The lowest level for a single dose of 25 mg / kg was observed on day 7.

Example 10 Portability of Optimized mRNA Agents, AD-57928.

Additional mRNA agents derived from the parental sequences of AD-57928 described in FIG. 12A (and in Table 10) was evaluated for tolerance in rats. Male rats were subcutaneously injected with 225 mg / kg of these mRNA agents on days 1, 8 and 15 and were sacrificed and necropsied on day 16 (see Table 15). The animals were monitored every day for any clinical symptoms and the body weights of the animals were determined before the study and every week throughout the study. On the 16th day, the blood of the animals was evaluated hematologically for coagulability and a biochemical analysis of the serum was performed; drug metabolism and pharmacokinetics were determined using animal liver samples; and the heart, lungs (insufflated), kidneys, liver, spleen, testes, and the first and last injection sites were analyzed for any changes. There were no changes in clinical signs, visual observation of the injection site, serum biochemistry, clotting, or microscopic abnormal anatomy of the liver, spleen, lung, heart, or testicles. Table 16 summarizes data on liver weight, final body weight, results of hematological analyzes and assessment of the severity of pathology for the sites of the last injection and kidney for each investigated agent.

- 121 037110

Table 15. Dosing regimens

Group pa doses TA Dose (mg / kg) Dose volume (ml / kg) Qty males Scheme dosing Day Nx one PBS 0 five 3 SC in 1, 8 and 15 Days Day 16 2 AD-57928 (original) 225 3 3 AD-59849 225 3 four AD-59223 225 3 five AD-59228 225 3 6 AD-60688 225 3 7 AD-60212 225 3

Table 16. Generalized data on portability

AD-57928 (original one AD-59849 AR-59223 AD-59228 AD-60688 AD-60212 Qty PS 6 6 6 thirteen 6 6 Quantity 2T 21 15 12 21 nine 12

- 122 037110

Number of dT 0 0 0 0 0 one [liver] (μg / g) 907 ± 62 1139 ± 160 1277 ± 231 1999 ± 424 1624 ± 147 1258 ± 286 The ultimate Bw (% of control) -2.1% -4.6% -2.1% -6.8% -0.5% -2.9% Day 16 Complete blood count Without changes Without changes 1WBC. 1LYM. hemolysis Without changes Without changes Without changes Day 16, inflammation at the site of the last injection 3/3 (1.7) 3/3 (1.3) 2/3 (1.5) 3/3 (2.3) 2/3 (1.0) 3/3 (1.3) 16 day, basophilic e granules. bud 3/3 (2.0) 3/3 (2.3) 3/3 (1.0) 3/3 (2.0) 3/3 (1.3) 3/3 (1.3)

Assessment of the severity of pathology: 1 - minimal; 2 - weak; 3 - moderate;

BW is body weight;

WBC - white blood cell;

LYM - lymphocytes.

Claims (54)

1. Double-stranded RNAi agent that inhibits the expression of proprotein convertase subtilisin / kexin 9 (PCSK9) in a cell, where said double-stranded RNAi agent contains a sense strand complementary to the antisense strand, forming a double-stranded region; where the specified antisense strand contains a region complementary to a portion of the mRNA encoding PCSK9; where the length of each chain is independently 19 to 30 nucleotides; where the specified antisense strand contains at least 19 consecutive nucleotides of the nucleotide sequence where the specified double-stranded RNAi-agent contains at least one modified nucleotide selected from the group consisting of 2'-O-methyl, 2'-fluoro and 2'-deoxythymidine (dT); where the antisense strand contains two phosphorothioate internucleotide linkages between three nucleotides at the 3 'end and two phosphorothioate internucleotide linkages between three nucleotides at the 5' end; and where the sense strand contains two phosphorothioate internucleotide linkages between three nucleotides at the 5'-end; and where at least one sense strand is conjugated to a ligand containing one or more GalNAc derivatives linked by a divalent or trivalent branched linker. 2. The double-stranded RNAi agent of claim 1, wherein the double-stranded region is 19-25 base pairs in length. - 123 037110 3. The double-stranded RNAi agent of claim 1, wherein the double-stranded region is 19-23 base pairs in length. 4. The double-stranded RNAi agent of claim 1, wherein the double-stranded region is 21-25 base pairs in length. 5. The double-stranded RNAi agent of claim 1, wherein the double-stranded region is 23-27 base pairs in length. 6. The double-stranded RNAi agent of claim 1, wherein the double-stranded region is 19-21 base pairs in length. 7. The double-stranded RNAi agent of claim 1, wherein the double-stranded region is 21-23 base pairs in length. 8. The double-stranded RNAi agent of claim 1, wherein each strand is 19-25 nucleotides in length. 9. The double-stranded RNAi agent of claim 1, wherein the sense strand has a total of 21 nucleotides and the antisense strand has a total of 23 nucleotides. 10. The double-stranded RNAi agent of claim 1, wherein the region complementary to a portion of the mRNA encoding PCSK9 comprises a nucleotide sequence 5'-ACAAAAGCAAAACAGGUCUAGAA-3 '(SEQ ID NO: 1666). 11. The double-stranded RNAi agent of claim 1, wherein the sense strand consists of a nucleotide sequence 5'- CUAGACCUGUTUUGCUUUUGU-3 '(SEQ ID NO: 1665) and the antisense strand consists of the nucleotide sequence 5'-ACAAAAGCAAAACAGGUCUAGAA-3 '(SEQ ID NO: 1666). 12. The double-stranded RNAi agent of claim 1, wherein the antisense strand comprises a nucleotide sequence 5'- ACAAAAGCAAAACAGGUCUAG-3 '(SEQ ID NO: 412) and the sense strand contains the nucleotide sequence 5'-AGACCUGUUUUGCUUUUUGU-3 '(SEQ ID NO: 191). 13. The double-stranded RNAi agent of claim 1, wherein the sense strand consists of a nucleotide sequence 5'- ACAAAAGCAAAACAGGUCUAGAA-3 '(SEQ ID NO: 1666) and the sense strand consists of the nucleotide sequence 5'-CUAGACCUGUTUUGCUUUUGU-3 '(SEQ ID NO: 1665). 14. The double-stranded RNAi agent of claim 1, wherein the sense strand comprises a nucleotide sequence 5'-csusaqacCfuGfudTuuqcuuuuqu-3 '(SEQ ID NO: 1657) and the antisense strand contains the nucleotide sequence 5 '- asCfsaAfAfAfgCfaAfaAfcAfgGfuCfuagsasa-3' (SEQ ID NO: 1663), where a, c, g and u are 2'-O-methyl (2'-OMe) A, C, G and U, respectively; Af, Cf, Gf and Uf are 2'-fluoro A, C, G and U, respectively; dT is 2'-deoxythymidine; and s is a phosphorothioate bond. 15. The double-stranded RNAi agent of claim 1, wherein the double-stranded RNAi agent comprises (a) an antisense strand consisting of a nucleotide sequence 5'-aCfaAfaAfgCfaAfaacAfgGfuCfuAfgsAfsa-3 '(SEQ id NO: 1151), and a sense strand consisting of a nucleotide sequence 5'-CfuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUf-3 '(SEQ ID NO: 600); (b) an antisense strand consisting of a nucleotide sequence 5'-aCfaAfAfAfgCfaAfaacAfgGfuCfuAfgsAfsa-3 '(SEQ ID NO: 1246), and a sense strand consisting of the nucleotide sequence 5'-CfuAfgAfcCfuGfUfUfuUfgCfuuuUfgUf-3 '(SEQ IDNO: 695); (c) an antisense strand consisting of a nucleotide sequence 5'-aCfaaaAfgCfaAfaacAfgGfuCfuAfgsAfsa-3 '(SEQ ID NO: 1253), and a sense strand consisting of the nucleotide sequence 5'-CfuAfgAfcCfuGfUfUfuUfgCfuUfUfUfgUf-3 '(SEQid NO: 702); (d) an antisense strand consisting of a nucleotide sequence 5'-aCfaAfAfAfgCfaAfaacAfgGfuCfusAfsg-3 '(SEQid NO: 1263), and a sense strand consisting of a nucleotide sequence 5'-AfgAfcCfuGfUfUfuUfgCfuuuUfgUf-3 '(SEQ IDno: 712); (f) an antisense strand consisting of a nucleotide sequence 5'-aCfaaaAfgCfaAfaacAfgGfuCfusAfsg-3 '(SEQ IDnO: 1269), and a sense strand consisting of the nucleotide sequence 5 '-AfgAfcCfuGfUfUfuUfgCfuUfUfUfgUf-3' (SEQ IDno: 718); (f) an antisense strand consisting of a nucleotide sequence - 124 037110 5'-asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa-3 '(SEQ ID NO: 1369), and a sense strand consisting of the nucleotide sequence 5'-CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUf-3 '(SEQID NO: 818); (g) an antisense strand consisting of a nucleotide sequence 5'-asCfsaAfaagCfaAfaacAfgGfucuAfgsasa-3 '(SEQ id NO: 1660), and a sense strand consisting of a nucleotide sequence 5'-CfsusAfgAfcCfuGfUfUfuUfgcuuuugu-3 'SEQ ID NO: 1654); or (h) an antisense strand consisting of a nucleotide sequence 5'-asCfsaAfaAfsgCfaAfaacAfgGfuCfsuAfgsasa-3 '(seq ID NO: 1400), and a sense strand consisting of a nucleotide sequence 5 '-CfsusAfgAfcCfuGfUfUfuUfgCfsuUfsuUfsgsUf3-3 ^ (SEQ ID NO: 849); where a, g, c and u represent modified 2'-O-methyl (2'-OMe) A, C, G and U; Af, Gf, Cf and Uf are 2'-fluorine modified A, C, G and U nucleotides; dT is a 2'-deoxythymidine nucleotide; and s is a phosphorothioate bond. 16. The double-stranded RNAi agent of claim 1, wherein the GalNAc derivative is attached to the sense strand. 17. The double-stranded RNAi agent of claim 1, wherein substantially all nucleotides of the sense strand and substantially all nucleotides of the antisense strand are modified nucleotides. 18. The PHKi agent of claim 1, wherein all nucleotides of the sense strand and all nucleotides of the antisense strand are modified. 19. The double-chain PHKi agent of claim 1, wherein the ligand is 20. The double-stranded RNAi agent of claim 19, wherein the ligand is attached to the sense strand at the 3-end. 21. The double-stranded PHKi agent of claim 20, which is conjugated to a ligand as shown in the following diagram: where X is O or S. 22. A pharmaceutical composition comprising the double-chain RNAi agent of claim 1 for treating an individual with a disorder mediated by the expression of PCSK9. 23. Double-stranded RNAi agent that inhibits the expression of proprotein convertase subtilisin / kexin 9 (PCSK9) in a cell, containing a sense strand and an antisense strand, where the sense strand contains a nucleotide sequence 5'-csusagacCfuGfudTuugcuuuuguL96-3 '(SEQ ID NO: 1657) and the antisense strand contains the nucleotide sequence 5 '- asCfsaAfAfAfgCfaAfaAfcAfgGfuCfuagsasa-3' (SEQ ID NO: 1663), where a, c, g and u are 2'-O-methyl (2'-OMe) A, C, G and U, respectively; Af, Cf, Gf and Uf are 2'-fluoro A, C, G and U, respectively; s is a phosphorothioate bond; - 125 037110 dT is 2'-deoxythymidine, where L96 is and where L96 is conjugated to the 3'-end of the sense strand, as shown in the diagram below: where X represents O. 24. A pharmaceutical composition comprising the double-chain RNAi agent of claim 23, used in a method for treating an individual with a disorder mediated by PCSK9 expression. 25. The pharmaceutical composition of claim 24 further comprising an unbuffered solution. 26. The pharmaceutical composition of claim 25, wherein the unbuffered solution is saline or water. 27. The pharmaceutical composition of claim 24 further comprising a buffer solution. 28. The pharmaceutical composition of claim 27, wherein the buffered solution contains acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. 29. Double-stranded RNAi agent that inhibits the expression of proprotein convertase subtilisin / kexin 9 (PCSK9) in a cell, containing a sense strand and an antisense strand, where the sense strand consists of a nucleotide sequence 5'-csusagacCfuGfudTuugcuuuuguL96-3 '(SEQ ID NO: 1657) and the antisense strand consists of the nucleotide sequence 5 '- asCfsaAfAfAfgCfaAfaAfcAfgGfuCfuagsasa-3' (SEQ ID NO: 1663), where a, c, g and u are 2'-O-methyl (2'-OMe) A, C, G and U, respectively; Af, Cf, Gf and Uf are 2'-fluoro A, C, G and U, respectively; s is a phosphorothioate bond; dT is 2'-deoxythymidine, and where L96 is where L96 is conjugated to the 3-end of the sense strand as shown in the diagram below: - 126 037110 where X represents O. 30. A pharmaceutical composition comprising a double-chain RNAi agent according to claim 29, used in a method for treating an individual with a disorder mediated by PCSK9 expression. 31. Double-stranded RNAi agent that inhibits the expression of proprotein convertase subtilisin / kexin 9 (PCSK9) in a cell, containing an antisense strand that differs by no more than 4 bases from the nucleotide sequence 5 '- asCfsaAfAfAfgCfaAfaAfcAfgGfuCfuagsasa-3' (SEQ ID NO: 1663), and a sense strand that differs by no more than 4 bases from the nucleotide sequence 5'-csusagacCfuGfudTuugcuuuuguL96-3 '(SEQ ID NO: 1657), where a, c, g and u are 2'-O-methyl (2'-OMe) A, C, G and U, respectively; Af, Cf, Gf and Uf are 2'-fluoro A, C, G and U, respectively; s is a phosphorothioate bond; dT is 2'-deoxythymidine; and L96 is and where L96 is conjugated at the 3 'end of the sense strand as shown in the following diagram: where X represents O. 32. The double-stranded RNAi agent according to claim 31, wherein the antisense strand differs by no more than 3 bases from the nucleotide sequence 5'-asCfsaAfAfAfgCfaAfaAfcAfgGfuCfuagsasa-3 '(SEQ ID NO: 1663), and the sense strand differs by no more than 3 bases from the nucleotide sequence 5'-csusagacCfuGfudTuugcuuuuguL96-3 '(SEQ ID NO: 1657). 33. Double-stranded RNAi agent according to claim 31, wherein the antisense strand differs by no more than 2 bases from the nucleotide sequence - 127 037110 5'-asCfsaAfAfAfgCfaAfaAfcAfgGfuCfuagsasa-3 '(SEQ ID NO: 1663), and the sense strand differs by no more than 2 bases from the nucleotide sequence 5 '- csusagacCfuGfudTuugcuuuuguL96-3' (SEQ ID NO: 1657). 34. A pharmaceutical composition comprising the double-chain RNAi agent of claim 61, used in a method for treating an individual with a disorder mediated by PCSK9 expression. 35. A method for inhibiting expression of PCSK9 in a cell, comprising: (a) contacting the cell with a double-stranded RNAi agent according to any one of claims 1, 29 or 31 or with a pharmaceutical composition according to any one of claims 22, 30 or 34; and (b) maintaining the cell obtained in step (a) for a period of time sufficient to obtain degradation of the mRNA transcript of the PCSK9 gene, thereby inhibiting the expression of the PCSK9 gene in the cell. 36. Use of a therapeutically effective amount of a double-stranded RNAi agent according to any one of claims 1, 29 or 31 or a pharmaceutical composition according to any one of claims 22, 30 or 34 for treating an individual with lipidemia mediated by PCSK9 expression. 37. Use according to claim 36, wherein the individual is a human. 38. Use according to claim 37, wherein the person has hypercholesterolemia. 39. The use of claim 36, wherein the double chain PHKi agent is for administration at a dose of from about 0.01 mg / kg to about 10 mg / kg, or from about 0.5 mg / kg to about 50 mg / kg. 40. Use according to claim 36, wherein the double-chain RNAi agent is for administration in two or more doses. 41. Use according to claim 40, wherein the double-chain RNAi agent is for administration in a dosage regimen that includes a loading phase followed by a maintenance step. 42. Use according to claim 41, wherein the maintenance phase comprises a dose of the double-stranded RNA agent to be administered to the subject once every three months. 43. Use according to claim 41, wherein the maintenance phase comprises administering a dose of the double-stranded RNAi agent to the individual once every six months. 44. Use according to claim 36, wherein the double-chain RNAi agent or pharmaceutical composition is for administration to a subject subcutaneously or intravenously. 45. A method for inhibiting expression of PCSK9 in a cell, comprising: (a) contacting the cell with a double-stranded RNAi agent according to claim 23 or with a pharmaceutical composition according to claim 24; and (b) maintaining the cell obtained in step (a) for a period of time sufficient to obtain degradation of the mRNA transcript of the PCSK9 gene, thereby inhibiting the expression of the PCSK9 gene in the cell. 46. Use of a therapeutically effective amount of a double-stranded RNAi agent according to claim 23 or a pharmaceutical composition according to claim 24 for treating an individual with PCSK9 expression mediated lipidemia. 47. Use according to claim 46, wherein the individual is a human. 48. Use according to claim 47, wherein the person has hypercholesterolemia. 49. Use according to claim 46, wherein the double-chain RNAi agent or pharmaceutical composition is for administration to a subject subcutaneously or intravenously. 50. The use of claim 46, wherein the double chain PHKi agent is for administration at a dose of from about 0.01 mg / kg to about 10 mg / kg, or from about 0.5 mg / kg to about 50 mg / kg. 51. Use according to claim 46, wherein the double-chain RNAi agent is for administration in two or more doses. 52. Use according to claim 46, wherein the double-chain RNAi agent is for administration in a dosing regimen that includes a loading phase followed by a maintenance step. 53. Use according to claim 52, wherein the maintenance phase comprises a dose of a double-stranded RNA agent to be administered to the subject once every three months. 54. Use according to claim 52, wherein the maintenance phase comprises a dose of a double-stranded RNA agent to be administered to the subject once every six months.