CN113881671A - Gene target for enhancing killing power of NK (natural killer) cells and application - Google Patents
Gene target for enhancing killing power of NK (natural killer) cells and application Download PDFInfo
- Publication number
- CN113881671A CN113881671A CN202111162804.8A CN202111162804A CN113881671A CN 113881671 A CN113881671 A CN 113881671A CN 202111162804 A CN202111162804 A CN 202111162804A CN 113881671 A CN113881671 A CN 113881671A
- Authority
- CN
- China
- Prior art keywords
- cells
- granzyme
- target
- cell
- target cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0646—Natural killers cells [NK], NKT cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Cell Biology (AREA)
- Immunology (AREA)
- Hematology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a gene target for enhancing NK cell lethality and application thereof. In the process that NK cells kill target cells, the NK cells are triggered by signals, and first through the degranulation process, Perform and Granzyme B are released to reach the target cells, wherein the Perform is used for perforating a channel on a target cell membrane to further mediate Granzyme B to enter the target cells, and the Granzyme B triggers DNA breakage of the target cells after entering the target cells to enable the target cells to die. CD107a is also an important factor involved in NK cell degranulation. Therefore, one skilled in the art usually evaluates the lethality of NK cells by detecting the expression level of Perforin, Granzyme B, CD107 a. The invention discovers that the high-expression lncRNA-AF289591 can effectively improve the lethality of NK cells.
Description
Technical Field
The invention belongs to the field of cellular immunotherapy, and particularly relates to a gene target for enhancing NK cell lethality and application thereof.
Background
NK cells, also known as natural killer cells, are one of the constitutional cells of the body's innate immunity and are mainly distributed in the peripheral blood and spleen. Under normal conditions, NK cells eliminate tumor cells or virally infected cells by distinguishing "self from" non-self "by recognizing Human Leukocyte Antigen (HLA) class i molecules on the cell surface to kill or induce apoptosis. At present, NK cells have been widely used in adoptive immunotherapy of tumors. Because NK cells only account for 5% -15% of peripheral blood lymphocytes, the requirement of clinical treatment can be met through in vitro amplification. Experimental studies have shown that in vitro amplified NK cells show good anti-tumor effects in various tumors such as liver cancer, glioblastoma, leukemia, and the like.
Long non-coding RNA (lncRNA) is RNA with the length of more than 200nt and without the function of coding protein, and accounts for 80 percent of non-coding RNA. IncRNA plays an important role in cell life and is crucial to various functions of cells.
Disclosure of Invention
The invention aims to provide a gene target for enhancing NK cell lethality and application thereof.
The above purpose of the invention is realized by the following technical scheme:
a method for enhancing killing power of NK cells in vitro is used for improving the expression level of target genes in the NK cells, wherein the target genes are long-chain non-coding RNAs.
Preferably, the long non-coding RNA is lncRNA-AF 289591.
In the process that NK cells kill target cells, the NK cells are triggered by signals, and first through the degranulation process, Perform and Granzyme B are released to reach the target cells, wherein the Perform is used for perforating a channel on a target cell membrane to further mediate Granzyme B to enter the target cells, and the Granzyme B triggers DNA breakage of the target cells after entering the target cells to enable the target cells to die. CD107a is also an important factor involved in NK cell degranulation. Therefore, one skilled in the art usually evaluates the lethality of NK cells by detecting the expression level of Perforin, Granzyme B, CD107 a. The specific embodiment of the invention shows that the high expression of lncRNA-AF289591 can effectively improve the lethality of NK cells.
Has the advantages that:
the invention discovers that the high-expression lncRNA-AF289591 can effectively improve the lethality of NK cells.
Drawings
FIG. 1 shows the agarose gel electrophoresis determination of the expression level of IncRNA-AF 289591.
FIG. 2 is a flow method for detecting the expression level of Perforin, Granzyme B and CD107 a.
Detailed Description
First, experimental material
The lymphocyte separation solution is purchased from Hangzhou Union Biotechnology corporation under the brand of MultiSciences. IL-2 was purchased from Solaibao, human AB serum was purchased from Shanghai Union Biotech, Inc., and NK cell culture medium brand was CellGro. The reverse transcription kit is purchased from TaKaRa, lncRNA-AF289591mimic, NC-mimic and PCR amplification primers are purchased from Shanghai.
Second, Experimental methods
1. NK cell culture and characterization
Collecting appropriate amount of anticoagulated peripheral blood, adding lymphocyte separation solution, centrifuging at 2000rpm for 20min, sucking leukocyte layer, washing with physiological saline for 3 times, removing supernatant, adding NK cell culture medium (complete culture medium) containing IL-2 200U/mL and human AB serum 50mL/L, adjusting cell density to 1 × 106/mL, inoculated in 6-well plates in 5% CO2Culturing in an incubator at 37 ℃, and adding a culture medium in time according to the growth condition. Cell phenotype was examined by flow cytometry using PerCP-Cy5.5 labeled CD3, FITC labeled CD56 incubated with uninduced (0d) and cultured 12d NK cells.
2. Grouping and transfection
Collecting cultured NK cells of 12 days to obtain cells with density of 2 × 106And inoculating the cell suspension/mL into a 6-well plate, culturing the cell suspension for 24h, and then performing transfection, wherein an lncRNA-AF289591mimic group, an NC-mimic group and a blank control group are respectively arranged, and the transfection mode is performed according to the specification of a Lipofectamine 2000 transfection reagent.
3. IncRNA-AF 289591 content level detection (agarose gel electrophoresis method)
The transfected NK cells were collected, washed, total RNA extracted and RNA concentration determined according to TRIzol kit instructions. After extraction is finished, RNA concentration determination is carried out, and the ratio of A260/A280 is ensured to be more than or equal to 1.8. And carrying out reverse transcription (TaKaRa) on the obtained RNA by adopting a reverse transcription kit, carrying out PCR amplification on cDNA obtained by the reverse transcription, preparing 1.5% agarose gel after the amplification reaction is finished, taking 5 mu L of each PCR product, adding 2 mu L of 6 × loading buffer, mixing and loading, and carrying out 50V electrophoresis for 60 min. And analyzing the optical density value of each strip by using an image analysis system, and photographing. The PCR amplification primer sequences are as follows.
lncRNA-AF289591 forward: GTTGCCGTCCCATCAGTTGC (5 '-3')
lncRNA-AF289591 reverse: TCACTCAAGGTCACCAGCCA (5 '-3')
GAPDH forward: CATGGCACCGTCAAGGCTGA (5 '-3')
GAPDH reverse: GGACTCCACGACGTACTCAG (5 '-3')
4. NK cell killing activity assay (flow method)
Transfected NK cells were collected, washed with PBS and resuspended to a cell density of 1X 107Perform/mL, 0.1mL per tube, and flow cytometry detection was performed by incubation with PE-labeled Perforin (Perforin), PE-labeled granzyme B (granzyme B), and APC-labeled CD107 a.
5. Statistical analysis
Statistical analysis of the data was performed using GraphPad Prism 5 software. Data are expressed as mean ± standard deviation, and the comparison between two groups of data is performed by paired t test, and P < 0.05 indicates that the difference has statistical significance.
Third, experimental results
1. NK cell culture and characterization
The detection result of the flow cytometry shows that the CD3 of the 0d cell－CD56+The positive rate is (10.8 +/-3.7)%, and the cultured 12d NK cells are CD3－CD56+The positive rate is as high as (75.2 +/-6.5)%, the difference has statistical significance, and the NK cell culture is successful.
2. Agarose gel electrophoresis determination of lncRNA-AF289591 expression level
The result is shown in figure 1, compared with a blank control group and an NC-mimic group, the expression level of the lncRNA-AF289591 of the lncRNA-AF289591mimic group is obviously improved, the difference has statistical significance, and the success of constructing the NK cell of the high-expression lncRNA-AF289591 is proved.
3. Flow method for detecting expression levels of Perforin, Granzyme B and CD107a
Results as shown in table 1 and fig. 2, the expression levels of Perforin, Granzyme B, CD107a were significantly increased in the intervention group compared to the control group, and the differences were statistically significant.
TABLE 1 Perforin, Granzyme B, CD107a expression levels
In the process that NK cells kill target cells, the NK cells are triggered by signals, and first through the degranulation process, Perform and Granzyme B are released to reach the target cells, wherein the Perform is used for perforating a channel on a target cell membrane to further mediate Granzyme B to enter the target cells, and the Granzyme B triggers DNA breakage of the target cells after entering the target cells to enable the target cells to die. CD107a is also an important factor involved in NK cell degranulation. Therefore, one skilled in the art usually evaluates the lethality of NK cells by detecting the expression level of Perforin, Granzyme B, CD107 a. Therefore, the high expression of lncRNA-AF289591 can effectively improve the killing power of NK cells.
Claims (2)
1. A method of enhancing NK cell killing in vitro, comprising: and (3) improving the expression level of a target gene in the NK cell, wherein the target gene is long-chain non-coding RNA.
2. The method of claim 1, wherein: the long non-coding RNA is lncRNA-AF 289591.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111162804.8A CN113881671A (en) | 2021-09-30 | 2021-09-30 | Gene target for enhancing killing power of NK (natural killer) cells and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111162804.8A CN113881671A (en) | 2021-09-30 | 2021-09-30 | Gene target for enhancing killing power of NK (natural killer) cells and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113881671A true CN113881671A (en) | 2022-01-04 |
Family
ID=79005020
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111162804.8A Pending CN113881671A (en) | 2021-09-30 | 2021-09-30 | Gene target for enhancing killing power of NK (natural killer) cells and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113881671A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| IL300306A (en) * | 2023-01-30 | 2024-08-01 | Yissum Res Dev Co Of Hebrew Univ Jerusalem Ltd | Methods for cd48 targeted immunotherapy |
-
2021
- 2021-09-30 CN CN202111162804.8A patent/CN113881671A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| IL300306A (en) * | 2023-01-30 | 2024-08-01 | Yissum Res Dev Co Of Hebrew Univ Jerusalem Ltd | Methods for cd48 targeted immunotherapy |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3702459B1 (en) | Method for improving fetal hemoglobin expression | |
| Donahue et al. | Plerixafor (AMD3100) and granulocyte colony-stimulating factor (G-CSF) mobilize different CD34+ cell populations based on global gene and microRNA expression signatures | |
| WO2023123195A1 (en) | Engineered immune cell target gene of which can be regulated, preparation method therefor, and use thereof | |
| JP2014030375A (en) | Method for obtaining monocytes or nk cells | |
| CN108251369B (en) | Immune cell culture medium, culture method and application | |
| CN113881671A (en) | Gene target for enhancing killing power of NK (natural killer) cells and application | |
| CN110438077B (en) | Method for simultaneously culturing NK and gamma delta T cells | |
| CN114540294A (en) | Preparation and application of stem cell exosome for delivering gene drugs to tumor site | |
| CN113502267A (en) | Culture medium and method for NK cell amplification in peripheral blood | |
| CN114787381A (en) | Method for obtaining nucleic acids for sequencing | |
| CN113897334A (en) | Use of PD-1 blocker to enhance NK cell lethality | |
| CN112300992B (en) | NK cell culture solution and multistage activated NK cell culture method | |
| CN111826354A (en) | NK cell and application thereof in tumor treatment | |
| CN114990061B (en) | Culture method for inducing expansion of central memory T cells | |
| CN113069547B (en) | Application of Bap1 as tumor treatment target in preparation of drugs for preventing or treating tumors | |
| CN116496985A (en) | DC-CIK cell and application thereof in preparing tumor cell therapeutic drug | |
| Guo et al. | Puromycin selection confounds the RNA-Seq profiles of primary human erythroblasts | |
| CN116656607B (en) | T cell serum-free culture medium and application thereof | |
| CN103952406A (en) | siRNA of targeting STAT3 gene for inhibiting human malignant brain glioma propagation and its expression vector and use | |
| CN112675201B (en) | Application of macrophage subgroup and regulator thereof in acute graft-versus-host disease | |
| Villiani et al. | Plasmacytoid DC inhibit Th2 driven contact hypersensitivity by altering the DC compartment in skin draining lymph nodes | |
| CN118853580A (en) | LRRC25 gene-deleted macrophage and preparation and application thereof | |
| CN112251466A (en) | CAR-T preparation method with low virus dosage | |
| CN115611975A (en) | Tumor antigen rich in HIF-1A protein, preparation method thereof and application of tumor antigen in preparing DC vaccine | |
| Plaisance-Bonstaff et al. | Isolation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20220104 |
|
| WD01 | Invention patent application deemed withdrawn after publication |