CN110724712A

CN110724712A - Construction method and application of miRNA sponge expression vector

Info

Publication number: CN110724712A
Application number: CN201910954646.6A
Authority: CN
Inventors: 王小文; 黄春; 向小勇; 蒋迎九; 吴庆琛
Original assignee: First Affiliated Hospital of Chongqing Medical University
Current assignee: First Affiliated Hospital of Chongqing Medical University
Priority date: 2019-10-09
Filing date: 2019-10-09
Publication date: 2020-01-24

Abstract

The invention relates to a construction method of a miRNA sponge expression vector, which at least comprises the following steps: (1) introducing a linker sequence containing a first enzyme cutting site into an expression vector skeleton; (2) respectively introducing two ends of a competitive ribonucleotide sequence matched with the target miRNA into sticky ends matched with the first enzyme cutting sites; (3) and (3) inserting the sequence obtained in the step (2) into the expression vector obtained in the step (1) to obtain the miRNA sponge expression vector. The method can obtain a considerable amount of 'sponges' directionally inserted into the MBS only by one-time single enzyme digestion reaction, simplifies the experimental steps, reduces the experimental steps, and ensures the directional insertion of the MBS and the carrier, thereby reducing the meaningless reverse connection of the MBS and increasing the success rate of constructing the miRNA sponge expression carrier.

Description

Construction method and application of miRNA sponge expression vector

Technical Field

The invention relates to the technical field of biology, in particular to a construction method and application of a miRNA sponge expression vector.

Background

Micro RNA (microRNA, miRNA) is non-coding small RNA with the length of about 19-24 nucleotides, which is widely existed in organisms, and has the main function of silencing or cutting target mRNA to inhibit the expression of the target gene at the post-transcriptional level through incomplete or complete complementation with the target gene mRNA, so as to mediate post-transcriptional negative regulation. The number of mirnas in the human genome is about 1% of the entire genome, but can regulate the expression of at least more than 30% of genes. most of miRNA are located in the intron region of mRNA transcript of coding or non-coding protein, and play an important role in controlling organ development, cell differentiation, apoptosis, tumor formation and metastasis and the like. Recent studies have found that mirnas are involved in many important physiological and pathological processes in the field of cardiovascular diseases, such as cardiac development, myocardial remodeling, vascular remodeling, heart failure, and cardiac arrhythmias, among others. mirnas play important regulatory roles in regulating cardiovascular-related diseases, such as VSMC and endothelial cell development, differentiation, and homeostasis in tissues. With the deep understanding of the biological functions of microRNAs, more and more microRNAs participating in the regulation and control of the biological functions and behaviors of VSMCs are continuously discovered.

The common and important means for miRNA function research are function acquisition and function deletion, and the current main methods for miRNA function deletion include gene knockout, oligonucleotide inhibitors and Sponge technology. Oligonucleotide inhibition technology is mainly used for short-term experimental research, and gene knockout technology can be used for long-term experimental research, but a considerable number of miRNAs are located in protein coding regions or in miRNA clusters, so that the gene knockout is challenging in terms of time, cost and technology; the span technology comprises a plurality of antisense binding sites aiming at specific miRNA, namely competitive inhibitory nucleotide sequences (MBS) matched with target miRNA, the MBS can effectively inhibit the expression level of the target miRNA, and can be used as an ideal substitute gene knockout method. In 2007, the construction method of miRNA Sponge is reported for the first time by Ebert MS and the like, and after a plurality of tandem MBS is inserted into an expression vector and expressed in cells, target miRNA can be specifically adsorbed, so that the target miRNA level is effectively reduced, and the miRNA target genes are inhibited. miRNA span has the potential to inhibit all family members with the same seed sequence. Therefore, the mirnaschange technology has its unique advantages when studying the function of the miRNA seed family. Moreover, the functions of different miRNAs can be researched simultaneously by introducing different MBS and miRNA span technologies.

How to directionally insert the designed MBS into the corresponding position of the vector through enzyme digestion reaction reduces meaningless reverse connection to the maximum extent, thereby quickly obtaining an effective sponge expression vector, which is an important difficulty of miRNA sponge construction technology.

Disclosure of Invention

In view of the above-mentioned shortcomings of the prior art, the present invention aims to provide a construction method of a miRNA sponge expression vector and applications thereof.

In order to achieve the above objects and other related objects, a first aspect of the present invention provides a method for constructing a miRNA sponge expression vector, the method at least comprising the following steps:

(1) introducing a linker sequence containing a first enzyme cutting site into an expression vector skeleton;

(2) respectively introducing two ends of a competitive ribonucleotide sequence matched with the target miRNA into sticky ends matched with the first enzyme cutting sites;

(3) and (3) inserting the sequence obtained in the step (2) into the expression vector obtained in the step (1) to obtain the miRNA sponge expression vector.

The second aspect of the invention provides a miRNA sponge expression vector, which comprises an expression vector skeleton, a competitive ribonucleotide sequence and a linker sequence containing a first enzyme cutting site; two ends of the competitive ribonucleotide sequence are respectively provided with a sticky end matched with the first enzyme cutting site; the competitive ribonucleotide sequence is located in the linker sequence; the linker sequence is linked to the expression vector backbone.

In a third aspect, the invention provides a host cell capable of expressing the miRNA sponge expression vector described above.

The fourth aspect of the invention provides the application of the construction method of the miRNA sponge expression vector in miRNA function research.

As described above, the construction method and application of the miRNA sponge expression vector of the present invention have the following beneficial effects:

the research designs a method for quickly constructing the miRNA sponge, and the sponge with considerable quantity of MBS directionally inserted can be obtained only through one single enzyme digestion reaction, so that the method simplifies the experimental steps and reduces the experimental steps, and ensures the directional insertion of the MBS and the carrier, thereby reducing the meaningless reverse connection of the MBS and increasing the success rate of constructing the miRNA sponge expression carrier.

Drawings

FIG. 1 shows a schematic diagram of the strategy for constructing miRNA sponge recombinant expression plasmids in the invention.

FIG. 2 shows a schematic design diagram of miRNA-17-92 MBS and sponge of the invention.

FIG. 3 shows the Linker design sequence containing PupMI cleavage sites.

FIG. 4 shows a schematic diagram of construction of miRNA-17-92 sponge recombinant adenovirus expression vectors.

FIG. 5 shows that the Linker recombinant plasmid was identified by PupMI enzyme digestion.

FIG. 6 shows the sequencing identification of Ad-miR-17-92 sponge recombinant plasmid.

FIG. 7 shows that miR-17-92 sponges containing different MBS inhibit expression of miR-17-92 in VSMC.

Detailed Description

The invention provides a construction method of a miRNA sponge expression vector, which at least comprises the following steps:

In one embodiment, in step (1), the first enzyme cleavage site is selected from a PpuMI cleavage site or a SanDI cleavage site.

A competitive ribonucleotide sequence that is matched to a target miRNA is one that contains a nucleotide sequence that is capable of hybridizing to the target miRNA gene under stringent conditions.

By matching with a target miRNA, it is meant that the competitive ribonucleotide sequence is substantially complementary to 3-20 contiguous nucleotide sequences in the target miRNA gene. Preferably, the competitive ribonucleotide sequence is substantially complementary to 8-18 contiguous nucleotide sequences in the target miRNA; the competitive ribonucleotide sequence is substantially complementary to 12, 13 or 14 consecutive nucleotide sequences in the target miRNA gene.

In one embodiment, in step (2), the sticky end is selected from the group consisting of a 5 '-GTC sticky end and a 3' -CAG sticky end.

In one embodiment, in step (1), the linker sequence further comprises one or more of a PspXI cleavage site, an EcoRV cleavage site, an Xbal cleavage site, and a Bgl II cleavage site.

In one embodiment, the Linker sequence (Linker) comprises in order the Linker sequence comprises in order the PspXI cleavage site, the EcoRV cleavage site, the PpuMI cleavage site, the Xbal cleavage site, and the Bgl II cleavage site.

According to the invention, firstly, Linker containing PupMI enzyme cutting sites is introduced into an expression vector, 5 '-GTC and 3' -CAG sticky ends of the enzyme cutting sites are introduced into the tail end of MBS, and the Linker can be complementarily connected with the Linker subjected to enzyme cutting by PupMI, so that a cut is sealed, a non-enzyme cutting sequence is formed on the left side after connection, the PupMI enzyme cutting sites are kept on the right side, the enzyme cutting reaction is continued to be inserted into the MBS, and the insertion of the MBS is stopped until the enzyme cutting reaction is terminated, so that Sponges with different MBS quantities are generated in a unidirectional directional connection mode.

The linker sequence contains one or more motifs repeated in tandem. For example, the motif may be (5 '-GTCGG-3', 3 '-CCCAG-5'). Preferably, the motifs are adjacent in the linker sequence with no intervening amino acid residues between the repeats. The linker sequence may comprise 1, 2, 3, 4 or 5 repeat motifs. The linker may be 3 to 25 amino acid residues in length, for example 3 to 15, 5 to 15, 10 to 20 amino acid residues. In certain embodiments, the linker sequence is a polyglycine linker sequence. The number of glycines in the linker sequence is not particularly limited, and is usually 2 to 20, such as 2 to 15, 2 to 10, 2 to 8. In addition to glycine and serine, other known amino acid residues may be contained in the linker, such as alanine (a), leucine (L), threonine (T), glutamic acid (E), phenylalanine (F), arginine (R), glutamine (Q), and the like.

In one embodiment, the nucleotide sequence of the linker sequence is as set forth in SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

Specifically, the method comprises the following steps:

Linker:S 5’TCGAGCCTGGATATCGACGGGTCCCGACTCTAGAGACA 3’(SEQ ID NO：1)，

AS 3’CGGACCTATAGCTGCCCAGGGCTGAGATCTCTGTCTAG 5’(SEQ ID NO：2)。

in one embodiment, in step (2), the number of competitive ribonucleotide sequences (MBS) is not less than 2.

In one embodiment, the competitive inhibitory nucleotide sequences are linked to each other by a spacer.

In one embodiment, the spacer sequence is 2 to 8nt in length.

Preferably, the spacer sequence is 4nt in length.

Optionally, the spacer sequence is selected from AATT, TTAA, CCTT or GGTT.

In one embodiment, the competitive ribonucleotide sequence is mismatched to the 9 th to 12 th base of the target miRNA. Preferably, there may be one or more base mismatches between positions 9 and 12.

Base mismatches refer to a-to-C or G pairing, or T-to-G or C pairing, between the competitive ribonucleotide sequence and the target miRNA. Mismatches are either one base plus mismatch reduction or one base plus mismatch increase. Preventing cleavage and degradation by endogenous enzymes.

In one embodiment, the target miRNA is selected from one or more of miR-17-92.

Optionally, the target miRNA is selected from one or more of miR-17, miR-18a, miR-20a, miR-19a/b and miR-92 a.

In one embodiment, the competitive ribonucleotide sequences of miR-17 and miR-20a are identical, and/or the competitive ribonucleotide sequences of miR-19a and miR-19b are identical.

In one embodiment, the competitive ribonucleotide sequences of miR-17 and miR-20a are as set forth in SEQ ID NO: 3, respectively. In particular to miR-17/20a:5 '-CTACCTGCACCCG-AGCACTTTA-3'.

In one embodiment, the competitive ribonucleotide sequence of miR-18 is set forth in SEQ ID NO: 4, respectively. Specifically, the miR-18 a:5 '-CTATCTGCACCCT-TGCACCTTA-3'.

In one embodiment, the competitive ribonucleotide sequences of miR-19a and miR-19b are as set forth in SEQ ID NO: 5, respectively. Specifically, the miR-19a/19 b: 5 '-TCAGTTTTGCCCT-ATTTGCACA-3'.

In one embodiment, the competitive ribonucleotide sequence of miR-92a is as set forth in SEQ ID NO: and 6. In particular, the method comprises the following steps of,

miR-92a:5'-AGCATTGCGATCG-TCCCAACCT-3'。

the expression vector skeleton refers to a DNA molecule which can be connected with a restriction enzyme site, inserted with exogenous DNA, introduced into a receptor cell and replicated by itself.

Further, the expression vector backbone can be a plasmid. In one embodiment, the miRNA sponge expression vector is selected from one or more of a lentiviral vector, an adenoviral vector, a retroviral vector, and AAV.

Optionally, the adenovirus is selected from adenovirus or adeno-associated virus, and the adenovirus vector exemplified in the examples of the present invention is Ad-EGFP.

The miRNA sponge expression vector provided by the invention comprises an expression vector skeleton, a competitive ribonucleotide sequence and a linker sequence containing a first enzyme cutting site; two ends of the competitive ribonucleotide sequence are respectively provided with a sticky end matched with the first enzyme cutting site; the competitive ribonucleotide sequence is located in the linker sequence; the linker sequence is linked to the expression vector backbone.

Further, the miRNA sponge expression vector is prepared by the construction method of the miRNA sponge expression vector.

The host cell provided by the invention can express the miRNA sponge expression vector.

The invention also provides application of the construction method of the miRNA sponge expression vector in miRNA function research.

The competitive ribonucleotide sequence or a fragment thereof of the present invention can be obtained by PCR amplification, recombination or artificial synthesis. For the PCR amplification method, primers can be designed based on the nucleotide sequences disclosed herein, and the sequences can be amplified using a commercially available cDNA library or a cDNA library prepared by a conventional method known to those skilled in the art as a template. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order.

The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention.

Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments, and is not intended to limit the scope of the present invention; in the description and claims of the present application, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise.

When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.

Unless otherwise indicated, the experimental methods, detection methods, and preparation methods disclosed herein all employ techniques conventional in the art of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related arts.

Example 1

Design of recombinant expression plasmid of miRNA sponge

The general strategy for constructing the miRNA sponge recombinant expression plasmid is shown in figure 1, firstly a Linker containing PupMI enzyme cutting sites is introduced into an expression vector, and secondly MBS designed aiming at target miRNA is directionally inserted into the Linker through enzyme cutting reaction.

Design of miR-17-92 MBS and Linker

The miR-17-92 is used as a target research object for experimental design. And designing and synthesizing competitive ribonucleotide inhibition sequences (MBS) matched with the miR-17, miR-18a, miR-20a, miR-19a/b and miR-92a according to the mature sequences of the miR-17, miR-18a, miR-20a, miR-19a/b and miR-92a in the miRbase database, wherein the MBS design of the miR-17 and miR-20a, miR-19a and miR-19b is consistent. Wherein, a mismatch is formed at the 9-12 sites to prevent the endogenous enzyme from shearing and degrading, the two antisense sequences are connected through four basic groups of AATT, and the miR-21 sponge is constructed, and the specific design is shown in figure 2.

In order to introduce PupMI enzyme cutting sites into an adenovirus expression vector, a Linker shown in figure 3 is designed so as to rapidly and continuously insert mi-17-92 MBS in a directional manner.

Construction of miR-17-92 sponge recombinant adenovirus expression vector

A schematic diagram of a construction method of the miR-17-92 sponge recombinant adenovirus expression vector is shown in figure 4.

The specific experimental steps are as follows:

1.1 Annealing reaction of sponge antisense sequence and Linker nucleotide sequence

(1) ddH addition according to the synthetic Olige Specification₂Dissolving O, wherein the final concentration is 100 uM;

(2) taking a PCR tube, and adding 10ul of sense strand and antisense strand respectively;

(3) the analing reaction is as follows:

5min

10min

60min

after the reaction is finished, storing the mixture in a refrigerator at 4 ℃ for later use

(4) PNK reaction

The experimental product obtained in the previous step is subjected to PNK reaction according to the following system:

mixing the reaction system into an EP tube, reacting in water bath at 37 ℃ for 1h, and inactivating PNK enzyme at 70 ℃; because the Buffer of the PNK reaction is consistent with the ligation reaction, the PNK reaction can be used for the next experiment without purification.

1.2 enzyme digestion and purification of Ad-GFP expression vector

1.2.1 enzyme digestion reaction system:

mixing the reaction system into an EP tube, and carrying out enzyme digestion reaction in a water bath tank at 37 ℃ for 3 hours.

1.2.2 purification of the digestion product

And (3) carrying out gel electrophoresis on the enzyme digestion product, then recovering by using a DNA fragment recovery kit, measuring the concentration by using an ultraviolet spectrophotometry, and storing at-20 ℃ for later use. The glue recovery steps are as follows: separating by agarose gel electrophoresis; cutting a target strip, and putting the cut target strip into a 1.5mL centrifuge tube; adding sol solution with 3 times volume to completely melt the sol; transferring the solution to a centrifugal column for centrifugation, centrifuging at 12000rpm at room temperature for 1 minute, pouring out liquid in a collecting pipe, and then putting the adsorption column into the same collecting pipe; adding 700 μ l Washing Buffer A, centrifuging at 13000rpm for 1min, pouring off waste liquid in the collecting tube, and placing the adsorption column into the collecting tube; centrifuging at 13000rpm for 1min, and removing the residual rinsing liquid on the adsorption column; the adsorption column was placed in a clean 1.5ml centrifuge tube, 30-40. mu.l of buffer was added to the center of the adsorption membrane, and after standing at room temperature for 1 minute, it was centrifuged at 1300rpm at room temperature for 1 minute.

1.3 Ad-GFP + Linker ligation

Connecting a Linker of PNK with the linearized vector DNA, wherein the reaction system is as follows:

and (3) carrying out ligation reaction for 3 hours at room temperature, simultaneously setting a control group, carrying out ligation transformation, and paving a plate.

1.4 enzyme digestion and purification of Ad-GFP-Linker expression vector

1.4.1 the enzyme digestion reaction system is as follows:

1.4.2 enzyme digestion product purification: same as experiment step 1.2

1.5 linkage of Ad-GFP-Linker + miR-17-92-Sponge

Connecting miR-17-92-span of PNK with carrier DNA subjected to linearization treatment, wherein the reaction system comprises the following steps:

1.6 ligation transfer, coating plates

(1) Taking out the competent Escherichia coli in a refrigerator at-80 deg.C, and thawing on ice for 5 min;

(2) adding 50 mul of competent escherichia coli into an EP tube containing 4 mul of plasmid DNA (Ad-GFP-miR-17-92), and incubating on ice for 30 min;

(3) moving the EP tube into a water bath at 42 ℃ for heat shock for 90s (accurate timing is needed), and taking care that shaking is not needed;

(4) rapidly moving to ice for 2 min;

(5) adding 500 μ l LB liquid culture medium, resuscitating at 37 deg.C with shaking table at 225rpm/min for 1h to allow bacteria to resuscitate and express plasmid-encoded antibiotic anti-marker gene;

(6) centrifuging at 2000rpm/min-4000rpm/min for 2-10min, sucking out part of supernatant with a pipette, and uniformly coating the residual supernatant with 100 μ l of residual supernatant, after resuspension, uniformly coating the bacteria on an LB plate, and coating competent Escherichia coli without plasmid on another LB plate for marking;

(7) the plates were incubated overnight at 37 ℃ the next day and compared for colony growth.

1.7 plasmid Mini drawers

Selecting the positive colonies detected by the experiment in the previous step, respectively marking the positive colonies in a FALCON tube containing 5ml of an LB culture medium containing the aminobenzene antibiotics, and carrying out shake culture at 37 ℃ and 320rpm/min for overnight; plasmid extraction using plasmid extraction kit (inntron corporation):

① FALCON tube, 5 tubes in total, 4000rpm/min, centrifuging for 10min, discarding the supernatant, and patting on paper to dry the tube wall;

② mu.l of Resuspension Buffer was added and the cells were suspended thoroughly in a shaker;

③ adding 250 μ l lysine Buffer, gently and fully turning and mixing up and down for 10 times until the solution becomes clear, avoiding vortex, and standing at room temperature for 3 min;

④ adding 350 μ l Neutralization Buffer, gently turning over for 8-10 times, standing at room temperature for 5min to avoid violent mixing, and immediately mixing after adding to avoid local precipitation;

⑤ 13000rpm, centrifuging at 4 deg.C for 10min, carefully sucking the supernatant onto the adsorption column (placing the adsorption column into the collection tube), and taking care not to suck out the precipitate;

⑥ 13000 centrifuging at 13000rpm for 1min, pouring out waste liquid in the collecting tube, and placing the adsorption column into the collecting tube;

⑦ adding 500 μ l Washing Buffer A, centrifuging at 13000rpm for 1min, pouring off waste liquid in the collecting tube, and placing the adsorption column into the collecting tube;

⑧ adding 700 μ l Washing Buffer B, centrifuging at 13000rpm for 1min, pouring off waste liquid in the collecting tube, and placing the adsorption column into the collecting tube;

⑨ 13000 centrifuging at 13000rpm for 1min, and removing the residual rinse solution on the adsorption column;

⑩ mu.l of solution Buffer (13000 rpm) was added dropwise to the middle of the adsorption membrane and centrifuged for 1min, and the plasmid solution was collected in a centrifuge tube and the concentration was measured.

1.8 Linker enzyme digestion identification

Carrying out enzyme digestion identification on Ppu MI of a recombinant Linker plasmid obtained by small-amount extraction of the plasmid to determine whether the Linker is inserted into Ad-GFP, and if so, cutting the recombinant plasmid into linearization due to the Ppu MI enzyme digestion site contained in the Linker; and using unmodified Ad-GFP as a control; the enzyme digestion identification reaction system is as follows:

mixing the reaction system into an EP tube, and carrying out enzyme digestion reaction in a 37 ℃ water bath tank for 3 hours; carrying out agarose gel electrophoresis observation imaging on the enzyme digestion product; sequencing is carried out according to enzyme digestion electrophoresis selection.

1.9 sequencing identification

Sequencing the recombinant plasmid obtained by small-scale extraction of the plasmid in the last step by the EGFP-F primer, wherein the sequencing is completed by Shenzhen Huada Gene company.

1.10 miR-17-92 Sponge validity verification

And (3) transfecting the constructed Ad-miR-17-92-Sponge recombinant adenovirus expression vector to VSMC cells, and verifying whether the expression level of miR-17-92 in the cells can be effectively reduced.

4. Results of the experiment

(1) Linker enzyme digestion identification

As shown in FIG. 5, the recombinant Linker plasmid was digested with Ppu MI, and a clear band with a size of about 5200bp was observed by agarose electrophoresis, and no significant bands were observed.

(2) Sequencing identification

As shown in FIG. 6, sequencing of the recombinant plasmid revealed that the sequence of the inserted target fragment was not mutated; sequencing results show that miR-17-92 Sponge sequences are successfully inserted into the Ad-GFP vector, and the nucleotide sequences are not mutated or deleted.

(3) Cell experiment verification

As shown in FIG. 7, in order to verify the effectiveness of miR-17-92 Sponge, VSMC cells (named as miR-SP-6MBS, miR-SP-8MBS and miR-SP-12MBS respectively) are pretreated by miR-17-92 Sponge containing 4 MBS, 8MBS and 12MBS respectively, and are stimulated by PDGF with the concentration of 20ng/ml after starvation for 24 h. Compared with a Control group (Control-SP) and a blank group (Vehicle), the miR-17-92 Sponge can obviously inhibit the expression of miR-17, miR-18a, miR-20a, miR-19b and miR-92a in VSMC, and the inhibition effect is more obvious along with the increase of the MBS quantity.

The above examples are intended to illustrate the disclosed embodiments of the invention and are not to be construed as limiting the invention. In addition, various modifications of the methods and compositions set forth herein, as well as variations of the methods and compositions of the present invention, will be apparent to those skilled in the art without departing from the scope and spirit of the invention. While the invention has been specifically described in connection with various specific preferred embodiments thereof, it should be understood that the invention should not be unduly limited to such specific embodiments. Indeed, various modifications of the above-described embodiments which are obvious to those skilled in the art to which the invention pertains are intended to be covered by the scope of the present invention.

Sequence listing

<110> Chongqing medical university affiliated first hospital

<120> construction method of miRNA sponge expression vector and application thereof

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>38

<212>DNA

<213>Artificial Sequence

<400>1

tcgagcctgg atatcgacgg gtcccgactc tagagaca 38

<210>2

<211>38

<212>DNA

<213>Artificial Sequence

<400>2

cggacctata gctgcccagg gctgagatct ctgtctag 38

<210>3

<211>22

<212>DNA

<213>Artificial Sequence

<400>3

ctacctgcac ccgagcactt ta 22

<210>4

<211>22

<212>DNA

<213>Artificial Sequence

<400>4

ctatctgcac ccttgcacct ta 22

<210>5

<211>22

<212>DNA

<213>Artificial Sequence

<400>5

tcagttttgc cctatttgca ca 22

<210>6

<211>22

<212>DNA

<213>Artificial Sequence

<400>6

agcattgcga tcgtcccaac ct 22

Claims

1. A construction method of miRNA sponge expression vector is characterized in that the preparation method at least comprises the following steps:

2. The method for constructing the miRNA sponge expression vector according to claim 1, wherein: in step (1), the first enzyme cleavage site is selected from a PpuMI cleavage site or a SanDI cleavage site.

3. The method for constructing the miRNA sponge expression vector according to claim 2, wherein: in the step (2), the sticky end is selected from a 5 '-GTC sticky end and a 3' -CAG sticky end.

4. The method for constructing the miRNA sponge expression vector according to claim 2, wherein: in the step (1), the linker sequence further comprises one or more of PspXI enzyme cutting site, EcoRV enzyme cutting site, Xbal enzyme cutting site and Bgl II enzyme cutting site.

5. The method for constructing the miRNA sponge expression vector of claim 4, wherein: the linker sequence sequentially comprises a PspXI enzyme cutting site, an EcoRV enzyme cutting site, a PupMI enzyme cutting site, an Xbal enzyme cutting site and a Bgl II enzyme cutting site.

6. The method of constructing a miRNA sponge expression vector according to claim 1, further comprising one or more of the following features:

1) in the step (2), the number of the competitive ribonucleotide sequences is not less than 2;

2) the competitive ribonucleotide sequence is mismatched with the 9 th to 12 th bases of the target miRNA;

3) the target miRNA is selected from one or more of miR-17-92;

4) the expression vector backbone is selected from one or more of a lentiviral vector, an adenoviral vector, a retroviral vector, and an AAV.

7. The method for constructing the miRNA sponge expression vector of claim 6, wherein: further comprising one or more of the following features:

1) in the feature 1), the competitive ribonucleotide sequences are connected with each other through a spacer sequence;

2) in the characteristic 3), the target miRNA is selected from one or more of miR-17, miR-18a, miR-20a, miR-19a/b and miR-92 a.

8. The method for constructing the miRNA sponge expression vector of claim 7, wherein in characteristic 2), the competitive ribonucleotide sequences of miR-17 and miR-20a are the same, and/or the competitive ribonucleotide sequences of miR-19a and miR-19b are the same.

9. A miRNA sponge expression vector comprises an expression vector skeleton, a competitive ribonucleotide sequence and a linker sequence containing a first enzyme cutting site; two ends of the competitive ribonucleotide sequence are respectively provided with a sticky end matched with the first enzyme cutting site; the competitive ribonucleotide sequence is located in the linker sequence; the linker sequence is linked to the expression vector backbone.

10. The miRNA sponge expression vector of claim 9, wherein the miRNA sponge expression vector is produced by the method of constructing a miRNA sponge expression vector of any one of claims 1-8.

11. A host cell capable of expressing the miRNA sponge expression vector of claim 9 or 10.

12. Use of the method of constructing a miRNA sponge expression vector according to any one of claims 1-8 in miRNA function studies.