CN109988714B

CN109988714B - Trichoderma reesei and application thereof

Info

Publication number: CN109988714B
Application number: CN201711477699.0A
Authority: CN
Inventors: 许丽红; 刘艳萍; 王华明
Original assignee: Qingdao Vland Biotech Group Co Ltd
Current assignee: Qingdao Vland Biotech Group Co Ltd
Priority date: 2017-12-29
Filing date: 2017-12-29
Publication date: 2021-12-28
Anticipated expiration: 2037-12-29
Also published as: CN109988714A; WO2019128454A1

Abstract

The invention relates to the technical field of genetic engineering, and particularly provides a novel trichoderma host and application thereof. The preservation number of the trichoderma is CCTCC NO: M2017796, and the trichoderma can be used for effectively expressing one or more endogenous or exogenous proteins and has an obvious effect.

Description

Trichoderma reesei and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a trichoderma reesei expression host and application thereof in expressing foreign protein.

Background

With the development of genetic engineering technology, people transform microorganisms by using a genetic engineering method in the middle and later 20 th century, and the microorganisms are called genetically engineered bacteria and also called genetically engineered bacteria. The microorganism has the characteristics of high transformation efficiency, rapid propagation, easy culture and easy control, so the genetically engineered bacterium is widely applied and has very wide research prospect. The construction of the genetically engineered bacteria comprises the construction of an optimal expression vector, and is suitable for the processes of selection, transformation, screening and identification of host cells, genetic stability, obtaining of genetically engineered bacteria with plasmids capable of realizing stable inheritance and high-efficiency expression and the like.

Enzymes are applicable to various fields as biocatalysts, and the yield, quality and function of enzymes are important determinants for the application of enzymes to industries. Efficient expression of enzymes is associated with a number of factors: cell growth characteristics, expression levels, intracellular/extracellular expression patterns, post-translational modifications, active proteins, etc., of the host. In order to achieve efficient expression of the enzyme, the choice of enzyme expression system is crucial. Recombinant enzymes have been successfully expressed in a variety of hosts, such as E.coli, Bacillus, yeast, filamentous fungi, and the like.

Among systems for expressing recombinant proteins, Escherichia coli is widely used as an expression host for the most clear understanding of its genetic characteristics and physiology. Most of the currently commercialized genetic engineering products are expressed by escherichia coli, and the most prominent advantages are simple process, high yield, short period, low production cost, and the level of expressed exogenous gene products is far higher than that of other genetic engineering expression systems. However, the system has obvious defects, such as lack of post-translational modifications such as glycosylation, phosphorylation and the like of the expressed protein, which results in that some proteins from eukaryotic sources cannot normally function; high expression causes protein aggregation to form inclusion bodies, resulting in no activity of the expression product; in addition, the expression product is doped with endotoxin or toxic protein contained in Escherichia coli, so that the application of the product in medicine is limited.

The bacillus is widely used as an expression host because of rapid growth, simple culture conditions and clear understanding of genetic background. Bacillus has a good fermentation base and production technology, and can grow to a very high density in a relatively simple medium. The cell wall of bacillus is simple in composition and when the secreted protein crosses the cell membrane, it is processed and released directly into the culture medium. In addition, the protein product secreted by the bacillus is not mixed with substances such as pyrogen lipopolysaccharide and the like in the cell wall components of the gram-negative bacteria, so that the purification of the target protein is relatively simple. In addition, most bacilli are nonpathogenic, possess a set of efficient secretion signal skin and molecular chaperone systems, endow the bacilli with the capability of efficiently secreting target proteins, and in most cases, recombinant proteins secreted by bacilli and derived from eukaryotic sources can have the native conformation and biological activity of the recombinant proteins.

Yeast is a unicellular lower eukaryotic microorganism, has unique advantages as an expression tool, and can grow in a wider range; the expression product can be subjected to posttranslational modification; can perform secretory expression, and is beneficial to the separation and purification of protein; can be used for high-density fermentation and can meet the requirement of industrial production; the strain has been widely used in brewing wine and food industry for a long time, and is safe and reliable. Yeast expression systems have advantages such as post-translational modifications of proteins (e.g., glycosylation), high heat tolerance, high salt tolerance, and the like. Thus, yeast is increasingly used as a gene expression system, particularly in the research of genes in large-molecule eukaryotes.

The filamentous fungus expression system has the advantages of high expression of macromolecular eukaryotic protein, super strong protein secretion capacity, food safety host, etc. Trichoderma and Aspergillus are well-known safe production strains, have a well-established batch fermentation technology and strong protein extracellular secretion capacity, and have attracted extensive attention for their transformation systems and expression of foreign genes. The trichoderma expression system is a system for exogenous gene expression emerging in recent years, can overcome the defect that specific post-translational modification cannot be carried out in a prokaryotic expression system, has higher capability of secreting exogenous protein than saccharomyces cerevisiae, and therefore becomes an important way for producing eukaryotic protein with biological activity.

However, most of trichoderma can synthesize certain cellulase, so that the expressed enzyme system is a mixed enzyme system, and the separation and purification of target protein are difficult, thereby directly limiting the application of the trichoderma as a cellulase expression host. In addition, numerous studies have shown that the expression level of foreign proteins by Trichoderma is not as high as expected. Therefore, it is a hot and difficult point to develop a novel expression system and find more and more efficient methods for expressing foreign proteins.

Disclosure of Invention

The invention aims to provide a trichoderma reesei host which is used for recombinant expression of exogenous or endogenous genes, so that the protein expression quantity is remarkably improved, and the application prospect is wide.

The invention firstly provides Trichoderma reesei which is Trichoderma reesei O11-8U (Trichoderma reesei O11-8U) and is preserved in China center for type culture collection of Wuhan university in Wuhan, China in 2017, 12 months and 15 days, wherein the preservation number is CCTCC NO: M2017796.

The trichoderma reesei hosts of the present invention can be used to efficiently express one or more endogenous or exogenous proteins.

The protein is selected from one or more of hemicellulase, peroxidase, protease, cellulase, xylanase, lipase, phospholipase, esterase, cutinase, pectinase, keratinase, reductase, oxidase, phenoloxidase, lipoxygenase, ligninase, pullulanase, tannase, pentosanase, malanase, beta-glucanase, arabinosidase, hyaluronidase, chondroitinase, laccase, amylase and glucoamylase.

The protein is selected from acetyl esterase, aminopeptidase, amylase, arabinase, arabinofuranosidase, carboxypeptidase, catalase, cellulase, chitinase, chymosin, cutinase, deoxyribonuclease, epimerase, esterase, alpha-galactosidase, beta-galactosidase, alpha-glucanase, glucan lyase, endo-beta-glucanase, glucoamylase, glucose oxidase, alpha-glucosidase, beta-glucosidase, glucuronidase, hemicellulase, hexose oxidase, hydrolase, invertase, isomerase, laccase, lipase, lyase, mannosidase, oxidase, oxidoreductase, pectate lyase, pectin acetylesterase, pectin depolymerase, pectin methylesterase, pectin lyase, peroxidase, pectinase, xylanase, isomerase, laccase, lipase, lyase, mannosidase, glucosidase, xylanase, laccase, xylanase, a lipase, a xylanase, a lipase, a xylanase, a lipase, a xylanase, a lipase, a xylanase, a lipase, a xylanase, a lipase, a xylanase, any one or more of phenol oxidase, phytase, polygalacturonase, protease, rhamnogalacturonase, ribonuclease, thaumatin, transferase, transport protein, transglutaminase, xylanase and hexose oxidase.

In another aspect, the present invention provides a recombinant strain of trichoderma reesei, which is obtained by transforming an expression vector carrying a desired gene into the above trichoderma reesei host cell.

Preferably, the target gene is a cellulase gene;

one nucleotide sequence of the cellulase gene is SEQ ID NO. 5, and the coded amino acid sequence is SEQ ID NO. 6.

One nucleotide sequence of the cellulase gene is SEQ ID NO. 7, and the coded amino acid sequence is SEQ ID NO. 8.

The expression vector is, as a specific choice of the examples, the PC2G vector.

The Trichoderma reesei recombinant strain is used for producing cellulase.

The invention takes Trichoderma reesei U11-4 as an original strain, and the mutant strain Trichoderma reesei O11-8U obtained by mutagenesis can be used as a novel host cell and is generally applied to the recombinant expression of endogenous or heterologous genes. The recombinant strain constructed by taking the mutant strain trichoderma reesei O11-8U as the host cell can efficiently express cellulase NCE5, the fermentation enzyme activity of the recombinant strain reaches 86U/mL, the protein amount reaches 0.62mg/mL, and the cellulase NCE5 is respectively increased by 56.4% and 51.2% compared with a control strain constructed by taking the original strain trichoderma reesei U11-4 as the host cell; the trichoderma reesei O11-8U can also efficiently express cellulase TT45, the fermentation enzyme activity of a recombinant strain constructed by taking the trichoderma reesei as a host reaches 60.89U/ml, the protein content reaches 0.59mg/ml, the fermentation enzyme activity is respectively improved by 83.1% and 78.8% compared with a control strain constructed by taking an original strain as a host cell, and the effect is obvious.

Drawings

FIG. 1: SDS-PAGE electrophoresis detection analysis chart; wherein lane 1 is a fermentation supernatant of a control strain Trichoderma reesei U11-4-NCE5, and lane 2 is a fermentation supernatant of Trichoderma reesei O11-8U-NCE 5. The protein band indicated by the arrow is cellulase NCE 5.

Detailed Description

The applicant obtains a Trichoderma reesei strain which does not secrete cellulase by knocking out four genes, namely CBH1, CBH2, EG1 and EG2, in wild type Trichoderma reesei (Trichoderma reesei) by a gene knock-out method, and the Trichoderma reesei strain is named Trichoderma reesei U (Trichoderma reesei U).

The applicant further obtains a mutant strain trichoderma reesei 11 by screening through ultraviolet mutagenesis on trichoderma reesei U, wherein the mutant strain trichoderma reesei U11 has thick and short hypha form, compact hypha and more branches, can obviously reduce the viscosity of a zymophyte liquid, achieves the purposes of reducing the stirring speed and improving the dissolved oxygen, and is more beneficial to high-density fermentation of the strain. Trichoderma reesei U11 can be used as a novel host cell and is generally applied to recombinant expression of endogenous or heterologous genes. The recombinant strain trichoderma reesei constructed by taking the mutant strain trichoderma reesei U11 as a host cell can efficiently express NCE5 and glucose transferase genes, the fermentation enzyme activities of the recombinant strain trichoderma reesei are respectively 412U/mL and 3550U/mL, and are respectively improved by 43.1% and 50.4% compared with a control strain. In addition, the applicant also expressed saccharifying enzyme, glucose oxidase, pectinase, amylase, etc. in mutant host U11. Compared with a control host Trichoderma reesei U, the mutant strain host U11 has 40-60% higher expression level of the genes, and has unexpected effect.

The applicant has deposited the above mutant strain Trichoderma reesei U11(Trichoderma reesei U11) in the China center for type culture Collection, CCTCC NO: M2016726, at 2016, 12, 7.

Example 1 deletion of cellobiohydrolase (CEL74a) Gene

1.1 construction of CEL74a Gene knockout expression cassette

First, the total genomic DNA of trichoderma reesei was extracted: inoculating Trichoderma reesei into PDA culture medium, culturing for 7 days, taking 1cm × 1cm bacterial block, placing in 1.5mL centrifuge tube, adding 400 μ l lysis buffer (60mM Tris-HCl, pH7.8,20mM Na-Ac,1mM EDTA, 1.5% SDS), and shaking vigorously with bead mill for 2.5 min; water bath at 65 deg.C for 20min, adding 200 μ l 10M ammonium acetate solution, mixing, ice-cooling for 10min, centrifuging at 12000rpm for 10min, and collecting supernatant; adding phenol with the same volume for extraction once, centrifuging at 12000rpm for 2 minutes, and taking supernatant; adding equal volume of isopropanol for precipitation for 5 minutes, and centrifuging at 12000rpm for 5 minutes; washing twice with 70% ethanol; finally, the dried DNA was dissolved in ddH 2O.

The method is characterized in that the genome DNA of trichoderma reesei is used as a template to amplify the upstream and downstream sequences of the trichoderma reesei Cel74a gene (the nucleotide sequence is SEQ ID NO:1), wherein the primer sequences used by the upstream segment are as follows:

Cel74aEcoR1-5F:GTACGAATTCGTAATGGAGATGAGCTCACTTC

Cel74aXba1-5R:GTAC TCTAGA TGCTAGAGTC TGTCTCGGAG

the sequences of the primers used for the downstream fragment were:

Cel74aMlu1-3F:GTACACGCGTCTCCAACTCCCTATTGCAAATC、

Cel74aSph1-3R:GTACGCATGCGAACACCCGCGACGGGTTGAACT；

the gene is amplified from Trichoderma reesei genomic DNA upstream and downstream by Phusion DNA polymerase (Thermo scientific). PCR amplification conditions were 95 ℃ for 4 min; 30S at 94 ℃; 30 cycles of 40S at 55 ℃ and 1min at 72 ℃; 7min at 72 ℃. And recovering the PCR amplification product by using a gel recovery kit.

An Aspergillus niger pyrG label is adopted when the knockout box is constructed, an Aspergillus niger genome is extracted by the method and used as a template, a pyrG fragment is amplified by the following primers, and the amplified fragment is connected with a pMD18T vector after being recovered by glue.

pyrG F：CGCCGTCGTG TCTCGTCTCC

pyrG R：GCCGCTGGTCAATGTTATCTGGTAT

After the vector is connected, Escherichia coli is transformed, positive transformants are selected for sequencing, and the sequenced plasmid is named pyrG4-pMD 18T.

The plasmid pyrG4-pMD18T and the upstream fragment of the Cel74a gene were digested simultaneously with restriction enzymes EcoRI and XbaI, and the digested fragments were purified using a PCR purification kit. The purified fragment and the target gene fragment are ligated by T4 ligase. The ligation product was transformed into Trans 5. alpha. E.coli (Transgen) and selected with ampicillin. To ensure accuracy, several clones were sequenced (Invitrogen). After sequencing, a positive transformant plasmid was extracted, named pMD18T-pyrG 4-5F.

Meanwhile, the purified downstream PCR product is digested by restriction enzymes Mlu1I and SphI (Fermentas) and digested by plasmid pMD18T-pyrG 4-5F. The cleavage products were purified using a gel purification kit and ligated with T4 DNA ligase (Fermentas). The ligation product was transformed into Trans 5. alpha. E.coli (Transgen) and selected with ampicillin. To ensure accuracy, several clones were sequenced (Invitrogen).

Plasmids were purified from E.coli clones with correct sequencing using a plasmid quantitation kit (Axygen). The resulting 1 knock-out plasmid was Δ Cel74a-pMD 18T.

1.2 transformation and selection

1.2.1 protoplast preparation

Inoculating Trichoderma reesei U11(CCTCC NO: M2016726) hypha to grow on PDA plate for 7 days; colonies with a diameter of about 2cm were excised and placed in about 100ml of YEG + U (0.5% yeast powder, 1% glucose, 1% uridine) liquid medium,shaking and culturing at 30 deg.C and 200rpm overnight; filtering with multiple layers of gauze to collect mycelia; placing the mycelium in 20ml of lyase solution (Sigma L1412) for enzymolysis for 2 hours; taking out the enzymolysis solution, adding 0.7M NaCl solution, shaking gently, pouring into three layers of sterilized mirror paper for filtering, collecting filtrate, centrifuging at 3000rpm for 10 min; the supernatant was discarded, and 10-20ml of STC solution (20% sucrose, 50mM Tris-Cl, 50mM CaCl) was added₂) Suspending, 3000rpm, and centrifuging for 10 min; adding appropriate amount of STC, suspending and subpackaging (150 μ l/tube, 10)⁸Pieces/ml).

1.2.2 transformation and validation

Add 10. mu.g of. DELTA.Cel 74a-pMD18T plasmid DNA into 200. mu.l of protoplast, then add 50. mu.l of 25% PEG and mix gently, stand for 20min at room temperature; then, 2ml of 25% PEG was added again, the mixture was gently mixed, and the mixture was allowed to stand at room temperature for 5min, and then 4M 1.2M sorbitol was added thereto and the mixture was left to stand at room temperature. Adding protoplast to about 50ml of upper semi-solid culture medium (0.1% MgSO. RTM.) which is melted and cooled to 45-55 deg.C₄,1％KH₂PO4,0.6％(NH₄)₂SO₄1% glucose, 18.3% sorbitol, 0.35% agarose), gently mixed and poured into the lower basal medium plate (2% glucose, 0.5% (NH4)₂SO₄,1.5％KH₂PO₄,0.06％MgSO₄,0.06％CaCl₂1.5% agar), cultured at 30 ℃ in the dark for several days until transformants grew.

Transformants were verified by amplification of the Cel74a gene using genomic inner primers (Cel74 a-Fs: TATTCCGCTCCACAGACTCGGGCA; and Cel74 a-Ra: ATTCTGCTTC TGGCAGACAT ACGG) by extracting transformant genomic DNA as a template according to the method described in example 1.1. PCR amplification conditions were 95 ℃ for 4 min; 30S at 94 ℃; 40S at 59 ℃, 1min at 72 ℃ for 30 cycles; 7min at 72 ℃.

Transformants which were not amplified to the Cel74a gene were cross-verified using two pairs of primers, genomic CEL74A-F and pyrGR and pyrGF and CEL74A-R, respectively. PCR amplification conditions were 95 ℃ for 4 min; 30S at 94 ℃; 40S at 59 ℃, 3min at 72 ℃ for 30 cycles; 7min at 72 ℃.

The sequences of the two pairs of primers are as follows:

CEL74A-F:AAGTAGTGAGCGCAGCCAACATAC

CEL74A-R:GATTGTGAGA AGCAGGTTGT TGCTG

the two pairs of cross primers can amplify target fragments of about 4k, and the successful knockout of the CEL74A gene in Trichoderma reesei U11 is proved. The applicant named the knocked-out strain Trichoderma reesei U11-1(Trichoderma reesei U11-1).

By the same method, the applicant knocks out 3 genes of EG III (nucleotide sequence is SEQ ID NO:2), XYN III (nucleotide sequence is SEQ ID NO:3) and BGL (nucleotide sequence is SEQ ID NO:4) in Trichoderma reesei U11 in sequence.

The applicant named Trichoderma reesei U11 strain with CEL74A, EG III, XYN III and BGL4 genes knocked out as Trichoderma reesei U11-4(Trichoderma reesei U11-4).

Example 2 UV mutagenesis and screening

The applicant takes trichoderma reesei U11-4 as a spawn, and further screens mutant bacteria with small bacterial colonies and increased hypha branches by ultraviolet mutagenesis.

Trichoderma reesei U11-4 was inoculated to a fresh PDA plate and cultured at 30 ℃ for 5-7 days. When the colony surface turns white and a large amount of spores are produced, 5ml of sterile water is absorbed for elution to obtain a spore liquid, the spore liquid is suspended by the sterile water after centrifugation, and a blood counting plate is used for counting to ensure that the concentration of the spores is about 5 multiplied by 10⁷One per ml. A rotor was placed in a 90mm sterile petri dish, 10ml of diluted spore suspension was added, and the mixture was stirred on a magnetic stirrer to keep the spore liquid in a uniform state. Irradiating with ultraviolet lamp with power of 9w at vertical distance of 20cm in sterile ultra-clean bench for 60s, 90s, 120s, 150s, and 180s, respectively. Diluting the irradiated spore solution by 10000 times, uniformly coating 100ul of the diluted spore solution on a PDA plate, culturing at 30 ℃ for 2-3d, counting, and calculating the lethality by taking the spore solution which is not irradiated by ultraviolet as a control. The result shows that the lethality of the trichoderma reesei spores is 90% when the trichoderma reesei spores are irradiated for 120s by ultraviolet, so that the irradiation time is selected for carrying out subsequent mutagenesis experiments.

Mutagenesis screening: placing a rotor into a 90mm sterile culture dish, and adding 10ml of diluted spore suspension (5 × 10 concentration)⁷Pieces/ml). Stirring on a magnetic stirrer to make spore liquid in a uniform state. In a sterile ultra-clean workbench, an ultraviolet lamp with power of 9w is used for vertical distanceIrradiating for 120s from the upper part of 20cm, and then standing in dark for 30 min. Diluting the spore suspension by 10000 times, taking 100ul of the spore suspension, uniformly coating the spore suspension on a PDA plate, culturing at 30 ℃ for 2-3d, simultaneously coating the PDA plate by the same method by taking the original strain Trichoderma reesei U11-4 as a control group, and culturing at 30 ℃ for 2-3 d.

Applicants have plated 130 PDA plates in total, each plate growing about 50 colonies. By observing colony morphology and comparing with the original strain Trichoderma reesei U11-4, 177 mutants with obvious variation in colony morphology are selected, respectively inoculated to PDA rescreened plates (each plate is evenly inoculated with 12 mutants), and cultured for 2-3d at 30 ℃.

Finally, the applicant screened 29 Trichoderma reesei mutant bacteria with obviously reduced colony morphology, dense mycelia and more branches. The mutant bacteria have the advantages of short mycelium, high dissolved oxygen level, low viscosity of fermentation liquor and the like in the amplification fermentation process.

Example 3 uracil auxotrophy screening of Trichoderma reesei expression hosts

5-fluoroorotic acid can induce thalli to lack orotidine transferase or orotidine monophosphate decarboxylase in a uracil nucleotide synthesis pathway, so that 5-fluoroorotic acid cannot form toxic substance 5-fluorouracil nucleotide, and resistance to 5-fluoroorotic acid is generated, pyrimidine nucleotide nutrition can be supplemented by adding uracil into a culture medium, and therefore a uracil auxotrophic strain formed by induction of 5-fluoroorotic acid can grow in the culture medium containing 5-fluoroorotic acid and uracil; the wild-type strain was not resistant to 5-fluoroorotic acid and could not grow under the culture conditions containing 5-fluoroorotic acid. Therefore 5-fluoroorotic acid is commonly used to screen uracil-deficient mutants.

Spores of 29 strains of the mutant strain of Trichoderma reesei screened in example 2 were each diluted to about 1X 10 with 0.1% Tween-20 solution⁷Per mL; the spore suspension was then spread evenly on a minimal solid medium (2% glucose, 0.5% (NH) containing 1.5g/mL 5-fluoroorotic acid and 1.87g/mL Uridine (Uridine)₄)₂SO₄,1.5％KH₂PO₄,0.06％MgSO₄,0.06％CaCl₂1.5% agar) plates, each coated with about 1X 10⁶Culturing spores at 30 deg.C for 7 days. The results showed that different numbers of colonies were grown on the plates of each mutant, indicating that these colonies are likely uracil-deficient strains of the corresponding mutant.

Colonies growing on the plates corresponding to each of the above-mentioned mutant bacteria were picked, and each colony was plated on a minimal medium plate and a minimal medium plate containing 1.87g/mL of Uridine, respectively, for verification. A true uracil auxotrophic strain can only grow on minimal medium plates containing Uridine, but not in minimal medium plates lacking Uridine. Finally, the applicant obtained 29 Trichoderma reesei mutant strains through ultraviolet mutagenesis in example 2, wherein each mutant strain corresponds to 1 uracil-deficient strain with the best growth state, and the 29 strains are named as Trichoderma reesei O11-1U, O11-2U, O11-3U, O11-4U, … … and O11-29U respectively.

To further determine the stability of the 29 uracil auxotrophic mutant strains, they were each cultured in a liquid minimal medium (2% glucose, 0.5% (NH)₄)₂SO₄,1.5％KH₂PO₄,0.06％MgSO₄,0.06％CaCl₂) The culture was shaken for 7 days to observe whether it could grow, and the experiment was repeated 3 times. The results of the experiments showed that 29 uracil-deficient mutant strains failed to grow in the liquid minimal medium lacking Uridine.

Example 4 expression of neutral cellulase Gene NCE5 in Trichoderma reesei mutant bacteria

In order to verify the expression efficiency of the mutant strains Trichoderma reesei O11-1U, O11-2U, O11-3U, O11-4U, … … and O11-29U on target genes, the applicant selects the neutral cellulase gene NCE5 (the nucleotide sequence of which is SEQ ID NO:5 and the coding amino acid sequence of which is SEQ ID NO:6) derived from Trichoderma reesei to be expressed in the original strain Trichoderma reesei U11-4 and the mutant strains respectively.

4.1 extraction of Trichoderma reesei Total genomic DNA

Inoculating Trichoderma reesei into a shake flask culture medium for overnight culture, taking a proper amount of thalli to place in a centrifuge tube, centrifuging at 13000rpm for 5min, and discarding the supernatant; add 400. mu.l of extraction buffer (100mM TrisHCl,100mM EDTA,250mM NaCl, 1% SDS); then adding 100mg of quartz sand or glass beads, and violently oscillating in a bead beating instrument for about 2 min; water bath is carried out in a water bath kettle at 65 ℃ for 20min, 200 mul of 10M NH4AC is added for ice bath for 10 min; centrifuging at 13000rpm for 10min, collecting supernatant, adding 2 times volume of anhydrous ethanol, and standing at-20 deg.C for 30 min; centrifuging at 13000rpm for 10min, discarding supernatant, and washing with 70% ethanol for 2 times; air drying, adding appropriate amount of water, dissolving at-20 deg.C, and storing.

4.2 cloning of the Gene

PCR amplification was performed using the total genomic DNA extracted in 4.1 as a template, using primers anl-F and anl-R (TCTAGAGGAGCGGCAGTCCGGCAGCGGCC and AGTTAGTTAGCACTCAAGGG A). PCR amplification conditions were 95 ℃ for 4 min; 30 cycles of 94 ℃ 30S, 59 ℃ 40S, 72 ℃ 1 min; 7min at 72 ℃. And recovering the PCR amplification product by using a gel recovery kit.

4.3 sequencing analysis

The amplification product recovered in 4.2 was ligated to PC2G vector to obtain the clone vector NCE5-PC2G plasmid, which was sent to Beijing Huada Gene research center for sequencing analysis. As a result of sequencing, the nucleotide sequence of the amplification product is SEQ ID NO. 5, and the coding amino acid sequence thereof is SEQ ID NO. 6. The results of multiple clones demonstrated that no amplification errors occurred.

4.4 transformation and selection

4.4.1 protoplast preparation

Inoculating Trichoderma reesei mutant O11-1U hyphae obtained in example 3 to grow for 7 days on a PDA plate; cutting colonies with a diameter of about 3cm, placing in about 60ml YEG (0.5% yeast powder, 1% glucose, 0.1% Uridine) liquid medium, and culturing overnight at 30 deg.C under shaking at 200 rpm; filtering with multiple layers of gauze to collect mycelia; placing the mycelium in 20ml of lyase solution (Sigma L1412) for enzymolysis for 2 hours; taking out the enzymolysis solution, adding 0.7M NaCl solution, shaking gently, pouring into three layers of sterilized mirror paper for filtering, collecting filtrate, centrifuging at 3000rpm for 10 min; the supernatant was discarded, and 10-20ml of STC solution (20% sucrose, 50mM Tris-Cl, 50mM CaCl) was added₂) Suspending, 3000rpm, and centrifuging for 10 min; adding appropriate amount of STC, suspending and subpackaging (200 μ l/tube, 10)⁸Pieces/ml).

4.4.2 transformation and validation

Adding 10 μ g NCE5-PC2G DNA into 200 μ l protoplast, adding 50 μ l 25% PEG, mixing, and standing at room temperature for 25 min; adding 2ml 25% PEG 2-3 times, mixing, standing at room temperature for 25min, adding 50ml upper semisolid culture medium (0.1% MgSO) which is melted and cooled to 45-55 deg.C₄,1％KH₂PO4,0.6％(NH₄)₂SO₄1% glucose, 18.3% sorbitol, 0.35% agarose), gently mixed and poured into the lower basal medium plate (2% glucose, 0.5% (NH4)₂SO₄,1.5％KH₂PO₄,0.06％MgSO₄,0.06％CaCl₂1.5% agar), cultured at 30 ℃ in the dark for several days until transformants grew. And (3) selecting a positive transformant with the highest cellulase expression amount through shake flask fermentation, and naming the positive transformant as trichoderma reesei O11-1U-NCE 5.

By adopting the same method, Trichoderma reesei mutant strains O11-2U, O11-3U, O11-4U, … … and O11-29U are respectively used as host cells to construct and obtain Trichoderma reesei recombinant strains for recombinant expression of neutral cellulase NCE5, and positive transformants with the highest expression level are correspondingly selected and named Trichoderma reesei O11-2U-NCE5, O11-3U-NCE5, O11-4U-NCE5 … … and O11-29U-NCE 5.

Meanwhile, the original strain trichoderma reesei U11-4 is used as a control host, the same method is adopted to construct a trichoderma reesei recombinant strain for recombinant expression of neutral cellulase NCE5, and a positive transformant with the highest expression quantity is correspondingly selected and named as trichoderma reesei U11-4-NCE5 to serve as a control strain.

4.5 fermentation validation

The constructed control strain Trichoderma reesei U11-4-NCE5 and the recombinant strain Trichoderma reesei O11-1U-NCE5, O11-2U-NCE5, O11-3U-NCE5 … … and O11-29U-NCE5 constructed by taking mutant strains O11-1U, O11-2U, O11-3U, … … and O11-29U as host cells are respectively inoculated in a shake flask culture medium (10 g/L of glucose, 10g/L of liquid sugar, 15g/L of corn steep liquor, 9g/L of ammonium sulfate, 5-10g/L of magnesium sulfate, 20g/L of potassium dihydrogen phosphate and 4g/L of diammonium hydrogen phosphate) at 30 ℃ and 200rpm for 48 hours, and then the temperature is controlled to be 25 ℃ and the fermentation is carried out for 3 days. Respectively taking fermentation supernatant to determine the enzyme activity of the cellulase in the fermentation supernatant.

(1) Enzyme activity measuring method

The amount of enzyme required for degrading and releasing 1. mu. mol of reducing sugar, which is equivalent to glucose, from a sodium carboxymethylcellulose solution having a concentration of 5mg/ml per minute at 50 ℃ and a pH of 4.8 (neutral pH of 6.0) is one enzyme activity unit U.

Adding 0.5mL CMC substrate into each of the three test tubes, and preheating with the enzyme solution to be tested in 50 deg.C water bath for 5 min. 0.5mL of the solution to be detected was added to each of the first and second test tubes, and the mixture was reacted in a water bath at 50 ℃ for 15min while counting the time. After the reaction, 1.5mL of LDNS reagent is added into each of the three test tubes, and 0.5mL of enzyme solution to be detected is added into the third test tube. The three tubes were taken out and shaken up, and then reacted for 5min in a boiling water bath. It was rapidly cooled to room temperature and adjusted to 5.0mL with water. And (3) measuring the absorbance of the first and second test tube solutions at 540nm wavelength by using the third test tube solution as a control, preferably, the absorbance is 0.25-0.35. The absolute value of the difference between the absorbance of the enzyme liquid reaction solution to be detected and the absorbance of the enzyme liquid reaction solution for horizontal control is not more than 0.015.

Enzyme activity X ═ (glucose equivalent/180/15/0.5). times.n

Wherein X is enzyme activity unit, IU/g (mL);

180-conversion of glucose from micrograms to micromoles;

15-reaction time of the solution to be tested and the substrate;

0.5-the amount of enzyme solution to be measured added;

n is dilution multiple;

(2) results of enzyme Activity measurement

The enzyme activity of fermentation supernatant of a control strain Trichoderma reesei U11-4-NCE5 constructed by taking original strain Trichoderma reesei U11-4 as a control host is 55U/mL, the protein content is 0.41mg/mL, recombinant strains Trichoderma reesei O11-1U-NCE5, O11-2U-NCE5, O11-3U-NCE5 … … and O11-29U-NCE5 constructed by taking mutant strains O11-1U, O11-2U, O11-3U, … … and O11-29U as host cells have the fermentation enzyme activity of about 71-86U/mL and the protein amount of about 0.55-0.62mg/mL, which indicates that the cellulase gene NCE5 is effectively expressed in the original strain Trichoderma reesei U11-4 and the mutant strains O11-1U, O11-2U, O11-3, O … … -11, and the expression level in the mutant bacteria is obviously higher than that of the original bacteria. The recombinant strain trichoderma reesei O11-8U-NCE5 constructed by taking the mutant strain O11-8U as a host cell has the highest fermentation enzyme activity of 86U/mL and the highest protein content of 0.62mg/mL, is increased by 56.4% and 51.2% compared with a control strain, and obtains unexpected technical effects.

SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) detection is carried out on fermentation supernatant of a control strain Trichoderma reesei U11-4-NCE5 and a recombinant strain Trichoderma reesei O11-8U-NCE5 constructed by taking a mutant strain O11-8U as a host cell, and the result is shown in figure 1, compared with the control strain, the expression level of a target protein NCE5 (indicated by an arrow) in Trichoderma reesei O11-8U-NCE5 is obviously improved.

The applicant has deposited the above mutant strain Trichoderma reesei O11-8U (Trichoderma reesei O11-8U) in China center for type culture Collection, CCTCC NO: M2017796, 12, 15, 2017 at Wuhan university, Wuhan, China.

Example 5 expression of cellulase TT45 in Trichoderma reesei O11-8U

With reference to the method described in example 4, a Trichoderma reesei genome was extracted, and PCR amplification was performed using the following primers to obtain cellulase TT45 gene fragment (nucleotide sequence: SEQ ID NO:7, amino acid sequence: SEQ ID NO: 8).

TT45-KpnI-F：CGGGGTACCATGCGATCTACCCCGGTCC

TT45-MluI-R:CGACGCGTTCAGAGGCACTGAGAGTAGTAG

Connecting the cellulase TT45 gene segment to a PC2G vector to obtain a recombinant vector; and then transforming the recombinant vector into a host cell Trichoderma reesei O11-8U to construct a Trichoderma reesei recombinant strain for recombinant expression of cellulase TT45, and selecting a positive transformant with the highest expression quantity, namely Trichoderma reesei O11-8U-TT45(Trichoderma reesei O11-8U-TT 45).

Meanwhile, the original strain trichoderma reesei U11-4 is used as a control host, the trichoderma reesei recombinant strain for recombinant expression of cellulase TT45 is constructed by the same method, and a positive transformant with the highest expression quantity is correspondingly selected and named as trichoderma reesei U11-4-TT45 and used as a control strain.

The constructed trichoderma reesei O11-8U-TT45 and the control bacterium trichoderma reesei U11-4-TT45 are respectively inoculated in a shake flask culture medium (10 g/L glucose, 10g/L liquid sugar, 15g/L corn steep liquor, 9g/L ammonium sulfate, 5-10g/L magnesium sulfate, 20g/L potassium dihydrogen phosphate and 4g/L diammonium hydrogen phosphate) at 30 ℃, and after shaking culture at 200rpm for 48 hours, the temperature is controlled to be 25 ℃, and fermentation is carried out for 3 days. The fermentation supernatants were each taken to determine the cellulase activity (enzyme activity determination method reference example 4.5).

The enzyme activity measurement result shows that: the fermentation enzyme activity of the control bacterium trichoderma reesei U11-4-TT45 is 33.26U/ml, the protein content is 0.33mg/ml, the fermentation enzyme activity of the trichoderma reesei O11-8U-TT45 is as high as 60.89U/ml, the protein content is as high as 0.59mg/ml, the fermentation enzyme activity is improved by 83.1% and 78.8% compared with the control bacterium, and the effect is obvious. The result also shows that the expression quantity of the cellulase TT45 in the recombinant strain constructed by taking the mutant strain trichoderma reesei O11-8U as the host cell is far higher than that of the recombinant strain constructed by taking the original strain trichoderma reesei U11-4 as the host cell.

In addition, the applicant also expressed the glucosidase, dextranase, pectinase, catalase, etc. in the mutant bacterial host O11-8U. Compared with the original strain host Trichoderma reesei U11-4, the mutant strain host O11-8U has the advantages that the expression quantity of the genes is improved by more than 30%, and the effect is obvious.

In conclusion, the mutant strain Trichoderma reesei O11-8U (Trichoderma reesei O11-8U) obtained by mutagenesis by taking Trichoderma reesei U11-4 as an original strain can be used as a novel host cell and is generally applied to recombinant expression of endogenous or heterologous genes, so that the yield of protein is increased, and the production cost is reduced.

Sequence listing

<110> Islands blue biological group Co Ltd

<120> novel trichoderma and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2517

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgaaggtct ctcgagtcct tgcccttgtc ctgggggccg tcatccctgc ccatgctgcc 60

ttttcatgga agaacgtcaa gctcggcggc ggcggcggct tcgtccccgg catcatcttc 120

catcccaaga caaaaggcgt agcatatgca cgaacagata ttggcgggct gtaccgcctc 180

aacgccgacg actcatggac cgccgtcacg gatgggattg ctgataatgc cggctggcac 240

aactggggca tcgacgctgt tgcgcttgat ccgcaggacg atcaaaaggt gtatgccgca 300

gtcggcatgt atacgaacag ctgggatccg agtaatggag ccatcattcg ctcgtcagac 360

cgcggcgcaa cgtggtcctt caccaacttg cccttcaaag tcgggggtaa catgccagga 420

cgcggagccg gagagcgtct ggctgtcgat ccggccaact ccaacatcat ctactttggt 480

gctcgctcag gaaacggcct ctggaagtct acggacggcg gcgtgacctt ttccaaggtc 540

tcgtcgttca cggcaactgg gacgtacatc ccagacccga gtgattccaa cggctacaac 600

agcgacaagc aaggactcat gtgggttacg ttcgactcaa ccagcagcac gaccggggga 660

gccacgtctc gtatctttgt tggcacggct gataacatca ctgcttcagt ctatgtgagc 720

acgaatgccg gctccacgtg gagtgctgta ccggggcagc cagggaaata ctttcctcac 780

aaggcgaaac tgcagccagc agagaaggcc ttgtatctga cctattccga tggcacaggg 840

ccgtatgatg gcacacttgg ctcagtgtgg aggtacgaca ttgcaggggg aacttggaaa 900

gacatcaccc ctgtctctgg atcagatcta tactttggct ttggcggcct tggcctcgat 960

ttgcaaaagc caggaaccct tgttgttgct tctttgaact cttggtggcc agatgctcag 1020

ctgtttcggt cgaccgactc tgggacaaca tggagcccga tctgggcgtg ggcgagctat 1080

ccgactgaga cctattacta cagcatctca actcccaaag caccgtggat caagaacaac 1140

tttatcgatg tgacgagcga gtcaccgtcc gatggtctca tcaagcgcct cggctggatg 1200

attgagtctc tcgagattga cccaaccgac agcaaccact ggctctacgg caccggaatg 1260

acaatctttg gcggccacga tctcaccaac tgggacacgc gccacaatgt gtcaatccaa 1320

tcactggcag acggcatcga ggaattctcc gtccaggacc tggcctctgc acccggcgga 1380

agcgagctat tggccgcagt cggagacgac aacggcttca cctttgccag cagaaacgac 1440

ctcgggacat cgccgcagac ggtctgggca acgcccacat gggccacctc gacgagcgtc 1500

gactacgccg ggaactcggt caagagcgtc gtccgcgtcg gcaacaccgc cggcacgcaa 1560

caggtggcca tctcgtccga cggcggcgcg acgtggagca tcgactacgc ggccgacacg 1620

tccatgaacg gcggcacggt ggcctattcg gccgacggcg acacgatcct ctggtcgacc 1680

gcctcgtccg gcgtgcagcg ctcgcagttc cagggcagct ttgcctccgt ctcgagcctg 1740

cccgcgggcg ccgtcatcgc ctcggacaag aagaccaaca gcgtcttcta cgccggctcc 1800

ggatcgacct tttacgtcag caaggacacc ggcagcagct tcacgcgcgg gcccaagctg 1860

ggcagcgcag ggacgatccg ggatatcgct gctcacccga ccaccgcggg cacgttgtat 1920

gtctcgaccg acgtcggcat attccgctcc acagactcgg gcacgacctt tggccaagtc 1980

tccaccgccc tgaccaacac ctaccagatc gccctgggtg tgggctcagg ctcgaactgg 2040

aacctgtatg ccttcggcac cggcccgtca ggggctcgcc tctacgccag tggagacagc 2100

ggcgcctcct ggacggacat ccagggctcc cagggcttcg gctccatcga cagcaccaag 2160

gtcgccggca gcggcagcac cgccgggcaa gtctacgtgg gcaccaacgg ccggggcgtc 2220

ttttacgctc agggaaccgt cggcggcggc acgggcggga cttcctcgtc gaccaagcag 2280

agcagcagca gtacctcttc cgccagctcg agcaccacgc tgaggtcgag cgttgtatcc 2340

acgacccggg cttcgacggt gacttcgtcg aggaccagct cggccgccgg tcccacgggg 2400

tcaggggtcg ccggtcatta tgctcagtgc ggagggattg ggtggacggg gccgacgcag 2460

tgtgtggcgc cgtatgtctg ccagaagcag aatgattatt actaccagtg tgtgtga 2517

<210> 2

<211> 705

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgaagttcc ttcaagtcct ccctgccctc ataccggccg ccctggccca aaccagctgt 60

gaccagtggg caaccttcac tggcaacggc tacacagtca gcaacaacct ttggggagca 120

tcagccggct ctggatttgg ctgcgtgacg gcggtatcgc tcagcggcgg ggcctcctgg 180

cacgcagact ggcagtggtc cggcggccag aacaacgtca agtcgtacca gaactctcag 240

attgccattc cccagaagag gaccgtcaac agcatcagca gcatgcccac cactgccagc 300

tggagctaca gcgggagcaa catccgcgct aatgttgcgt atgacttgtt caccgcagcc 360

aacccgaatc atgtcacgta ctcgggagac tacgaactca tgatctggct tggcaaatac 420

ggcgatattg ggccgattgg gtcctcacag ggaacagtca acgtcggtgg ccagagctgg 480

acgctctact atggctacaa cggagccatg caagtctatt cctttgtggc ccagaccaac 540

actaccaact acagcggaga tgtcaagaac ttcttcaatt atctccgaga caataaagga 600

tacaacgctg caggccaata tgttcttagc taccaatttg gtaccgagcc cttcacgggc 660

agtggaactc tgaacgtcgc atcctggacc gcatctatca actaa 705

<210> 3

<211> 1044

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgaaagcaa acgtcatctt gtgcctcctg gcccccctgg tcgccgctct ccccaccgaa 60

accatccacc tcgaccccga gctcgccgct ctccgcgcca acctcaccga gcgaacagcc 120

gacctctggg accgccaagc ctctcaaagc atcgaccagc tcatcaagag aaaaggcaag 180

ctctactttg gcaccgccac cgaccgcggc ctcctccaac gggaaaagaa cgcggccatc 240

atccaggcag acctcggcca ggtgacgccg gagaacagca tgaagtggca gtcgctcgag 300

aacaaccaag gccagctgaa ctggggagac gccgactatc tcgtcaactt tgcccagcaa 360

aacggcaagt cgatacgcgg ccacactctg atctggcact cgcagctgcc tgcgtgggtg 420

aacaatatca acaacgcgga tactctgcgg caagtcatcc gcacccatgt ctctactgtg 480

gttgggcggt acaagggcaa gattcgtgct tgggacgtgg tcaatgaaat cttcaacgag 540

gatggaacgc tgcgctcttc agtcttttcc aggctcctcg gcgaggagtt tgtctcgatt 600

gcctttcgtg ctgctcgaga tgctgaccct tctgcccgtc tttacatcaa cgactacaat 660

ctcgaccgcg ccaactatgg caaggtcaac gggttgaaga cttacgtctc caagtggatc 720

tctcaaggag ttcccattga cggtattgga agccagtccc atctcagcgg cggcggaggc 780

tctggtacgc tgggtgcgct ccagcagctg gcaacggtac ccgtcaccga gctggccatt 840

accgagctgg acattcaggg ggcaccgacg acggattaca cccaagttgt tcaagcatgc 900

ctgagcgtct ccaagtgcgt cggcatcacc gtgtggggca tcagtgacaa ggactcgtgg 960

cgtgccagca ccaaccctct tctgtttgac gcaaacttca accccaagcc ggcatataac 1020

agcattgttg gcatcttaca atag 1044

<210> 4

<211> 2235

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgcgttacc gaacagcagc tgcgctggca cttgccactg ggccctttgc tagggcagac 60

agtcactcaa catcgggggc ctcggctgag gcagttgtac ctcctgcagg gactccatgg 120

ggaaccgcgt acgacaaggc gaaggccgca ttggcaaagc tcaatctcca agataaggtc 180

ggcatcgtga gcggtgtcgg ctggaacggc ggtccttgcg ttggaaacac atctccggcc 240

tccaagatca gctatccatc gctatgcctt caagacggac ccctcggtgt tcgatactcg 300

acaggcagca cagcctttac gccgggcgtt caagcggcct cgacgtggga tgtcaatttg 360

atccgcgaac gtggacagtt catcggtgag gaggtgaagg cctcggggat tcatgtcata 420

cttggtcctg tggctgggcc gctgggaaag actccgcagg gcggtcgcaa ctgggagggc 480

ttcggtgtcg atccatatct cacgggcatt gccatgggtc aaaccatcaa cggcatccag 540

tcggtaggcg tgcaggcgac agcgaagcac tatatcctca acgagcagga gctcaatcga 600

gaaaccattt cgagcaaccc agatgaccga actctccatg agctgtatac ttggccattt 660

gccgacgcgg ttcaggccaa tgtcgcttct gtcatgtgct cgtacaacaa ggtcaatacc 720

acctgggcct gcgaggatca gtacacgctg cagactgtgc tgaaagacca gctggggttc 780

ccaggctatg tcatgacgga ctggaacgca cagcacacga ctgtccaaag cgcgaattct 840

gggcttgaca tgtcaatgcc tggcacagac ttcaacggta acaatcggct ctggggtcca 900

gctctcacca atgcggtaaa tagcaatcag gtccccacga gcagagtcga cgatatggtg 960

actcgtatcc tcgccgcatg gtacttgaca ggccaggacc aggcaggcta tccgtcgttc 1020

aacatcagca gaaatgttca aggaaaccac aagaccaatg tcagggcaat tgccagggac 1080

ggcatcgttc tgctcaagaa tgacgccaac atcctgccgc tcaagaagcc cgctagcatt 1140

gccgtcgttg gatctgccgc aatcattggt aaccacgcca gaaactcgcc ctcgtgcaac 1200

gacaaaggct gcgacgacgg ggccttgggc atgggttggg gttccggcgc cgtcaactat 1260

ccgtacttcg tcgcgcccta cgatgccatc aataccagag cgtcttcgca gggcacccag 1320

gttaccttga gcaacaccga caacacgtcc tcaggcgcat ctgcagcaag aggaaaggac 1380

gtcgccatcg tcttcatcac cgccgactcg ggtgaaggct acatcaccgt ggagggcaac 1440

gcgggcgatc gcaacaacct ggatccgtgg cacaacggca atgccctggt ccaggcggtg 1500

gccggtgcca acagcaacgt cattgttgtt gtccactccg ttggcgccat cattctggag 1560

cagattcttg ctcttccgca ggtcaaggcc gttgtctggg cgggtcttcc ttctcaggag 1620

agcggcaatg cgctcgtcga cgtgctgtgg ggagatgtca gcccttctgg caagctggtg 1680

tacaccattg cgaagagccc caatgactat aacactcgca tcgtttccgg cggcagtgac 1740

agcttcagcg agggactgtt catcgactat aagcacttcg acgacgccaa tatcacgccg 1800

cggtacgagt tcggctatgg actgtcttac accaagttca actactcacg cctctccgtc 1860

ttgtcgaccg ccaagtctgg tcctgcgact ggggccgttg tgccgggagg cccgagtgat 1920

ctgttccaga atgtcgcgac agtcaccgtt gacatcgcaa actctggcca agtgactggt 1980

gccgaggtag cccagctgta catcacctac ccatcttcag cacccaggac ccctccgaag 2040

cagctgcgag gctttgccaa gctgaacctc acgcctggtc agagcggaac agcaacgttc 2100

aacatccgac gacgagatct cagctactgg gacacggctt cgcagaaatg ggtggtgccg 2160

tcggggtcgt ttggcatcag cgtgggagcg agcagccggg atatcaggct gacgagcact 2220

ctgtcggtag cgtag 2235

<210> 5

<211> 673

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atgcagctcc ccctgaccac gctcctcacc ctcctccccg ccctcgcggc ggcccagtcc 60

ggcagcggcc gcaccacgcg ctactgggac tgctgcaagc gtcgtgcgcg tggcccggca 120

agggcccggc gcccgtgcgg acgtgcgacc ggtgggacac ccgctgttcg acggcggcaa 180

cacgcgcagc gggtgcgacg cgggcggcgg cgcctacagt gctcggacca gagcccgtgg 240

gcggtcagcg acgacctggc gtacggctgg gcggccgcaa cattgccggc tccaacgaga 300

ggcagtggtg ctgcgcctgc tacgagctga ccttcacagc gggccggtgg cgggcaagag 360

gatgattgtg caggcgagca atacgggagg cgattgggga acaaccactt tgatattgct 420

atgcccggcg gtggcgtcgg tatcttcaac gcctcaccga ccagtacggc gcgcccccca 480

acgggtgggg ccagcgctac ggcggcatca gccacgccac gagtgcgacg ccttccccga 540

gaagctcaag cccggctgct actggcgctt tgctggtgcg tttccctctt tcctcctctc 600

tcactgtctt tgccccctgg aacagggcag agatgggaag aagttgtgtt ttttttccct 660

tgagtgctaa cta 673

<210> 6

<211> 227

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Met Gln Leu Pro Leu Thr Thr Leu Leu Thr Leu Leu Pro Ala Leu Ala

1 5 10 15

Ala Ala Gln Ser Gly Ser Gly Arg Thr Thr Arg Tyr Trp Asp Cys Cys

20 25 30

Lys Pro Ser Cys Ala Trp Pro Gly Lys Gly Pro Ala Pro Val Arg Thr

35 40 45

Cys Asp Arg Trp Asp Asn Pro Leu Phe Asp Gly Gly Asn Thr Arg Ser

50 55 60

Gly Cys Asp Ala Gly Gly Gly Ala Tyr Met Cys Ser Asp Gln Ser Pro

65 70 75 80

Trp Ala Val Ser Asp Asp Leu Ala Tyr Gly Trp Ala Ala Val Asn Ile

85 90 95

Ala Gly Ser Asn Glu Arg Gln Trp Cys Cys Ala Cys Tyr Glu Leu Thr

100 105 110

Phe Thr Ser Gly Pro Val Ala Gly Lys Arg Met Ile Val Gln Ala Ser

115 120 125

Asn Thr Gly Gly Asp Leu Gly Asn Asn His Phe Asp Ile Ala Met Pro

130 135 140

Gly Gly Gly Val Gly Ile Phe Asn Ala Cys Thr Asp Gln Tyr Gly Ala

145 150 155 160

Pro Pro Asn Gly Trp Gly Gln Arg Tyr Gly Gly Ile Ser Gln Arg His

165 170 175

Glu Cys Asp Ala Phe Pro Glu Lys Leu Lys Pro Gly Cys Tyr Trp Arg

180 185 190

Phe Asp Trp Cys Val Ser Leu Phe Pro Pro Leu Ser Leu Ser Leu Pro

195 200 205

Pro Gly Thr Gly Gln Thr Met Gly Arg Ser Cys Val Phe Phe Pro Leu

210 215 220

Ser Ala Asn

225

<210> 7

<211> 900

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atgcgctcta ctcccgttct tcgcacaacc ctggccgctg cacttcctct ggtcgcctcc 60

gcggccagtg gcagtggcca gtccacgaga tactgggact gctgcaagcc gtcgtgcgct 120

tggcccggga aggccgccgt cagccaaccg gtctacgcgt gcgatgccaa cttccagcgc 180

ctgtccgact tcaatgtcca gtcgggctgc aacggcggct cggcctactc ctgcgccgac 240

cagactccct gggcggtgaa cgacaatctc gcctacggct tcgccgcgac gagcatcgcc 300

ggcgggtccg aatcctcgtg gtgctgcgcc tgctacgcgc tcaccttcac ttccggtccc 360

gtcgccggca agacaatggt ggtgcagtca acgagcactg gcggcgacct gggaagtaac 420

cagttcgata tcgccatgcc cggcggcggc gtgggcatct tcaacggctg cagctcgcag 480

ttcggcggcc tccccggcgc tcaatacggc ggcatttcgt cgcgcgacca gtgcgattcc 540

ttccccgcgc cgctcaagcc cggctgccag tggcggtttg actggttcca gaacgccgac 600

aacccgacgt tcacgttcca gcaggtgcag tgccccgccg agatcgttgc ccgctccggc 660

tgcaagcgca acgacgactc cagcttcccc gtcttcaccc ccccaagcgg tggcaacggt 720

ggcaccggga cgcccacgtc gactgcgcct gggtcgggcc agacgtctcc cggcggcggc 780

agtggctgca cgtctcagaa gtgggctcag tgcggtggca tcggcttcag cggatgcacc 840

acctgtgtct ctggcaccac ctgccagaag ttgaacgact actactcgca gtgcctctaa 900

<210> 8

<211> 299

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 8

Met Arg Ser Thr Pro Val Leu Arg Thr Thr Leu Ala Ala Ala Leu Pro

1 5 10 15

Leu Val Ala Ser Ala Ala Ser Gly Ser Gly Gln Ser Thr Arg Tyr Trp

20 25 30

Asp Cys Cys Lys Pro Ser Cys Ala Trp Pro Gly Lys Ala Ala Val Ser

35 40 45

Gln Pro Val Tyr Ala Cys Asp Ala Asn Phe Gln Arg Leu Ser Asp Phe

50 55 60

Asn Val Gln Ser Gly Cys Asn Gly Gly Ser Ala Tyr Ser Cys Ala Asp

65 70 75 80

Gln Thr Pro Trp Ala Val Asn Asp Asn Leu Ala Tyr Gly Phe Ala Ala

85 90 95

Thr Ser Ile Ala Gly Gly Ser Glu Ser Ser Trp Cys Cys Ala Cys Tyr

100 105 110

Ala Leu Thr Phe Thr Ser Gly Pro Val Ala Gly Lys Thr Met Val Val

115 120 125

Gln Ser Thr Ser Thr Gly Gly Asp Leu Gly Ser Asn Gln Phe Asp Ile

130 135 140

Ala Met Pro Gly Gly Gly Val Gly Ile Phe Asn Gly Cys Ser Ser Gln

145 150 155 160

Phe Gly Gly Leu Pro Gly Ala Gln Tyr Gly Gly Ile Ser Ser Arg Asp

165 170 175

Gln Cys Asp Ser Phe Pro Ala Pro Leu Lys Pro Gly Cys Gln Trp Arg

180 185 190

Phe Asp Trp Phe Gln Asn Ala Asp Asn Pro Thr Phe Thr Phe Gln Gln

195 200 205

Val Gln Cys Pro Ala Glu Ile Val Ala Arg Ser Gly Cys Lys Arg Asn

210 215 220

Asp Asp Ser Ser Phe Pro Val Phe Thr Pro Pro Ser Gly Gly Asn Gly

225 230 235 240

Gly Thr Gly Thr Pro Thr Ser Thr Ala Pro Gly Ser Gly Gln Thr Ser

245 250 255

Pro Gly Gly Gly Ser Gly Cys Thr Ser Gln Lys Trp Ala Gln Cys Gly

260 265 270

Gly Ile Gly Phe Ser Gly Cys Thr Thr Cys Val Ser Gly Thr Thr Cys

275 280 285

Gln Lys Leu Asn Asp Tyr Tyr Ser Gln Cys Leu

290 295

Claims

1. Trichoderma reesei (II) (A. reesei)Trichoderma reesei) The preservation number of the trichoderma reesei is M2017796 CCTCC NO.

2. Use of the trichoderma reesei of claim 1 to express one or more endogenous or exogenous proteins.

3. A recombinant strain of Trichoderma reesei, which is constructed by transforming an expression vector carrying a gene of interest into Trichoderma reesei according to claim 1.

4. The recombinant strain of trichoderma reesei of claim 3, wherein said gene of interest is a cellulase gene.

5. The recombinant strain of trichoderma reesei of claim 4, wherein the cellulase gene has a nucleotide sequence of SEQ ID No. 5 or SEQ ID No. 7.

6. The recombinant strain of trichoderma reesei of claim 3, wherein said expression vector is a eukaryotic expression vector.

7. Use of the recombinant strain of trichoderma reesei according to claim 4 for the production of cellulase enzymes.