BG63285B2 - Production of human pluripotent granulocytic colony-stimulation factor - Google Patents

Abstract

The invention relates to new polypeptides possessing part or the entire primary structural conformation and one or more biological properties of pluropotent granulocytic colony-stimulation factor (hpG-CSF) from a mammal. They are characterized by preferable forms as a product of prokaryotic and eukariotic expression in a host of exogenous DNA sequence. Sequences encoding part of the entire sequence of the amino acid residues of hpG-CSF or its analogues are incorporated in an autonomously replicating plasmide or viral vectors used for the transformation or transfection of suitable cells of prokaryotic or eukaryotic hosts such as bacteria, yeasts or cellular cultures of vertebrates. The products of the DNA sequence expression indicate the physical and the immunological properties and in vitro biological activities of hpG-CSF isolates originating from natural sources. The invention also relates to chemically synthesized polypeptides sharing the biochemical and the immunological properties of the hpG-CSF. 5 claims, 1 figure

Description

SUMMARY OF THE INVENTION

According to the present invention, DNA sequences encoding all or part of hpG-CSF are provided. Such sequences may include: incorporation of codons "preferred" for expression by selected invertebrate hosts; predicting cleavage sites from restriction endonuclease enzymes; and providing additional initial terminal or intermediate DNA sequences, which facilitates the construction of rapidly expressed vectors. The present invention also provides DNA sequences encoding for microbial expression of polypeptide analogs or hpG-CSF derivatives that differ from naturally occurring forms by identity or location of one or more amino acid residues (i.e., deletion analogs containing least of all the other residues, designated as hpGCSF; analogs with substitutions as [Ser ^17] hpGCSF, in which one or more residues specified are replaced by other residues; and analogs of addition in which a single yl more amino acid residues are added to a terminal or middle portion of the polypeptide) and which share one or more properties of the naturally occurring forms.

The novel DNA sequences of the invention include sequences useful for providing expression in prokaryotic or eukaryotic host cells of polypeptide products having at least part of the initial structural conformation and one or more of the biological properties of a naturally occurring pluripotent granulocyte colony stimulator. It has been found that the DNA sequences of the invention specifically include: a) the DNA sequence shown in Table 7 and Table 8 or their complementary strands; b) a DNA sequence that hybridizes (under hybridization conditions as illustrated herein or more stringent conditions) to the DNA sequences of Table 7 or to fragments thereof; and c) a DNA sequence which, due to the breakdown of the genetic code, would hybridize to the DNA sequence of Table 7. Typically, item b) includes genomic DNA sequences encoding allelic variants of hpG-CSF and / or encoding a pluripotent granulocyte colony- stimulating factor of other mammalian species. Typically, item c) includes DNA sequences encoding hpG-CSF, fragments of hpG-CSF, and analogs of hpG-CSF, whose DNA sequences may include codons that facilitate translation of RNA into microbial hosts. Such produced sequences can be readily constructed according to the methods of Alton, et al., PCT published application WO 83/04053.

The present invention also includes this class of polypeptides encoded by strands of DNA complement to the top strand of human cDNA or genomic DNA sequences of Table 7 or Table 8 of the present, i. Complementary inverted proteins, as described by Tramontano, et al., Nucleic Acids Res., 12.5049-5059 (1984).

The present invention provides purified and isolated polypeptide products .. having part or all of the primary structural conformation (i.e., a continuous sequence of amino acid residues) and one or more biological properties (e.g., immunological properties and in vitro biological activity) and physical properties (e.g. molecular weight) of naturally occurring hpG-CSFs including allelic variants. These polypeptides are also characterized by being the product of chemical procedures for synthesis or expression in a prokaryotic or eukaryotic host (e.g., from bacteria, yeast, higher plants, insects and vertebrate cell cultures) of exogenous DNA sequences obtained also by genomic or cDNA coupling or by gene synthesis. The products of typical yeast (e.g., Saccharomyces cerevisiae) or prokaryotic [Escherichia coli (E. coli)] host cells are not associated with any mammalian proteins. Microbial expression products in vertebrate cells (e.g., non-human and bird mammals) are not associated with any human proteins. According to the host used, the polypeptides of the invention may be glycosylated with carbohydrates from mammals and other eukaryotes or may not be glycosylated. The polypeptides of the invention may also include an initial methionine amino acid residue (at position -1).

The invention also includes pharmaceutical compositions containing an effective amount of the polypeptide products of the invention together with a suitable diluent, adjuvants and / or carriers useful in hpG-CSF therapy.

The polypeptide products of the invention may be " labeled " associated with " detectable marker substances (e.g., isotope labeled with ¹²⁵ l) < / RTI > to provide reagents useful for detecting or quantifying human hpG-CSF in solid tissues and liquid samples such as blood or urine. The DNA products of the invention can also be labeled with detectable markers (such as radiomarkers and non-isotope markers such as biotin) and used in DNA hybridization processes to localize the position of the human hpG-CSF gene and / or the position of any related gene family in the chromosome map. They can also be used to identify human hpG-CSF gene disorders

DNA level and to be used as gene markers to identify neighboring genes and their disorders.

The polypeptide products of the present invention may be useful alone or in combination with other hematopoietic factors or drugs in the treatment of hematopoietic disorders such as aplastic anemia. They may also be useful for treating hematopoietic deficits resulting from chemotherapy or radiation therapy. For example, the success of bone marrow transplantation can be enhanced by the administration of hpG-CSF. The healing process in the treatment of burn wounds and the treatment of bacterial inflammation may also benefit from the administration of hpG-CSF. In addition, hpG-CSF may also be useful in the treatment of leukemia ₅ based on the reported ability to differentiate leukemic cells. Welte, et al., Proc. Natl. Acad. Sci. (USA), 82, 1526-1530 (1985) in Sachs, no-rope.

Numerous aspects and advantages of the invention will become apparent to those skilled in the art upon consideration of the following detailed description, which provides illustrative material for the practical application of the invention in preferred embodiments of the invention.

BRIEF DESCRIPTION OF THE FIGURES

The figure is a partial restriction endonuclease map of the hpG-CSF gene> accompanied by arrows indicating the sequencing strategy used to obtain the genomic sequence.

DETAILED DESCRIPTION OF THE INVENTION

According to the present invention, the DNA sequences _h encoding part or all of the hpG-CSF polypeptide sequence are isolated and characterized.

The following examples are provided to illustrate the invention and in particular are directed to procedures carried out prior to the identification of hpG-CSF cDNA and genomic clones, to procedures leading to such identification and to the sequencing, development of cDNA-based expression systems. , genomic and produced genes and verification of hpG-CSF expression and similar products in such systems.

In particular, Example 1 relates to the sequencing of the amino acid sequence of hpG-CSF. Example 2 relates to the preparation of a cDNA library for screening for colony hybridization. Example 3 relates to the construction of hybridization samples. Example 4 relates to hybridization screening information, identification of positive clones, DNA sequencing of a positive cDNA clone, and generation of a polypeptide primary structural conformation (amino acid sequence). Example 5 relates to the identification and sequencing of a genomic clone encoding hpG-CSF. Example 6 relates to the construction of a produced gene encoding hpGCSF, using preferably E. coli codons.

Example 7 relates to procedures for constructing an E. coli transformation vector comprising DNA encoding hpG-CSF, using the vector for prokaryotic expression of hpG-CSF, and analyzing the properties of the recombinant products of the invention. Example 8 relates to procedures for generating hpG-CSF analogs, wherein cysteine residues are replaced by other suitable amino acid residues by means of mutagenesis performed on DNA encoding hpG-CSF. Example 9 relates to procedures for constructing a vector comprising the hpG-CSF analog-coding DNA derived from a positive cDNA clone, using the vector to transfer COS-1 cells, and culturing the transfected cells. Example 10 relates to the physical and biological properties or recombinant polypeptide products of the invention.

EXAMPLE 1 (A) Sequencing of material provided by methods in the literature

A sample (3-4 pg, 85-90% pure SDS stained with silver PAGE) of hpG-CSF was obtained from the Sloan Kettering Institute, New York, N.Y., the crust was isolated and purified according to Welte, et al., Proc. Natl. Acad. Sci. (USA), 82, 1526-1530 (1985).

The N-terminal amino acid sequence of this hpG-CSF sample was determined in embodiment # 1 by micro-sequencing analysis using an AB407A gas-phase sequencer (Applied Biosystems, Foster City, Calif.) To supply the sequence information indicated in Table 1 below. In letters 1-4, the one-letter code is used, "X" means a residue that is not clearly defined and residuals in parentheses are only determined alternatively or temporarily.

Table 1

5 10 15

K-P-L-G-P-A-S-K-L-K-Q - (G, V.S) -G-L-X-X-X

Is there a high backdrop for each execution cycle _? for which the results are presented in Table 1, indicating that the results of the sample have many contaminants, probably in the form of chemical residues from the purification. The sequence is reserved for reference only.

In run # 2, a second sample (5-6 pg, ~ 95% purity) was obtained from Sloan Kettering. as in embodiment # 1 and the sequencing procedure is performed as in embodiment # 1. This sample is made from the same batch of material used to generate Figure 4 by Welte, et al., Proc. Natl. Acad. Sci. (USA), 82, 1526-1530 (1985). The results are shown in Table 2.

Table 2

5 10 15 20 (S) (L)

T-P-L-G-P-A-S- (S) -L-P-Q-X - M - (M) -X-K- (R) -X-X- (R) - (L) -X

Although more residues have been identified, embodiment # 2 does not provide a sufficiently long unambiguous sequence ₀ from which a reasonable number of hpG-CSF DNA search samples can be constructed. It was estimated that at least 1536 samples would be needed to attempt to isolate the cDNA based on the sequence of Table 2. Again, the problem is implied by impurities in the sample.

Accordingly, a third sample (3-5 dd, ~ 40% purity) was obtained from Sloan Kettering as above. This preparation was electroblotched after separation by SDS-PAGE in an attempt for subsequent purification. Sequential analysis of this sample does not provide any data.

(C) Sequencing of materials supplied by improved methods

In order to obtain a sufficient amount of pure material - to perform a suitable final analysis of the amino acid sequence, bladder carcinoma cell line 5637 (subclone 1A6) produced by Sloan Kettering was obtained from Dr. E. Platzer. Cells were initially cultured in Iscove's medium (GIBCO, Grand Island, NY) in flasks until confluent. When merged, the CULTURES were treated with trypsin and sown in roller bottles (1½ flasks / bottle), each containing 25 ml of pre-conditioned Iscove's medium below 5% CO ₂ . The cells were cultured overnight at 37 ° C, at 0.3 gm (rpm).

Cytodex-1 beads (Pharmacia, Uppsala, Sweden) were washed and sterilized using the following procedures. Eight grams of pearls are placed in a bottle and 400 ml of PBS are added. The pearls were suspended until rotated gently for three hours. After the beads were allowed to precipitate, PBS was removed, the beads were washed in PBS, and fresh PBS was added. The beads were autoclaved for 15 minutes. Before use, the beads were washed in Iscove's medium plus 10% fetal calf serum (FCS) before fresh medium was added plus 10% FCS to obtain the treated beads.

After removing from each roller bottle all but 30 ml of medium, 30 ml of fresh medium plus 10% FCS and 40 ml of treated pearls are added to the bottles. The bottles were saturated with 5% CO ₂ and all bubbles were removed by withdrawal. The bottles were placed in roller frames at 3 rpm for% h before the speed was reduced to 0.3 rpm. After three hours, an additional flask was treated with trypsin and added to each rotating bottle containing pearls.

At 40% to 50% confluence, the roller bottle cultures were washed with 50 ml PBS and rotated for 10 minutes before removing PBS. The cells were cultured for 48 hours in medium A [Iscove's medium containing 0.2% FCS, 10 ' ⁸ M hydrocortisone, 2 mM glutamine, 100 units / ml penicillin and 100 pg / ml streptomycin]. The culture supernatant was then collected by centrifugation at 3000 rpm for 15 minutes and stored at -70 ° C. The cultures were supplemented with medium A containing 10% FCS * and cultured for 48 hours. After removal of the medium, the cells were washed with PBS as above and cultured for 48 hours in medium A. The supernatant was re-harvested and treated as described above.

Approximately 30 liters of medium conditioned with 1A6 cells _t were concentrated to about 2 liters on

Millipore Pellicon unit equipped with 2 cartridges having a 10,000 MW cutoff at a filtration rate of approximately 200 ml / min and a retention rate of approximately 1000 ml / min. The concentrate was diafiltered with approximately 10 liters of 50 mM Tris (pH 7.8) using the same apparatus and at the same flow rate. The diafiltered concentrate was loaded onto a column equilibrated with 50 mM Tris (pH 7.8) with 1 liter of DE cellulose at 40 ml / min. After loading, the column was washed at the same rate with 1 liter of 50 mM Tris (pH 7.8) and then with 2 liters of 50 mM Tris (pH 7.8) with 50 mM NaCl. The column was then eluted in portions of six 1 liter solutions of 50 ml Tris (pH 7.5) containing the following NaCl concentrations: 75 mM; 100 mM; 125 mM; 150 mM; 200 mM; and 300 mM. Fractions (50 ml) were collected, and the active fractions were pooled and concentrated to 65 ml on an Amicon agitated ultrafiltration cell unit equipped with a YM5 membrane. This concentrate is loaded onto a 2 liter AcA54 gel filtration column _? hurray introduced on PBS. Start the column at 80 ml / h and collect the 10 ml fractions. The active fractions were pooled and loaded directly onto a C4 column for High Performance Liquid Chromatography (HPLC).

Samples with a volume in the range of 125 ml to 850 ml and containing 1-8 mg of protein, approximately 10% of which is hpG-CSF, are loaded onto the column at a flow rate of 1 ml to 4 ml per minute. After loading and one initial wash with 0.1 M ammonium acetate (pH 6.0-7.0) in 80% 2-propanol at a flow rate of 1 / ml / min. 17 ml fractions were collected and monitored for protein at

220 nm, 260 nm in 280 nm.

As a result of the purification, the fractions containing hpG-CSF were clearly separated (as fractions 72 and 73 of 80) from the other fractions containing proteins. The hpG-CSF was isolated (150 - 300Cd) with a purity of approximately 85 + 5% and an approximate yield of 50%. Of this purified product, 9 µg were used in embodiment # 4, an amino acid assay in which the protein sample was applied to a TFA-activated fiberglass disc without polybrene. Sequence analysis was performed with an AB 470A sequencer according to the methods of Hewick, et al., J. Biol. Chem., 256, 79907997 (1981) and Lai, Anal. Chim. Acta, 163, 243-248 (1984). The results of embodiment # 4 are summarized in Table 3.

Table 3

510

Thr - Pro - Leu - Gly - Pro - Ala - Ser - Ser - Leu - Pro 1520

Gin - Ser - Phe - Leu - Leu - Lys - (Lys) - Leu - (Glu) - Glu 2530

Vai-Arg-Lys-lie - (Gin) - Gly - Vai - Gly - Ala - AlaLeu-X - X At run # 4, after the 31th cycle (corresponding to residue 31 in Table 3), no more relevant information is obtained . In order to obtain a longer unambiguous sequence, in embodiment # 5, 14 µg hpGCSF purified from the conditioned medium, 10 μΙ β-mercaptoethanol was reduced for 1 hour at 45 ° C and then dried under vacuum. The protein residue is then dissolved in 5% formic acid before being applied to the fiberglass polybrenched disc. Sequential analysis was performed as in embodiment # 4 above. The results of embodiment # 5 are shown in Table 4.

Table 4

510

Thr - Pro - Leu - Gly - Pro - Ala - Ser - Ser - Leu - Pro 1520

Gin-Ser-Phe-Leu-Leu-Lys-Cys-Leu-Glu-Gin 2530

Val-Arg-Lys-lie - Gin - Gly-Asp - Gly - Ala - Ala3540

Leu-Gin-Phe-Lys-Leu-Gly-Ala-Thr-Tyr-Lys 45

Val - Phe - Ser - Thr - (Arg) - (Phe) - (Met) - X

The amino acid sequence shown in Table 4 is sufficiently long (44 residues) and unambiguous.

to construct samples for the preparation of hpGCSF cDNA as described above.

EXAMPLE 2

Among the standard procedures for isolating cDNA sequences of interest is the preparation of a plasmid-derived cDNA "library" obtained by reverse transcription of mRNA> abundant into donor cells selected based on their gene expression of the target. When significant strands of the amino acid sequence are known to label single stranded DNA sequences, duplicating a sequence suspected to be present in a "target" cDNA, DNA / DNA hybridization procedures performed on cloned cDNA copies can be used, which have been denatured to single-stranded form. Weissman, et al., U.S. Pat. 4,394,443; Wallace, et al., Nucleic Acids Res., 6, 3543-3557 (1979), in Reyes, et al., Proc. Natl. Acad. Sci. (USA), 79, 3270-3274 (1982), in Jaye, et al., Nucleic Acids Res., 11, 2325-2335 (1983). See also U.S. Pat. Pat No. No. 4,358,535 to Falkow, et al., In reference to DNA / DNA hybridization procedures at diagnosis; in Davis, et al., “A Manual for Genetic Engineering, Advanced Bacterial Genetics,” Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1980) at pp. 55-58 I 174-176 relating to the hybridization techniques of colonies and plates.

Total RNA was extracted from approximately one gram of bladder cell line 5637 (1A6) cell carcinoma using the guanidine thiocyanate procedure to quantitatively isolate intact RNA. [Chirgwin, et al.,

Biochemistry, 18, 5294-5299 (1979)].

Sterile aqueous RNA solution contains total RNA from IA6 cells. To obtain information RNA only from the total RNA solution, the solution is passed through a column containing oligodeoxythymidylated [oligo (cG)] (Collaborative Reseach, Inc., Waltham, Mass. PolyAdenylated (poly-A ⁺ ) tails characteristic of adhering to the information DNA to the column while the ribosomal RNA was eluted resulting in the isolation of approximately 90 µg of polyadenylated RNA (poly-A ⁺ mRNA) The isolated poly-A ⁺ RNA was pretreated with methyl mercury hydroxide (Alpha Ventron , Danvers, Mass.) At final concentration of 4 mM for 5 minutes at room temperature prior to use in the cDNA reaction Treatment with methylmercury hydroxide denatures the interaction of the RNA with both itself and the contaminating molecules that inhibit translation Payvar, et al. J. Biol.Chem., 258, 7636-7642 (1979).

According to the Okayama procedure [Okayama, et al., Molecular & Cellular Biology, 2, 161-170 (1982)], a cDNA bank was prepared using the mRNA obtained from IA6 cells. the cDNAs are then transformed by incubation in the host E. coli K-12 strain HB101 microorganism for amplification.

EXAMPLE 3

Hybridization assays designed on the basis of the hpG-CSF amino terminal sequence of Table 4 consist of a set of 24 oligonucleotides, each with a length of 23 bases and containing three inosine residues. The oligonucleotides of the samples are produced according to the procedure of Caruthers, et al., Genetic Engineering, 4, 1-18 (1982) and are labeled with γ- ³² Ρ ATP by polynucleotide kinase treatment. The oligonucleotides of the samples corresponding to the RNA information for residues 23-30 of the sequence of Table 4 are illustrated in Table 5.

__________________________________________ Table 5 hpG-CSF Samples

A T G T

5 'GC IGC ICC TC ICC TG AT TT 3'

G C A C

T.

The determination of neutrality to I's is based on the published work of Takahashi et al., Proc. Natl. Acad. Sci. (USA), 82,1931-1935 (1985) in Ohtsuka et al., J. Biol. Chem., 260, 2605-2608 (1985). However, inosine can have a destabilizing effect if it forms a base pair with G or T. In Takahashi, et al., Inosins can appear as having a neutral effect as they are averaged as a group with close neutrality (e.g., three forming pairs favorable to C and two unfavorable for the formation of pairs cT).

To test the effect of owning I's base pair with G's, control experiments were designed using the N-myc gene sequence and clone. The sequences taken from the N-myc gene have the same G and C content at the first two positions of each codon as prescribed by the hpG-CSF samples. Therefore, the N-myc test samples are the same length, contain I's in the relatively same position and have potentially the same mean Tm (62-66 ° C, without taking into account 3 or 4 inosine residues, inclusive) as the hpG-CSF samples.

Two sets of N-myc test samples were constructed according to the procedure of Caruthers et al., Supra. Set I, as illustrated in Table 6..includes: 1. 23-meter with perfect match; 2. in which three-thirds of C's are replaced by I's, generating the worst case for adding I's; and 3. in which four thirds of C's are replaced by I's. The second set of test samples is designed to represent a more random distribution of inosine base pairs, which should give an overall neutral base pair binding effect. Set 2l <as illustrated in Table 6 _} includes: 4. containing two I's which will form a base pair with C's and one with G; and 5. identical to 4 with the addition of another I: G base pair.

Table 6

N is the test sample 1. ⁵ 'sass AAS TAT GCC GCC CCC TCC cc ³ ' 2. ⁵ 'sass AAS TAT GCI GCC CCI TCI cc ³ ' 3. ⁵ 'cai AAS TAT GCI GCC CCI TCI cc ³ 4. ⁵ AAS GAG CTG TGI GGC AGI CCI GC ³ 5. ⁵ 'AAI GAG CTG TGI GGC AGI CCI GC ³ '

Five replication filters containing N - Tus DNA sequences and the DNA sequences of chicken growth hormone (as a negative control) were baked in a vacuum oven for 2 hours at 80 ° C before hybridization. All filters were hybridized as described in Example 4 for the hpG-CSF samples, except that the hybridization period was only 6 hours. The filters were washed three times at room temperature, then once at 45 ° C for 10 minutes each. The filters are monitored with a Geiger counter.

The filter representing the N-myc sample 3 gives a very quiet signal with respect to the remaining 4 sample filters and is no longer flushed. After washing at 50 ° C for 10 minutes, the Geiger counter gives the following percentage signal, normalizing sample 1 to 100%; sample 2,20%; sample 3 (45 ° C), 2%; sample 4, 92%; and sample 5, 75%. After washing at 55 ° C the percentages become: sample 2. 16%; sample 4, 100%; and sample 5,

80%. Final washing at 6 ° C gives the following percentages:

sample 2, 1.6%; sample 4, 90%; and sample 5, 70%.

Therefore, in the presence of 3 I's, as in Samples 2 and 4, a signal difference of up to 60 times the theoretical Tm (I's not included in the calculations) is approached [based on worst case I of base pair formation (sample 2) and the relatively neutral base pair formation case (sample 4)].

The standardized information obtained through the N-myc hybridization test is used in flushing and visualizing hpG-CSF hybridization, as outlined below, to test the confidence level with which rigorous flushing results should be accepted.

EXAMPLE 4

According to the procedure of Hanahan, et al., J. Mol. Biol., 166, 557-580 (1983) bacteria containing recombinants with cDNA inserts, as obtained in Example 2, were sprayed onto 24 nitrocellulose filters (Millipore, Betford, Mass.) Deposited on agar plates. The plates were then incubated until approximately 150,000 colonies were identified, which were replicated inoculated with another 24 nitrocellulose filters. The replicas were incubated until the appearance of individual colonies. The bacteria on the filters were lysed on sheets of Watman 3MM paper slightly saturated with sodium hydroxide (0.5M) for 10 minutes, then added with Tris (1M) for 2 minutes followed by Tris (0.5M). ) containing NaCI (1.5 M) for 10 minutes. When the filters are almost dry, bake for 2 hours at

80 ° C in a vacuum oven prior to nucleic acid hybridization. [Wahl, et al., Proc. Natl. Acad. Sci.

(USA), 76, 3683-3687 (1979)]; in Maniatis, et al., Cell, 81, 163-182 (1976).

The filters were pre-hybridized for 2 hours at 65 ° C in 750 ml of 10 Denhardt's, 0.2% SDS and 6x SSC. The filters are washed in 6xSSC, then four are bagged and hybridized for 14 hours in 6xSSC and 10x Denhardt's. There are approximately 15 ml of injectable solutions bag containing 50x10 ⁶ cpm samples (oligonucleotides), labeled with ³² P.

After hybridization, the filters were washed three times in 6xSSC (1 liter / wash) at room temperature for 10 minutes each. The filters were then washed twice at 45 ° C for 15 minutes each, once at 50 ° C for 15 minutes and once at 55 ° C for 15 minutes using 1 liter volumes of 6xSSC. The filters were autoradiographically 2 hours at -70 ° C using a gain screen and Kodak XAR-2 film. There are 40-50 positive signals detected on this autoradiograph, including 5 very strong signals. The fields including the five strongest signals and the additional five positive are scraped from the main dishes and re-sown for secondary screening using the same sample mixture under the same conditions. The flushing procedure differs in that the high temperature washes consist of two at 55 ° C for 15 minutes each and then one at 60 ° C for 15 minutes. Based on the study of the N-myc sample of Example 3, the last rinsing temperature at the second screening rises, since the melting temperature of the aggregate of the 24 23-m is 60-68 ° C, similar to that of N-myc samples. Only after the second rinse at 55 ° C are the filters moistened and autoradiography performed. Comparison of this autoradiography with the second autoradiography conducted for a similar period of time after the last rinse at 60 ° C shows that only 10 clones tested did not suffer significant signal loss at a rise of 55-60 ° C. These two clones were later shown to have nearly identical lengths and patterns of restriction endonuclease. For screening, one clone named PP2 is selected.

The sequencing of the recombinant cDNA clone of hpGCSF, PP2 obtained by the above procedures was performed by the dideoxy method of Sanger, et al., Proc. Natl. Acad. Sci. (USA), 74, 5463-5467 (1977). The single-stranded DNA phage M-13 was used as a cloning vector to deliver single-stranded DNA matrices from double-stranded cDNA clones. The method of Sanger, et al., Derives the sequence as shown in Table 7, accompanied by its amino acid translation and complementary strand in the coding region of the polypeptide.

Hindlll

5'-AGCTTGGACTCAGCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG [NNNNN]

I— < o o 0 Ι- Ο- o 0 0 0 > 4 0 0 0 0 0 ra 0 0 Q = 3 1— < < Φ —1 0 0 0 0 o 0 0 L— CL 0 0 0 0 In “+ 0 0

ra < 0 0 0 ¹ 1— Ξ5 < 0 1— 0 0 0 0 CZ < 1— 0 0 0 0 0 - 1— < ra > 0 0 < H u_ 0 0 -Ci'll Ι- < H 0 0 ο. 0 0 1— H < Z5 Φ 0 0 < 0 0 < H ra 0 0 < 0 0 < 1— < σ Φ 0 0 T ω < l_ 0 0 o that < H 1 T 0 0 CL t— 0 0 0 0 1— H < 0 0 CM V ~ Ξ3 Φ 1— < —I 0 0

Ci o CL co ± co >> O rs Φ —I

I— ra <

co> ·. o

Σ5

Φ

CO., LTD

J3 c

Z5 Φ —1 o CO CO <

_Φ <

2? 0

Q_ co <

2 ^

GGC GAT GGC GCA GCG CTC CAG GAG AAG CTG TGT GCC ACC TAG AAG CTG TGC CAC CCC GAG CCG CTA CCG CGT CGC GAG GTC STC TTC GAC ACA CGG TGG ATG TTC GAC ACG GTG GGG CTC

CM (Continued)

0 < >> Η Η- 0 □ Η- φ 0 -J 0 φ Η SW Κ- 0_ Ι— Φ ο —1 0 > 4 0 0 0 0 ο U— φ ω 0 00 < 1— ω < ± 0 0 Η- φ 0 —1 C 5 0 0 0 ι_ Φ 0 ω < 0 Φ l · - —1 1— ω >> 0 0 0 1— 0 >. 0 Ο 0 < Φ 0 < 0 0 Φ 1— _1 0 0 ο C < b- 0 0 = 5 0 Φ 1— _J 0 Φ 0 < 0 0 C 0 0 < Ο k_ φ 0 ω 0 <

Η <

ο <

□ ο

<

<

ο ο

ο Η <

Η <

F Η ^-

Ο

I— ο

$ ο

<

ο ο ο

<

Ο Η ο

<

ο

Η 0

Η

Η

Η

Η 0 ο

$

I— <

I—

Η <

Η 0 (Continued)

I— ο ο ο <0 ο Η I— ο

ΙΟ I— ο ο I— ο

Ο ο <

Η

Η ο

_Φ <

ο

CL

ο ο 0 ΙΟ ο ο ο 0

Η <

ο

ΙΟ <

<

ο

ο ί— ο

<

ο <

Ο

> 4 Η

_3

Φ ο

<0 φ χζ 0_

JTO <

φ

>.

φ <

σ>

U.

<

σ>

<

ι <ο

0 Ο ΙΟ ο 0

ΙΟ

Ο I—

Η <ο <

ο <ο ο I— ο ο

<

ο Η ο i— 0 ο <

<

I— ο

<

ο ο ο <

<ο ο ο ο

ΙΟ ο

ΙΟ ο ο ο 0 ο 0

(Continued)

- Η ι— ο < ο ο ο ο 0 0 ο <ζ 1— ο < ο Η ο < ο ο - 1— ο < Ι- ο ι— Ο 1— Ο ο ο I— 1— ο 0 0 Η 1— 0 < 0 (- Ρ 1— ο Η 0 ο Η ί 1— Ι- ο Ο ο 0 0 - <ς S 0 Σ5 • 4— * <Τ ! - < ω Η ο <ζ Η ο < ο 0 Ι- ο < Ο 0 0 1— < Η

(Continued)

υ ο ο ο ο 1- TGG ο < ο 0 Ι- ο ο 0 - 0 ο Η Ο Η 0 < - ο 0 ο ο ο Η < < ο < 0 ο ο ο 0 0 0 0 0 < 0 0 ο 0 < < 0 0 - <· < 0 - ο 0 ο ί < Ι- < Η 0 Ο 0 Η 0 0 < Η < 1— 0 0 Η < < < - < 0 ο ο ο ο I— -X » ο 0 - - 0 0 ο 0 < 1— Η 0 0 ο Ι- 0 Q Ο < - ο ο 0 - Η 0 < 0 <ζ 0 ο ο 1— 0 - < 0 < ο ο 1— < Η < ο ο < < < < < ο ο 0 0 < Ι- 0 0 0 Ο 1— 0 < ο ο 0 0 0 ο - 0 ο ο ο 0 < ο 0 Η 0 0 Η 0 0 0 Η

mid (Continued)

I— ο <ο ο ι - ο ο ο ο ο I— ο I— 0 <ο ο [_ ο <ο ο ο ο ο ο <

ο I—

Η ο

I— ο ο <ο ο I— ο ο ο <ο I— ο

I— ο <ω ο I— ο <

<ο ο I— ο ο

Η

Η

Η0

<

<ο Η

Η ο <

<ο Η ο

co I

Η> χ τ φ τ ο

S ΣΓ

= 5> ΟΚΟ

X

CD φ

ΟΓ φ

Οχ

Εί τ π:

X se

CO q

X

X co 05 yo ο co yu sch o q q

x <

>.

Ο Q.

X co 05

Yu

O O

CN

And about co

The following sequence characteristics of Table 7 are noteworthy. At the 5 'end of the sequence, bases corresponding to those of the poly G cDNA linker are shown. Then about five bases (denoted by “M”) appear there, whose sequence cannot be determined unambiguously by the method of Sanger et. al., due to previous numerous G's. The sequence further shows a series of 12 codons encoding part of a putative leader sequence for the polypeptide. Based on the correspondence of the amino-terminal sequence of the natural isolates of hpCSF described in Example 1, the threonine-initiating residue of the putative "mature" hpG-CSF form is +1. The mature hpG-CSF was then shown to include 174 residues as indicated. Following the stop codon (OP codon, TGA), there are approximately 856 bases of one untranslated 3 'sequence and numerous A's of poly A' tail '. The unique HgiAi and Apal restriction endonuclease recognition sites, as well as two Stul sites (discussed below for the construction of prokaryotic and eukaryotic expression systems) are also listed in Table 7. Due to the lack of aspergine residues, no polypeptide is present in the polypeptide Nglycosylation. The underlined 6 bases near the end of the 3 'untranslated sequence represent a potential polyadenylation site.

Of note, each of the two additional cDNA clones identified by the hybridization procedures described above out of a total of 450,000 clones failed to include

DNA encoding the entire leader sequence from the forward transcription initiation site. In fact, all three hpG-CSF clones terminating in the 5 'region at exactly the same site indicate that the secondary mRNA structure strictly transcribes the posterior cDNAs beyond this site. Therefore, from a practical point of view, cDNA expression screening, as described by Okayama et al., Mol. and Cell. Biol., 3, 280-289 (1983) and actually used to isolate GM-CSF in Wong, et al., Science, 228, 810-814 (1985) cannot be directly applied to isolate hpCSF DNA, since such isolation systems are usually based on the presence of full-length cDNA transcript in the clones examined.

The above sequence is not exactly sensitive to ensuring the direct expression of hpG-CSF in a microbial host. To ensure such expression, the hpG-CSF coding region must be provided with an ATG initiation codon and the sequence must be inserted into a vector to be transformed into a site under the control of a suitable promoter / regulatory DNA sequence.

EXAMPLE 5

In this example, the cDNA encoding hpG-CSF, as isolated in the preceding example, is used to screen for a genomic clone. Human germline lambda phage genomic library [prepared according to the procedure of Lawn, et al., Cell. 15, 1157-1174 (1978) and obtained by T. Maniatis] was screened using a nick-translated sample consisting of two hpG-CSF cDNA fragments isolated by digestion with HgiAl and Stul (HgiAl to Stul, 649 bp; Stul to Stul, 639 bp). A total of about 500,000 phages were seeded on 12 (15 cm) petri dishes and plates were separated and hybridized with the sample using the Benton / Davison procedure [Benton et al., Science, 196, 180 (1977)]. A total of 12 positive clones were observed. Three clones (1-3) yielding the strongest autoradiography signals at second screening were cultured in 1 liter cultures and mapped by restriction enzyme digestion and Southern blotting using an isotope-labeled 24-oligonucleotide (treated with kinase with γ- ³² Ρ ATP) 5OTGCACTGTCCAGAGTGCACTGTG3 '. The mapping results show that isolates 1 and 3 are identical and 2 contains 2000 additional bases 5 'to the hpG-CSF gene. Therefore, clone 2 is used for subsequent characterization. Clone 2 DNA was digested with R1 to release a 850 bp fragment containing hpG-CSF, which was then subcloned into pBR322 with subsequent mapping by restriction endonuclease digestion, Southern blotting, M13 subcloning and sequencing. The resulting sequence is shown in Table 8.

Xt Ο xt

ο co

Σ

ο.

ω ω c

I— ΧΖ

I — it <

ο

L-. 0_ ο ο to <

Ο

Ο Ο Ο Ο <Ο ο ο

5κ ο

ο

Η ο ο <

I— ο 0 0 Η <ο ο ο <

<ο ο ο <ο ο ο ο 0 <

ο ο ο <ο g- ~ <- <Ί (Continued)

I

CD ο CD

Ο Ο h ~

I

(I)

Φ co

Φ co <

CL

J _J o Οχ:

H

ACCCCCCTGGGCCCTGCCAGCTCCCTGCCC

0

Φ I— οο m (Continued) ο OJ (ϋ>

ο

Σ5 Φ co>. Ο co> ZJ φ

Ζ3 φ —J φ xz CL

$ Ω ο ο co $ ο 0 <0 <Η Η0 0 Η 0 S ο I— ο 0 [- ο 0 Η I— ο 0 <0 <ο ju co ο co co>.

C

Φ _Φ <

_Φ <

Cl

CO <

2?

φ co> h

Ο)

L <

Σ Ο σ>

ο <

<

I— ο ο ο <

<

<

Η

ΙΟ <

<

I—

ΙΟ <

ΙΟ <

I— 0 <I— Η <Η <

<0 <

I <

Ο <

<

<

ΙΟ Η Ο ο

Η <ο <

<

ο 0 0 <ο 0 I— ο

<0 ι—

I— ο 0 Ο ΙΟ 0 0 0

Ο Η ο

Η <

I— 0 0 π-

ω <ο ο ο ο Η ο ο <ο

GACCAGAGAGTCGGGGAGGACCCGGGAAGGAGCGGCGACCCGGCCACGGC 1200

(Continued)

GAGTCTCACTCAGCATCCTTCCATCCCCAG

<φ>

ο.

σ) <

ο 'Г ο

σ>

Ο <0 Ο I— ο 0 0 0 0 Ο ο 0 <0 0

Ζ5

Φ _Ζ5 ο_

1— φ ω> s 0

Ζ5 Φ

Φ χζ 0_

Ζ5

Φ

Ο Ο CD (Continued) ο οο

2>

φ ω ω

X

ZJ

Φ

Η 0 0 1 =

Ο

I— 0 0 0 Η ΙΟ <0 0 0 0 0 0 Η 0 I— <0 0 0 $ 0 0 I— 0 0 0 0

I— 0 <

Η 0 <

Η

Η

Ο

U. ο.

<

<0 0 Η Η 0 0

0 ο CN

CL

I—

Φ

-C Η k— χ: Iro <φ JZ ο.

Ο Ο Γ-

ϊ <0 0 I— 0

Q.

(Λ <0

(Continued)

(Continued)

TTATGTCTATTTAAGCCTCATATTTAAAGACAGGGAAGAGCAGAACGGAG

TCTGGGTGCCCTCGGGACACCTGCCCTGCCCCCACGAGGGTCAGGACTGT 2600 (Continued)

GACTCTTTTTAGGGCCAGGCAGGTGCCTGGACATTTGCCTTGCTGGATGG

ο ο ο co

The restriction endonuclease map (approximately 3.4Kb) of the genomic DNA containing the hpG-CSF gene is shown in Figure 1. The restriction endonuclease shown in Figure 1 are: Ncol, N; Pstl, P; BanHI, B; Apal, A; Xhol, X; u Kpn, K. The arrows below the map indicate the sequencing strategy used to obtain the genomic sequence. The areas enclosed in rectangles are found in the cDNA clone, the dotted rectangles being a sequence. not present in the cDNA clone, but identified by mRNA spot testing. The identification of the coding sequences proposed for exon 1 was performed by Northern blot analysis. The 24′C oligonucleotide sample 5′CAGCAGCTGCAGGGCCATCAGCTT3 ′ occupying the predicted binding sites for exons 1 and 2 is hybridized with hpG-CSF and RNA in Northern blot format. The resulting spot shows an mRNA of the same size (-1650 bp) as the exon 2 oligonucleotide probe established. This data, combined with the ability of the pSVGM-Ppol vector to carry out the expression of hpG-CSF (Example 9) using the Met initiation codon indicated in Table 8, defines the coding sequences included in exon 1. Exons 2 - 5 are defined by the coding sequences obtained in the cDNA clone (PP2) of the hpG-CSF gene (Table 7).

EXAMPLE 6

This example relates to the preparation of a gene produced encoding hpG-CSF and including preferred E. coli codons.

In short, the protocol used is generally as described in PCT Publication No. W083 / 04053 co-authored with Alton, et al., Which is incorporated herein by reference. The genes are designed to initially assemble the constituent oligonucleotides into multiple duplexes, which in turn are assembled into three distinct sections. These sections are designed for rapid amplification and, after removal from the amplification system, can be assembled sequentially or by multiple ligation of fragments into a suitable expression vector.

The construction of Sections I, II and III is illustrated in Tables 9 to 14. In the construction of Sections I, as illustrated in Tables 9 and 10, oligonucleotides 1-14 are assembled into 7 duplexes (1 and 8; 2 and 9; 3 and 10; 4 and 11; 5 and 12; 6 and 13; and 7 and 14). Seven duplex then _ligated} to form Section I, as shown in Table 10. It can be noted in Table 10 that the section I comprises upstream from an Xbal sticky end and towards the downstream BamHI sticky-end used for ligation to amplification and expression vectors and for ligation to section II.

__________________________________________ Table 9

EchpG-CSFDNA - SECTION I

CTAGAAAAAACCAAGGAGGTAATAA 1

TAATGACTCCATTAGGTCCTGCTTCTTCT 2

CTGCCGCAAAGCTTTCTGCTGCTGAAATGTCTGG 3 (continued)

AACAGGTTCGTAAAATCCAGGGTGACGGT4

GCTGCACTGCAAGAAAAACTGTGCGCTA5

CTTACAAACTGTGCCATCCGGAAGAGC6

TGGTACTGCTGGGTCATTCTCTTGG7

CATTATTTATTACCTCCTTGGTTTTTT8

GCAGAGAAGAAGCAGGACCTAATGGAGT9

TGTTCCAGACATTTCAGCAGAAAGCTTTGCG10

CAGCACCGTCACCCTGGATTTTACGAACC11

TAAGTAGCGCACAGTTTTTCTTGCAGTG12

ACCAGCTCTTCGGGATGGCACAGTTTG13

GATCCCAAGAGAATGACCCAGAAGT14 TABLE 10

n _o and 9 and s - n < n b— < f and f and < F o rh F U δ f and n <

As shown in Tables 11 and 12 in the construction of section II, oligonucleotides 15-30 are assembled into eight duplexes (15 and 23; 16 and 24; 17 and 25; 18 and 26; 19 and 27; 20 and 28; 21 and 29 and 22 and 30). These eight duplexes are then ligated to form section II _; as shown in Table 12. As shown subsequently in Table 12, section II includes upstream one BamHI adhesive end and downstream EcoRI adhesive end used for ligation to the amplification vector and for ligation to section I. Near its the downstream end of section II also includes the downstream Sstl site used for eventual ligation of sections II and III.

____________________________________________ Table 11 EchpG-CSFDNA - SECTION II

GATCCCGTGGGCTCCGCTGTCTTCT15

TGTCCATCTCAAGCTCTTCAGCTGGC16

TGGTTGTCTGTCTCAACTGCATTCTGGT17

CTGTTCCTGTATATCAGGGTCTTCTG18

CAAGCTCTGGAAGGTATCTCTCCGGA19

ACTGGGTCCGACTCTGGACACTCTGCA20

GCTAGATGTAGCTGACTTTGCTACTACT21 (continued)

ATTTGGCAACAGATGGAAGAGCTCAAAG22

GACAAGAAGACAGCGGAGCCCACGG23

ACCAGCCAGCTGAAGAGCTTGAGATG24

ACAGACCAGAATGCAGTTGAGACAGACA25

CTTGCAGAAGACCCTGATACAGGA26

CAGTTCCGGAGAGATACCTTCCAGAG27

TAGCTGCAGAGTGTCCAGAGTCGGACC28

AAATAGTAGTAGCAAAGTCAGCTACATC29

AATTCTTTGAGCTCTTCCATCTGTTGCC30

TABLE 12

ο φ ο < Η ^- < Ε — ι Φ < φ cs Η <U Ο 00 Η φ Η Φ 21 ΐ U τ— ~ 4 φ Η φ <φ ΕΗ Η Η φ φ Φ U Γ-4 | Η Η < φ L · CNl φ φ φ Η < < φ φ υ Φ φ

φ ο Ε ^- * ο Η < Ο ο c 52 δ φ φ and Φ φ <! - < Η <b- Η φ * '' Ί 04 δ Φ Φ <ΙΝΙ φ Ε— ¹ < Η < < φ Q Φ Φ < Η < <

U Φ ο Η < Ο Η Φ < ο ο and Φ ο Η Η < '-' φ <and Η φ αο] φ φ δ- U Η < —Ί φ U φ Ο φ < (- Ι- Ε- < < and 2 Ο < Η Ε—! < Η Φ φ < 1- υ

Η ο ϋυ wl <Η <! η

ΟΙ ml

Lastly, Section III was constructed as shown in Tables 13 and 14. For this construction, oligonucleotides 31-42 were assembled into 6 duplexes (31 and 37; 32 and 38; 33 and 39; 34 and 40; 35 and 41; and 36 and 42). The six duplexes are then ligated to form Section III as shown in Table 14. As shown in Table 14 thereafter, Section III includes an upstream BamHI adhesive end and downstream EcoRI adhesive end used for ligation to an amplification vector, and at least in the case of the EcoRI terminus, into an expression vector. In addition, section II has an upstream Sstl site used for eventual ligation of sections II and III.

Table 13

EchpG-CSFDNA SECTION III

GATCCAAAGAGCTCGGTATGGCACCAG31

CTCTGCAACCGACTCAAGGTGCTATGCCG32

GCATTCGCTTCTGCATTCCAGCGTCGTGC33

AGGAGGTGTACTGGTTGCTTCTCATCTG34

CAATCTTTCCTGGAAGTATCTTACCGTGT35

TCTGCGTCATCTGGCTCAGCCGTAATAG36

AGAGCTGGTGCCATACCGAGCTCTTTG37 (Continued)

ATGCCGGCATAGCACCTTGAGTCGGTTGC

TCCTGCACGACGCTGGAATGCAGAAGCGA

ATTGCAGATGAGAAGCAACCAGTACACC

CAGAACACGGTAAGATACTTCCAGGAAAG

AATTCTATTACGGCTGAGCCAGATGACG

The Xbal to BamHI fragment formed in section I was ligated into an M13tr11 phage vector opened with Xbal and BamHI. The vector was then reopened by digestion of BamHI and EcoRI, followed by ligation with BamHI to the EcoRI fragment formed by section II. At this stage, sections I and II are connected in the correct orientation. Then another M13mpl1 vector was opened by BamHI to EcoRI digestion and then ligated with BamHI to the EcoRI fragment formed by section III.

The vector containing sections I and P was ground with Xbal u Sstl. Similarly, the vector containing section lll _z is digested with Sstl and EcoRI. Both smaller of the two fragments obtained by each grinding _; were ligated into plasmid pCFM1156, which was previously opened with Xbal and EcoRI. The product of this reaction is an expression plasmid. containing the continuous DNA sequence as shown in Table 15 encoding the entire hpG-CSF polypeptide with the amino terminal methionine codon (ATG) to initiate translation into E. coli.

TABLE 14

Ο

ο Ο ο n у

ο

οο | ml

'Xt'l ml

οι • ^ l <

<

Ε—

Φ υ ο <

Η and and φ <

Η <Η

Η <

sch | 'tl wl

ο τΓ

φ φ Ο υ φ Ό φ 40 φ < Η < φ Φ Φ φ φ < φ φ Η '< 40 Η < φ φ m φ φ Η < < φ φ < Η φ ¹ φ φ φ

<φ φ (- <

υ υ ο

ο

1D.

Η

Φ υ φ

Η ο

Η

Η φ Η <υ φ υ δ and

<

ο Η <

<Η φ 6 mlgg

Η <

Ρ <Η

Mr- | ml

Ο ml ml

Φ U Φ <Φ υ ΕΕ— <

φ υ φ φ φ φ <

<

φ

ο 'Τ φ φ φ Η <

<φ <Η <

ο

Φ Η Η

Η φ ο t

Η φ Η Η φ φ φ φ Η

<φ <

<φ φ φ <

<

m | ml

Η φ φ

Η Η φ Η Η φ φ <

φ φ ί

Although any suitable vector for expressing this DNA can be used, the expression plasmid pCFM1156 can be readily constructed from plasmid pCFM836, the construction of which is described in published application for European Patent No. 136,490. pCFM836 first cuts to Ndel and then blunt ends with Poll, thus destroying the two existing Ndel sites. The vector was then milled with Clal and Sacll to remove the existing polylinker prior to ligation to a replacement polylinker, as shown in Table 16. This replacement polylinker can be constructed according to the procedure of Alton, et al., Above. The expression control in the expression OCFM1156 plasmid is carried out by the lam6 to Pl promoter, which in turn can be controlled by C | ₈₅ 7 repressor gene (as supplied in E. coli strain K12AHtrp).

EXAMPLE 7

This example relates to the expression of a hpG-CSF polypeptide in E. coli by a DNA sequence encoding [Met ¹ ] hpCSF. The sequence used is partially synthetic and partly derived from cDNA. The synthetic sequence uses the preferred codons for E. coli.

Table 15

1 r— CL 0 0 - 5 0 ο 0 0 < φ (Λ 0 C ο 0 <L Ο 0 φ ΙΟ ο ° 8 ο Ο co < < Ο □ _ 0

(Continued)

Mr

IT;

Ο CD ff

1— <

Z5 φ it>

cn <

it>

_Z5

ZJ α>

φ χζ ο.

Η 0 I-C

Ζ3

GO (Ο τ ία »GO

GO <

(Continued)

Η

ΙΟ

Η I—

I— ο

Η ο Η

I—

I—

ΙΟ

Η ο Η

ΙΟ 0

GO

ΙΟ 0

_cz

GO <

03 0 Φ Η - * ο ο Γ-

IT)

Table 16

I— o o c o T H Q LO co O H μ Q l · < Ό Ό z 0 CD CM Ι- __7 Ο 03 x> s X CM Ι- No Ο 0 αί £ ο

CD

Plasmid PP2 containing the hpG-CSF gene shown in Table 7 was digested with HgiAl and Stul to provide a fragment of approximately 645 base pairs. at the 5 'end and approximately 100 base pairs from the 3' non-coding region. Grinding with HgiAl results in a 5 '4-base adhesive end identical to that of Pstl, and Stul leads to blunt ends. This allows for the rapid insertion of the fragment into M13 mp8 (Rf) cut with Pst1 and with the Hindi restriction enzyme forming blunt ends. After amplification in M13, the hpG-CSF DNA was excised by digestion with Apal and BamHI, which were truncated at Apa! site, having residual codons +3 to +5 on hpCSF and at the BamHI site downstream of the Hindi site in the M13 tr8 restriction polylinker. In order to allow expression of the hpG-CSF polypeptide in E. coli, a synthetic fragment was prepared as shown in Table 17 below.

Table 17 5 '- With TAG AAA AAA CCA AGG AGG TAA TAA ATA

3'- TTT TTT GGT TCC TCC ATT ATT TAT

Xbal

-1 +1

Met Thr Pro Leu

ATG ACA CCT CTG GGC C-5 '

TAC TGT GGA GAC - 3 '

Apal

As can be determined from the analysis of Table 17, the linker includes the Apal adhesive end, codons characterizing the original three amino acid residue residues of hpG-CSF ("restoring" Thr ¹ , Pro ² , Leu ₃ characterizing codons deleted after grinding with Apal of M13 DNA described above and using codons, preferably expressed in E. coli) initiating ATG translation, a 24 base pair sequence providing a ribosome binding site, and an Xbal adhesive end.

The expression vector used for expression in E. coli is the one described as pCFM536 in European Patent Application No. 136,490 by Morris, published April 10, 1985. (See also ATCC 39934, E. coli JM103 containing pCFM536). Briefly, plasmid pCFM536 was digested with Xbal u BamHI. The hpG-CSF fragment (Apal / BamHI) and the linker (Xbal / Apal) described above are then ligated thereto to form a plasmid designated p536Pro2.

Plasmid p536Pro2 was transformed into a variant of E. coli strain AM7, phage resistant, which had previously been transformed with plasmid pMW1 (ATCC No 39933) comprising the CI ⁸⁵⁷ gene. The transformation is verified on the basis of the antibiotic resistance marker gene (amp) transferred from the parent plasmid pCFM536. Cell cultures in LB broth (ampicillin 50 µg 1 ml) were maintained at 28 ° C and after cell growth in culture to A600 = 0.5, hpCSF expression was induced by raising the culture temperature to 42 ° C for 3 o'clock. The ultimate OD of culture is

A600 = 1.2.

It was determined on an SDS-polyacrylamide gel. stained with coomassie blue dye that the expression rate of hpG-CSF from the transformed cells is 3-5% of the total cellular protein.

Cells were harvested by centrifugation at 3500 g for 10 minutes in a JS-4.2 rotor. Cells at 25% (w / v) in water were destroyed by passing through French Pressure Cell at 10,000 p.s.i. The slurry cell suspension was centrifuged at 10,000 g for 15 minutes on a JA-20 rotor. The solid precipitate was resuspended in water and dissolved to approximately 5 mg / ml total protein in 1% lauric acid, 50 mM Tris, pH 8.7. The dissolved solid precipitate was centrifuged at 15,000 g for 10 minutes and CuSO2 was added to the supernatant; up to 20 tM. After 1 hour, this sample was passed onto a C4 HPLC purification column according to the procedures of Example 1 (B) with volume and concentration adjustment.

A second purification procedure is being developed to obtain larger amounts of hpG-CSF in an inorganic containing buffer. This product is suitable for in vivo studies. 150 grams of cell paste was resuspended in approximately 600 ml of 1 mM DTT and passed 4 times through a Manton Gualin Homogenizer at approximately 7,000 PSI. The slurry cell suspension was centrifuged at 10,000 g for 30 minutes and the solid was resuspended in 400 ml of 1% deoxycholate (DOC), 5 mM EDTA, 5 mM DTT and 50 mM

Tris, pH 9. This suspension was stirred at room temperature for 30 minutes and centrifuged at 10,000 g for 30 minutes. The solid precipitate was resuspended in approximately 400 ml of water and centrifuged at 10,000 g for 30 minutes. The solid precipitate was dissolved in 100 ml of 2% Sarkosyl and 50 mM Tris at pH 8. CuSO ₄ was added to 20 μΜ and the mixture was stirred for 16 hours at room temperature, then centrifuged at 20,000 g for 30 minutes. 300 ml of acetone were added to the supernatant. Put the mixture on ice for 20 minutes? then centrifuged at 5,000 g for 30 minutes. The solid precipitate was dissolved in 250 ml of 6M guanidine and 40 mM sodium acetate at pH 4, and placed on a 1,200 ml G-25 equilibration column and passed into 20 mM sodium acetate at pH 5.4. The hpG-CSF peak (about 400 ml) was pooled and loaded onto a 15 ml CM-cellulose column equilibrated in 20 mM sodium acetate at pH 5.4. After loading, the column was washed with 60 ml of 20 mM sodium acetate at pH 5.4 and 25 mM sodium chloride, after which the column was eluted with 200 ml of 20 mM sodium acetate at pH 5.4 and 37 mM sodium chloride. 150 ml of this eluent was concentrated to 10 ml and applied to a 300 ml G-75 equilibration column and passed into 20 mM sodium acetate and 100 mM sodium chloride at pH 5.4. The peak fractions containing 35 _ml> were pooled and filter sterilized. The final concentration of hpG-CSF, which is 1.5 mg / ml, has a purity above 95% purity as determined by gel analysis and contains less than 0.5 ng pyrogen per 0.5 mg hpG-CSF.

Pyrogen levels were determined using a Limulus Amebocite Lysate (LAL) (M.A. Bioproducts,

Walkersville, Md.).

EXAMPLE 8

This example relates to the use of recombinant methods for the generation of hpG-CSF analogs, wherein the cysteine residues present at positions 17, 36, 42, 64, and 74 are individually substituted with a suitable amino acid residue.

Site directed mutagenesis procedures were performed according to Souza, et al., Published PCT Application No. W085 / 00817, published February 28, 1985, on the [Met ^-1 ] coding DNA of plasmid p536Pro2 described below, using synthetic oligonucleotides ranging from 20 to 23 bases as indicated in Table 18 below. Oligonucleotide No 1 allows the formation of a gene encoding [Ser ¹⁷ ] hpG-CSF; oligonucleotide No 2 allows the formation of [Ser ³⁶ ] hpG-CSF, etc.

Table 18 Oligonucleotide Sequence

1. 5'-CTG STS AAG TCC TTA GAG CAA GT-3 '

2. 5 '-GAG AAG CTG TST GCC ACC TACA - 3'

3.5 '-TAC AAG CTG TCC CAC CCC GAG - 3' (Continued)

4. 5 '-TGA GCA GCT CCC CCA GCC AG-3'

5. 5 '-CTG GCA GGC TCC TTG AGC CAA-3'

Restriction of site-directed mutagenesis from Cys to Ser was performed using an M13 trYu containing an Xbal-BamHi hpG-CSF fragment isolated from p536Pro2 as template. DNA from each M13tr10 clone containing the Cys-Ser substitution was treated with Xbal and BamHI. The resulting fragment was cloned into the expression vector pCFM746 and the expression products were isolated as in Example 7.

Plasmid pCFM746 can be constructed by cleavage of plasmid pCFM736 (the construction of which, from deposited and publicly available materials, is described in Morris, PCT Application No. W085 / 00829, published 28.02.1985) with Clal u BamHI for removal of existing polylinker and by replacing the following polylinker.

Table 19

Clal ⁵ 'CGATTTGATTCTAGAATTCGTTAACGGTACCATGGAA ³ ' TAAACTAAGATCTTAAGCAATTGCCATGGTACCTT

GCTTACTCGAGGATCCGCGGATAAATAAGTAAC ^{* 3 *} CGAATGAGCTCCTAGGCGCCTATTTATTCATTGCTAG ⁵

Sau3a

In the process of purifying Cys to Ser analogs of the present invention, approximately 10-15 g of cell paste were resuspended in 40 ml of 1 mM DTT and passed three times through French Pressure Cell at 10,000 psi. The slurry cell suspension was centrifuged at 1000 g for 30 minutes. The solid precipitate was resuspended in 1% DOC, 5 mM EDTA, 5 mM DTT, 50 mM Tris, pH 9 and stirred for 30 minutes at room temperature. The mixture was centrifuged at 10,000 g for 30 minutes, resuspended in 40 ml of H ₂ O and again centrifuged at 10,000 g for 30 minutes. The solid precipitate was dissolved in 10 ml of 2% Sarkosyl, 50 mM DTT, 50 mM Tris, pH 8. After stirring for one hour, the mixture was clarified by centrifugation at 20,000 g for 30 minutes and then applied at 300 ml G-75 equilibrated column and passed in 1% Sarkosyl, 50 mM Tris, pH 8. Fractions _? containing the analogue are pooled and allowed to oxidize by exposure to air for at least 1 day. Final concentrations range from 0.5 - 5 mg / ml.

EXAMPLE 9

In this example, the mammalian cell expression system was split to verify whether an active hpG-CSF DNA polypeptide product could be expressed in and secreted by mammalian cells (COS-1, ATC CRL 1650). This system is designed to provide secretion of a polypeptide analog of hpG-CSF by expression and secretory processing of a partially synthetic, partially derived from cDNA coding structure [Ala ¹ ] hpG66

CSF., Preceded by leader polypeptide ₅ having the sequence of human attributed GMCSF residues in Wong, et al., Science, 228, 810-815 (1985) and Lee et al.,

Proc. Natl. Acad. Sci. (USA), 82, 4360 - 4364 (1985).

The expression vector used for preliminary studies of the expression polypeptide products of the invention is a shuttle vector] including both pBR322 and SV40 DNA that have been designed to allow autonomous replication in E. coli as well as in mammalian cells, with expression in mammalian cells of inserted exogenous DNA under the control of a viral promoter / regulatory DNA sequence. This vector, designated pSVDM-19, was transmitted from E. coli 101, deposited on 08/23/1985 at American Type Culture Collection, 12301 Parklawn Drive, Rockville, Md., And entry no. 53241.

The specific manipulations involved in the construction of the expression vector are as follows. The leader-coding DNA sequence was synthesized as indicated in Table 20 below.

Table 20

Hindlll Met Trp

5 '- A GCT TCC AAC ACC ATG TGG

3'-AGG TGG TGG TAC ACC ♦

(Continued)

Leu Gin Sir Leu Leu Leu Leu Gly Thr Val CTG CAG AGC CTG CTG CTC TTG GGC ACT GTG GAC GTC TCG GAC GAC GAG AAC CCG TGA CAC -1 + 1 Ala Cys Sir lie Sir Ala Pro Leu GCC TGC AGC ATC TCT GCA CCC CTG GGC G-3 ' CGG ACG TCG TAG AGA CGT GGG GAC -5 '

Apal

As indicated in Table 20, the sequence includes HindIII and Apal adhesive ends and codons for 17 amino acid residues ascribed to a "leader" by human GM-CSF. Following are codons characterizing the alanine residue, proline residue and leucine residue. Proline and leucine residues duplicate the amino acids present at positions +2 and +3 of hpG-CSF, while the alanine residue is more duplicate of the original amino-terminal (+1) residue of GM-CSF than of hpGCSF. The alanine threonine substitution is designed to facilitate proper “processing off” in the GM-CSF leader host cell by cellular mechanisms commonly involved in GM-CSF secretory processing.

Plasmid pSVDM-19 was digested with Kpnl and the site was blunted with a Klenow enzyme. The DNA is then digested with HindIII. The resulting large fragment was combined and ligated with

Hindlll / Pvull fragment ₇ shown in Table 7 (isolated from plasmid Rro2, as the second largest fragment resulting from digestion with Hindlll and partial digestion with _Pvul!)} 3a to form plasmid pSV-Ppol. The resulting GM-CSF leader sequence fragment from Table 8 was then ligated into pSV-Ppol (after its cleavage with HindIII and Ara1) _; to obtain plasmid pSVGM-Ppol.

Plasmid DNA pSVGM-Ppol _? precipitated with calcium phosphate (1-5 ug) _y is transformed repeatedly with 60 mm-ew plates COS-1 cells essentially as described by Wigler, et al., Cell, 14, 725-731 (1978). As a control, plasmid pSVDM-19 was also transformed into COS-1 cells. Tissue culture supernatants were harvested 5 days after transfection and assayed for hpG-CSF aggression. The yield of [Ala ¹ ] hpG-CSF from the culture supernatant is in the range of 1 to 2.5 pg / ml.

Following the successful expression of the [Ala ¹ ] hpG-CSF product encoded by plasmid pSVGM-Ppol, another vector was constructed in COS-1 cells that included a human GM-CSF leader sequence but having a codon for the threonine residue (naturally found hpGCSF position 1), which replaces the codon for alanine at this position. Briefly, oligonucleotide (5 'CAGCATCTCTACACCTCTGGG) was synthesized for site-directed mutagenesis (SDM). The HindIII to BamHI hpG-CSF fragment in pSVGM-Ppol was ligated into M13 trY for SDM. The newly synthesized hpG-CSF gene containing the Thr codon at position 1 was isolated by cleavage with HindIII and EcoRI. The fragment was then cloned into pSVDM19> prepared by cleavage with the same two restriction endonucleases. The resulting vector pSVGM-Ppo (Thr) was transformed into COS cells and the yield of hpG-CSF measured in the culture supernatant was in the range of 1 to 5 µg / ml.

Finally, the genomic sequence, the isolation of which is described in Example 5, is used to form an expression vector for expression of hpG-CSF in mammalian cells. In particular, pSVDM-19 was digested with Κρηϊ u HindIII and the large fragment was used in four-way synthetic linker ligation with HindIII and Ncol adhesive ends, as shown in Table 21. Ncol-BamHI fragment containing exon 1 isolated from pBR32 (8,500 hpG-CSF), a genomic subclone, and a BamHI-Kpnl fragment _; containing exons 2-5 isolated from plasmid pBR322 (8,500 hpG-CSF, genomic subclone). The mammalian expression vector obtained, pSV / ghG-CSF, produces 1 to 2.5 µg / ml hpG-CSF from transformed COS cells.

Table 21 Hindlll ⁵ 'agcttccaacac AGGTTGTGGTAC ⁵ Ncol

EXAMPLE 10

This example relates to the physical and biological properties of the recombinant polypeptide products of the present invention.

1. Molecular Weight

Recombinant hpG-CSF expression products in E. colli, as in example 7, have an apparent molecular weight of 18.8 kD when determined by reducing SDS-PAGE (as would be predicted from the deduced amino acid analysis of Table 7, where the natural isolates, such as those described in Example 1 have an apparent molecular weight of 19.6 kD The presence of N-glycans associated with natural isolates can indeed be ruled out on the basis of the lack of aspergine residues in the primary sequence of hpG-CSF of Table 7 and , therefore, a procedure is used to determine whether O-gl the moles are responsible for the difference in molecular weight between the natural isolates and the non-glycosylated recombinant products Approximately 5 µg of the natural isolate material is treated with neuraminidase (Calbiochem, LaJolla, California), a sample of 0.5 µg is removed and the remaining material is incubated with 4 mU O-glycanase (endo-x-acetylgalactosaminidase, Genzyme, Boston, Mass.) at 37 ° C. Abiquitous portions were removed after 1/2, 2 and 4 hours of incubation. These samples were subjected to SDS-PAGE side by side with a recombinant product derived from E. colli. After neuraminidase treatment, the apparent molecular weight of the isolate shifts from 19.6 kD to 19.2 kD, suggesting the removal of a sialic acid residue. Two hours after treatment with O-glycanase, the apparent molecular weight shifts from 18.8 kD - identical to the apparent molecular weight of product ₇ derived from E. colli. The sensitivity of the carbohydrate structure to neuraminidase and O-glycanase is suggested by the following structure for the carbohydrate component: N-acetyl-neuramic acid-a (2-6) galactose β (1-3) N-acetylgalactosamine-R, where R is serine or threonine.

2. ³ H-thymidine orientation

The induction of human bone marrow cell proliferation has been investigated on the basis of increased ³ H-thymidine incorporation. Human bone marrow from healthy donors was slotted for density with Ficoll-Hypaque (1.077 g / ml Pharmacia) and the low-density cells were suspended in Iscove's medium (GIBCO) containing 10% fetal bovine serum and glutamine pen-strep. Then 2x10 ⁴ human bone marrow cells were incubated with either control medium or recombinant E. colli material from Example 7 in 96-well flat bottom plates at 37 ° C in 5% CO ₂ in air for two days. Samples were tested in duplicate and the concentration varied over 10,000 times. The cultures were then cultured for 4 hours with 0.5 μCi / well ³ H-thymidine (New England Nuclear, Boston, Mass.). ³ H-thymidine orientation was measured as described in Ventua, et al., Blood, 61, 781 (1983). In this study, human hpG-CSF isolates could be induced by including ³ H-thymidine in human bone marrow cells at approximately levels 4-10 times higher than control supernatants. The hpG-CSF product derived from E. colli of Example 6 has similar properties.

A second study of human bone marrow cell proliferation was performed using the culture medium of transfected COS-1 cells as prepared in Example 9, and yielded similar results, indicating that the encoded polypeptide products are indeed secreted into the culture medium as active products.

3. WEHI - 3B D + induction of differentiation The ability of recombinant products derived from E. colli to produce differentiation of the murine myelomonocytic leukemic cell line WEHI - 3B D + _? is tested in semi-solid agar medium as described in Metcalf, Int. J. Cancer, 25, 225 (1980). The recombinant hpG-CSF product and media controls were incubated with 60 WEHI - 3B D + kettle / well at 37 ° C in 5% CO ₂ in air for 7 days. Samples were incubated in 24 flat bottom well plates and concentrations varied over 2,000 times. Colonies are classified as undifferentiated, partially differentiated, or fully differentiated, and cell colonies are counted under a microscope. The recombinant product of E. colli was found to induce differentiation.

4. CFU-GM, BFU-E and CFU-GEMM studies

Natural isolates of pluripotent human G-CSF (hpG-CSF) and recombinant pluripotent human G-CSF (rhpG-CSF) have been found to cause proliferation and differentiation of human bone marrow cells. These actions are measured at CFU-GM [Broxmayer, et al., Exp. Hematol., 5, 87, (1971)] BFU-E and CFU-GEMM studies [Lu, et al., Blood, 61, 250 (1983)] using low-density, non-adherent human bone marrow cells volunteer. Comparisons of CFU-GM, BFU-E, and CFU-GEMM biological activities using 500 units of hpG-CSF or rhpG-CSF are shown in Table 22 below.

All colony studies were performed at low density, non-adherent bone marrow cells. Human bone marrow cells were slotted for density with Ficoll-Hypaque (density 1.077 g / cm ³ ; Pharmacia). The low-density cells were then resuspended in Iscove's modified Dulbecco's medium containing fetal calf serum and plated for Falcon tissue culture plates (No 3003, Becton Dickenson, Cockeysville, Md.) For GL at 37 ° C.

Table 22

CFU-GM BFU-E CFU-GEMM Wednesday 0 ± 0 26 + 1 0 ± 0 HpG-CSF neutral 83 + 5.4 83 + 6.7 4 + 0 rhpG-CSF 87 + 5 81 + 0.1 6 + 2

The control medium consisted of Iscove's modified Dulbecco's medium plus 10% FCS, 0.2 mM hemin and one unit of recombinant erythropoietin.

For the CFU-GM assay, target cells were seeded at 1x10 ⁵ in 1 ml of 0.3% agar culture medium, which included supplemented McCoy's 5A medium and 10% heat-inactivated fetal calf serum. The cultures were counted for colonies (over 40 cells per unit) and morphologically determined on day 7 of cultivation. The number of colonies is shown as a mean of ± SEM, as determined by dishes in four replicates.

For BFU-E and CFU-GEMM assay, cells (1x10 ⁵ ) were added to 1 ml of a mixture of Iscove's modified Dulbecco's medium (Gibco), 0.8% methylcellulose, 30% fetal calf serum, 0.05 nM 2-mercaptoethanol 0 , 2 mM hemin and one unit of recombinant erythropoietin. The dishes were incubated in a humidified atmosphere of 5% CO ₂ and 5% O ₂ . Low oxygen pressure was obtained using an oxidizer from Reming Bioinstruments (Syracuse, NY). Colonies were counted after 14 days of incubation. The number of colonies is shown as their mean ± SEM as determined by the duplicate dishes.

For all colonies formed in the CFU-GM study, chloroacetate esterase was found to be positive and negative to nonspecific esterase (alpha-naphthyl acetate esterase), which was consistent with granulocyte-type colonies. Both natural hpG-CSF and rhpG-CSF were found to have a specific activity of approximately 1x10 ⁸ U / mg pure protein in serial dilution studies in the CFU-GM study. The BFU-E and CFU-GEMM data in Table 22 are representative of three separate experiments and are similar to those previously reported for natural hpGCSF. It is important to note that rhpG-CSF is extremely pure and devoid of other mammalian potential growth factors due to its production in E. coli. Therefore, rhpG-CSF is capable of supporting mixed column formation (CFU-GEMM) and BFU-E when added in the presence of recombinant erythropoietin.

5. Cell-binding assay

It has been reported previously that WEHI-3B (D ⁺ ) cells and human leukemia cells from newly diagnosed leukemias bind ¹²⁵ 1-labeled mouse G-CSF, and that this binding can be complete by the addition of unlabeled GCSF or human CSF-β. The ability of native hpG-CSF and rhpG-CSF to compete in the binding of ¹²⁵ l-hpG-CSF to human and mouse leukemic cells was tested. Highly purified natural hpG-CSF (> 95% purity; one pg) is iodized [Tejedor, et al., Anal. Biochem., 127, 143 (1982)], is separated from the reactants by gel filtration and ion exchange chromatography. The specific activity of native ¹²⁵ l-hpG-CSF is approximately 100 pCi / pg protein. Mouse WEHI-3B (D ⁺ ) and two human peripheral blood myeloid leukemia cell preparations (ANLL, one classified as M4, the other as M5B) were tested for their ability to bind ¹²⁵ l-hpG-CSF.

Mice and freshly obtained myeloid leukemic cells from human peripheral blood were washed three times with PBS / 1% BSA. WEHI-3B (D ⁺ ) cells (5x10 ⁶ ) or fresh leukemic cells (3x10 ⁶ ) were incubated repeatedly in PBS / 1% BSA (100 pl) in the absence or presence of different concentrations (volume: 10 pl) of unlabeled hpG- CSF, rhpG-CSF or GM-CSF and in the presence of ¹²⁵ l-hpG-CSF (approximately 100,000 cpm or 1 ng) at 0 ° C for 90 minutes (total volume: 120 pl). The cells were then resuspended and spread over a layer of over 200 µg of ice-cold FCS in 350 µl plastic centrifuge tubes and centrifuged (1 000 g; 1 minute). The solid precipitate was collected by cutting the bottom of the tube and the solid precipitate and supernatant were counted individually in a gamma counter (Packard).

Specific binding (cpm) is defined as total binding in the absence of a competitor (mean of repetitions) minus binding (cpm) in the presence of a 100-fold excess of unlabeled hpG-CSF (nonspecific binding). Non-specific binding is a maximum of 2 503 cpm for WEHI-3B (D ⁺ ) cells, 1 072 cpm for ANLL (M4) cells and 1 125 cpm for ANLL (M5B) cells. Experiments 1 and 2 were performed on different days using the same ¹²⁵ i-hpG-CSF preparations and depicted the intrinsic substance in percentage inhibition recorded for 2,000 hpG-CSF units. The data obtained are listed in Table 23 below.

Table 23

WEHI-3B (D ⁺ ) ANLL (M4) ANLL (M5B)

The competitor (U / ml) cpm % inhibition. cpm % inhibition. cpm % inhibition. Experience 1 0 6,608 th most common - 1,218 th most common - 122 - there is no natural 10,000 685 90 hpG-CSF: 2,000 1,692 th most common 74 34 97 -376 0 200 2,031 th most common 69 rhpG-CSF; 10,000 0 100 2,000 1,185 th most common 82 202 83 0 0 200 2,330 65 Experience 2 there is no 0 2,910 th most common 0 natural hpG-CSF: 2,000 628 78 GM-CSF: 2,000 3,311 th most common 0

As shown in Table 23, ¹²⁵ l-hpG-CSF showed binding to WEHI-3B (D ⁺ ) leukemic cells. Binding was inhibited in a dose-dependent manner by unlabeled natural hpG-CSF or rhpG-CSF but not by GM-CSF. In addition, binding of natural hpG-CSF to human myelomonocytic leukemia cells (ANLL, M4) has been observed. Binding to these cells is parallel to the response to native hpG-CSF in liquid cultures by differentiation into mature macrophages, as judged by morphology. The absence of binding of natural ¹²⁵ l-hpG-CSF to monocytic leukemia cells from another patient (ANLL, M5B) suggests that some leukemias may differentially express or lack receptors for hpG-CSF. The ability of rhpG-CSF to compete for the binding of native ¹²⁵ l-hpG-CSF, similar to natural hpG-CSF suggests that receptors are equally well recognized in both forms.

These studies, demonstrating the binding of natural ¹²⁵ 1-labeled hpG-CSF to leukemic cells, are in parallel in culture for the ability of natural hpG-CSF to induce differentiation of low-density bone marrow granulocytes from a single patient with acute promyelocytic leukemia (M3) and a second patient with acute myeloblastic leukemia (M2). Cells from each patient were cultured for 4 days only in medium or in the presence of 1x10 ⁵ units of rhpG-CSF. Cells from M3 control cultures incubated in medium alone are still promyelocyte type; while cells cultured in the presence of rhpG-CSF show mature myeloid-type cells, including metamyelocytes, a giant-shaped form, and segmented neutrophils and monocytes. The actual differential count for this patient, per 100 cells calculated from control, 100% promyelocytes, and for cells / treated with rhpG-CSF; 22% blasts plus promyelocytes, 7% myelocytes, 35% metamyelocytes, 20% stripe forms plus segmented neutrophils, 14% monocytes and 2% macrophages. It should be noted that one of the polymorphonuclear granulocytes still contains a remarkable auer genus, suggesting that at least this cell represents a differential cellular affiliation with the leukemic clone. Cells from the second patient with myeloblastic leukemia (M2) were also cultured for four days in the presence or absence of rhpG-CSF. Visual analysis of M2 cells cultured only in medium revealed large "blast-like" cells, some of which possess nuclear bodies. Some of the M2 cells upon rhpG-CSF treatment differentiate into mature segmented neutrophils showing residual auer rods in the center of the neutrophils, suggesting differentiation occurring in a cell belonging to a leukemic clone. The actual differentiation of one hundred cells, evaluated and morphologically, indicates that the control cells consist of 100% blasts. Cells / treated with rhpG-CSF consist of 43% blasts, 1% myelocytes, 15% metamyelocytes, 28% stripe plus segmented neutrophils, 2% promonocytes and 11% monocytes. Leukemic cells were also checked for differentiation at four other concentrations of rhpG-CSF (5x10 ³ , 1x10 ⁴ , 2.5x10 ⁴ and 5x10 ⁴ U / ml; data not shown). Even at the lowest tested concentrations (5x10 ³ U / ml) of rhpG-CSF, there was significant differentiation (cells differentiate beyond myelocytes) of M3 (50%) and M2 (37%) leukemia cells.

6. Immunoassay

For the preparation of polyclonal antibodies for immunoassay, the antigen used is pluripotent G-CSF purified from human bladder carcinoma cell line 5637 (1A6) as obtained in Example 1 (B). This product is estimated to be 85% pure based on silver nitrate staining of polyacrylamide gels. Vayu / C mice at 6 weeks of age are immunized with subcutaneous antigen injections. The antigen was resuspended in PBS and emulsified with equal volumes of Freund's complete adjuvant. The dose is 5 to 7 µg of mouse antigen per injection. 18 days later, auxiliary immunizations with the same amount of antigen emulsified with an equal volume of incomplete Freund adjuvant were administered. After 4 days, serum from mice was taken to test a specific antibody for human pluripotent G-CSF.

Dynatech Immulon II Removawell frames in frames (Dynatech Lab., Inc., Alexandria, Va.) Were coated with hpG-CSF 5 pg / ml in 50 mM carbonate-bicarbonate buffer, pH 9.2. The wells were covered with 0.25 pg in a volume of 50 μΙ. Antigen-coated dishes were incubated for two hours at room temperature and overnight at 4 ° C. The solution was decanted and the plates were incubated for 30 minutes with PBB containing 5% BSA to block the reactive surface. This solution was decanted and diluted pre-immune or test sera were added to the wells and incubated for 2 hours at room temperature. Sera were diluted with PBS pH 7.0 containing 1% BSA.

The serum solution was decanted and the dishes were washed three times with washing solution (KPL, Gaithersburg, Md.). Approximately 200,000 cpm iodinated rabbit antimouse IgG (NEN, Boston, Mass.) In 50 μΙ PBS, pH 7.0 containing 1% BSA was added to each well. After 1 hour of incubation at room temperature, the solution was decanted and the dishes were washed five times with washing solution. The wells are removed from the frames and counted on a Beckman 5 500 gamma counter. High titer mouse sera show more than 12 times higher reactivity than the corresponding preimmune sera at a 1: 100 dilution.

The immunological properties of hpG-CSF derived from E. coli y are determined by the reactivity of high-titer mouse sera specific for hpG-CSF derived from mammalian cells. A 0.25 pg protein with 90% purity ₅ obtained from E. coli was coated with 50 μm immulon II Removawells! and the mouse serum was examined as described above.

High titer mouse sera show more than 24 times higher reactivity to a product derived from E. coli than the corresponding pre-immune sera at a dilution of 1: 100.

7. Bioassay of the serine analogue [Ser ¹⁷ ] hpG-CSF, [Ser ³⁶ ] hpG-CSF, [Ser ⁴² ] hpG-CSF, [Ser ⁶⁴ ] hpG-CSF and [Ser ⁷⁴ ] hpG-CSF products obtained according to Example 9 were tested for hpG-CSF activity in ³ H-thymidine orientation assays, CFU-GM and WEHI-3B D ⁺ cells. In each assay [Ser ¹⁷ ], the analogue had activity ₇ comparable to that of recombinant molecules having the native structure. The remaining analogues have about 100 times lower activity in the ³ H-thymidine orientation study, 250 times lower activity in the CFU-GM study, and 500 times lower activity in the WEHI-3B D ⁺ study. These data support the suggestion that cysteines at positions 36, 42, 64 and 74 may be required for full biological activity.

8. In vivo bioassay

Alzet® osmotic pumps (Alzet Corp., Palo Alto, Calif .; Model 2001) are connected to permanent catheters of the right jugular vein and implanted subcutaneously into seven male Syrian golden hamsters. Four of the pumps contained buffer [20 mM sodium acetate (pH 5.4) and 37 mM sodium chloride] and 1.5 mg / ml hpG-CSF obtained from E. coli, while three of the pumps contained only buffer. The claimed rate of osmotic pumps is 1 microliter / hour for up to 7 days. On the third day after pump implantation, the average granulocyte count of the four treated hamsters was 6-fold higher than that of the three (buffer) controls, and the increased granulocyte count reflected a fourfold increase in total lymphocytes. The erythrocyte count did not change after treatment. These results indicate that the recombinant product results in a specific enhancement of the production and / or release of granulocytes in mammals.

In addition to the naturally occurring allelic forms of hpG-CSF, the present invention also includes other hpG-CSF products such as hpG-CSF polypeptide analogs and fragments of hpG-CSF. Following the methods of the aforementioned published application by Alton, et al., (W083 / 04053), one of ordinary skill in the art can also easily design microbial expression of primary conformations, to produce genes encoding polypeptides having different from the identities identified herein or the location of one or two residues (e.g., substitution, terminal or intermediate addition, or deletions). Alternatively, modifications of the cDNA and genomic genes can be readily accomplished with well-known techniques for site-directed mutagenesis and used to generate analogs and derivatives. Such products would share at least one of the biological properties of hpG-CSF, but may differ from others. For example, planned products according to the invention include those that are abbreviated, for example, by deletions; or those that are more resistant to hydrolysis (and may therefore have a more pronounced or prolonged effect than naturally occurring in nature); or which have been altered to deletion one or more of the potential o-glycosylation sites (which may result in higher activity of yeast products); or which may have one or more cysteine residues, deleted or substituted by, for example, alanine or serine residues, and potentially more readily isolated in active form by microbial systems; or which have one or more tyrosine residues substituted by phenylalanine and can bind more or less readily to the hpGCSF receptors of target cells. Also included are polypeptide fragments that duplicate only part of a continuous amino acid sequence or secondary conformations in hpG-CSF, which fragments may have one activity (e.g., for receptor binding) and not others (e.g., activity to stimulate colony growth ). It should be noted that the activity of some or more of the products of the invention need not have a therapeutic benefit [see, Weiland, et al., Blut, 44, 173-175 (1982)] or a benefit in another context, for example studies of hpG-CSF antagonism. Competitive antagonists can be quite useful, for example in the case of hpG-CSF overproduction.

According to another embodiment of the present invention, the described DNA sequence encoding hpG-CSF polypeptides is valuable for the information provided with respect to the amino acid sequence of a mammalian protein that was not yet available, despite the analytical approach of isolating naturally occurring in nature products. DNA sequences are also clearly valuable as products useful for carrying out microbial synthesis of hpG-CSF on a large scale through a wide variety of recombinant techniques. On the other hand DNA sequences _? provided by the present invention are used to generate new and useful viral and circular plasmid DNA vectors, new and useful transformed and transfected! host microbial prokaryotic and eukaryotic cells (including bacterial and yeast cells and cultured mammalian cells), and novel and useful methods for culturing such microbial host cells capable of expressing hpG-CSF and related products. The DNA sequences of the present invention are also particularly suitable products for use as labeled probes for the isolation of hpG-CSF and related proteins encoding human genomic DNA, as well as cDNA and genomic DNA sequences from other mammalian species. DNA sequences can also be used in various alternative methods for protein synthesis (eg in insect cells) or in gene therapy for humans and other mammals. It is expected that the DNA sequences of the present invention will be used in the development of transgenic mammalian species that can serve as eukaryotic "hosts" for the quantitative production of hpG-CSF and hpG-CSF products. See generally Palmiter, et al., Science, 222 (4625), 809-814 (1983).

For the applicability of the hpG-CSF fragments and polypeptide analogs of the invention, there are reports of immunological activity of synthetic peptides that essentially duplicate existing amino acid sequences in naturally occurring proteins, glycoproteins and nucleoproteins. In particular, relatively low molecular weight polypeptides have been shown to participate in immune responses that are similar in duration and range to the immune responses of physiologically relevant proteins, such as viral antigens, polypeptide hormones and the like. The immune responses of such polypeptides include the provocation of the formation of specific antibodies in immunologically active animals. See, for example, Lerner, et al.,

23, 309-310 (1981); Ross, et al., Nature 294, 654-656 (1981);

Walter, et al., Proc. Natl. Acad. Sci. (USA), 77, 5197-5200 (1980);

Lerner, et al., Proc. Natl. Acad. Sci. (USA), 78, 3403-3407 (1981);

Walter, et al., Proc. Natl. Acad. Sci. (USA), 78, 4882-4886 (1981);

Wong, et al., Proc. Natl. Acad. Sci. (USA), 78, 7412-7416 (1981);

Green, et al., Cell, 28, 477-487 (1982); Nigg, et al., Proc. Natl. Acad. Sci. (USA), 79, 5322-5326 (1982); Baron, et al., Cell 28, 395-404 (1982); Dreesman, et al., Nature, 295, 185-160 (1982); in Lerner, Scientific American, 248, No.2, 66-74 (1983). See also Kaiser, et al., Science, 223, 249-255 (1984) ₎ for biological and immunological activities of synthetic peptides that approximately share the secondary structures of peptide hormones but do not share their primary conformation.

As the present invention is described with respect to preferred embodiments, it should be understood that those skilled in the art would use variations and modifications. It is therefore understood that the appended claims include all such equivalent variations that are included within the scope of the invention according to the claims.

Claims (5)

Patent Claims A purified and isolated DNA sequence consisting essentially of a DNA sequence encoding a human pluripotent granulocyte colony-stimulating factor. The purified and isolated DNA sequence of claim 1, wherein said DNA sequence is a cDNA sequence. A plasmid or viral DNA vector comprising the DNA sequence of claim 1. A prokaryotic or eukaryotic host cell, stably transformed or transfected with the DNA sequence of claim 1, in a manner allowing expression of a semi-uripotent colony-stimulating factor. 5. Process for the preparation of a polypeptide product, wherein the culturing under suitable nutrient conditions procaryotic or eucaryotic host cells transformed or transfected with a DNA sequence encoding human _t pluripotent granulocyte colony-stimulating factor in a manner allowing expression of said polypeptide product, and the desired polypeptide product is isolated from the expression of said DNA sequence.