Technical diving
43 Followers
Recent papers in Technical diving
Since always and whatever the category, professional divers encountered a lot of accidents which are, due to the environment often lethal. As the causes of these accidents are often the same, the purpose of the present article is to... more
Questo manuale è il frutto di grande conoscenza ed esperienza ed è stato progettato per addestrare all'immersione tecnica i subacquei sportivi che siano già esperti ed abili e che posseggono come prerequisito minimo di addestramento il... more
Geoposizionamento, rilievo, campionatura e analisi dendrocronologica delle specie arboree della foresta sommersa del lago di Tovel (TN). Con il patrocinio del Parco Naturale Adamello Brenta e del Comune di Ville d'Anaunia (TN) e la... more
Nella formazione di un subacqueo questo corso è il più importante dopo quello iniziale e determina il definitivo passaggio da una attività ricreativa e non impegnativa ad una piùcosciente e ragionata. Per questo bisogna essere consapevoli... more
Le informazioni contenute in questo manuale introducono all'utilizzo delle miscele trimix, limitatamente a quelle normossiche. Il termine normossico, come già è stato introdotto dai corsi precedenti, indica quelle miscele con la... more
Manuale IANTD per l'addestramento di miscelatori di gas (gas blender) e operatori di pompe pneumatiche (booster operator). Centootto pagine di tecnica e operatività per svolgere con maestria e sicurezza tutte le operazioni per realizzare... more
Fabio Ruberti ha voluto, con questo approfondito studio di archeologia subacquea sulla corazzata Santo Stefano, iniziare una importante e insostituibile collana di libri sui Relitti nella Storia. Questa attività permetterà di colmare quel... more
Fishes inhabiting rhodolith beds and reefs at mesophotic depths on the Abrolhos Shelf, which encompasses the largest and richest coral reef formation in the South Atlantic Ocean, were assessed through technical diving and remotely... more
Quando, nel 2004, Fabio Ruberti venne a trovarmi nella redazione di SUB per parlarmi di un ambizioso progetto legato alla sua formazione storica e subacquea non potei fare a meno di ascoltarlo con grande interesse. Allora, le riviste... more
Articolo sulla nascita della subacquea tecnica in Italia dopo circa due anni dal'inizio della sua attività con i corsi della IANTD (International Association of Nitrox and Technica Diver) condotti da Fabio Ruberti.
During the last few decades, Cape Town Castle has been extensively renovated. Parallel to this, a series of archaeological excavations were undertaken under the auspices of different institutions. During the course of these, it became... more
Abstract: Safety is one of the most important components of diving. In various diving systems, there are many different methods in case of diver missing and physical sudden problems of the divers. Based on the rapid progress of science... more
La IANTD è stata la prima agenzia didattica a pensare, studiare e offrire corsi per immersione nei relitti (wreck diving) ed è all'avanguardia a livello mondiale in questo campo, grazie alla sua esperienza pluridecennale e ai suoi... more
... 16. © Allerton Press, Inc., 2011 ... of amplification of a 734 bp fragment of the hLF gene using pair of primers GL F (5' TGTCTTC CTCGTCCTGCTGTTCC 3') and GL R (5' CAT ACTCGTCCCTTTCAGCCTCG 3').... more
Dozens of marine fih species are known to form spawning aggregations, a behaviour that often increases the species vulnerability to fiheries. Therefore, it is widely recommended for aggregation sites to be considered a conservation... more
... 16. © Allerton Press, Inc., 2011 ... of amplification of a 734 bp fragment of the hLF gene using pair of primers GL F (5' TGTCTTC CTCGTCCTGCTGTTCC 3') and GL R (5' CAT ACTCGTCCCTTTCAGCCTCG 3').... more