Skip to main content
Since always and whatever the category, professional divers encountered a lot of accidents which are, due to the environment often lethal. As the causes of these accidents are often the same, the purpose of the present article is to... more
    • by 
    •   11  
      Civil EngineeringDivingEnvironmental Health and SafetyScuba Diving
Questo manuale è il frutto di grande conoscenza ed esperienza ed è stato progettato per addestrare all'immersione tecnica i subacquei sportivi che siano già esperti ed abili e che posseggono come prerequisito minimo di addestramento il... more
    • by 
    •   8  
      DivingDiving TourismScuba DivingScientific Diving
Geoposizionamento, rilievo, campionatura e analisi dendrocronologica delle specie arboree della foresta sommersa del lago di Tovel (TN). Con il patrocinio del Parco Naturale Adamello Brenta e del Comune di Ville d'Anaunia (TN) e la... more
    • by 
    •   11  
      Alpine ResearchDendrochronologyAlpine GeomorphologyAlpine Archaeology
Nella formazione di un subacqueo questo corso è il più importante dopo quello iniziale e determina il definitivo passaggio da una attività ricreativa e non impegnativa ad una piùcosciente e ragionata. Per questo bisogna essere consapevoli... more
    • by 
    •   12  
      DivingDiving TourismScuba DivingScientific Diving
Le informazioni contenute in questo manuale introducono all'utilizzo delle miscele trimix, limitatamente a quelle normossiche. Il termine normossico, come già è stato introdotto dai corsi precedenti, indica quelle miscele con la... more
    • by 
    •   11  
      DivingDiving TourismScuba DivingScientific Diving
Manuale IANTD per l'addestramento di miscelatori di gas (gas blender) e operatori di pompe pneumatiche (booster operator). Centootto pagine di tecnica e operatività per svolgere con maestria e sicurezza tutte le operazioni per realizzare... more
    • by 
    •   4  
      DivingScuba DivingScientific DivingTechnical diving
    • by 
    •   117  
      ReligionSumerian ReligionHistoryCultural History
Fabio Ruberti ha voluto, con questo approfondito studio di archeologia subacquea sulla corazzata Santo Stefano, iniziare una importante e insostituibile collana di libri sui Relitti nella Storia. Questa attività permetterà di colmare quel... more
    • by 
    •   10  
      HistoryMaritime ArchaeologyMaritime HistoryWorld War I
Fishes inhabiting rhodolith beds and reefs at mesophotic depths on the Abrolhos Shelf, which encompasses the largest and richest coral reef formation in the South Atlantic Ocean, were assessed through technical diving and remotely... more
    • by 
    •   7  
      Tropical EcologyROVRemotely Operated VehicleTechnical diving
Despite a strong increase in research on seamounts and oceanic islands ecology and biogeography, many basic aspects of their biodiversity are still unknown. In the southwestern Atlantic, the Vitória-Trindade Seamount Chain (VTC) extends... more
    • by  and +1
    •   19  
      Coral ReefsROVRemotely Operated VehicleCommercial Fisheries
    • by 
    •   8  
      MathematicsArtificial IntelligenceScuba DivingScientific Diving
Quando, nel 2004, Fabio Ruberti venne a trovarmi nella redazione di SUB per parlarmi di un ambizioso progetto legato alla sua formazione storica e subacquea non potei fare a meno di ascoltarlo con grande interesse. Allora, le riviste... more
    • by 
    •   9  
      HistoryMaritime ArchaeologyMaritime HistoryUnderwater Archaeology
Articolo sulla nascita della subacquea tecnica in Italia dopo circa due anni dal'inizio della sua attività con i corsi della IANTD (International Association of Nitrox and Technica Diver) condotti da Fabio Ruberti.
    • by 
    •   19  
      DivingDiving TourismScuba DivingScientific Diving
    • by 
    •   2  
      Underwater ArchaeologyTechnical diving
During the last few decades, Cape Town Castle has been extensively renovated. Parallel to this, a series of archaeological excavations were undertaken under the auspices of different institutions. During the course of these, it became... more
    • by 
    •   2  
      Underwater ArchaeologyTechnical diving
Abstract: Safety is one of the most important components of diving. In various diving systems, there are many different methods in case of diver missing and physical sudden problems of the divers. Based on the rapid progress of science... more
    • by 
    •   11  
      MathematicsComputer ScienceArtificial IntelligenceDiving
    • by 
    •   5  
      Scuba DivingScientific DivingTechnical divingAdvanced Scuba Diving
La IANTD è stata la prima agenzia didattica a pensare, studiare e offrire corsi per immersione nei relitti (wreck diving) ed è all'avanguardia a livello mondiale in questo campo, grazie alla sua esperienza pluridecennale e ai suoi... more
    • by 
    •   15  
      DivingScuba DivingScientific DivingRelitti
... 1–6. © Allerton Press, Inc., 2011 ... of amplification of a 734 bp fragment of the hLF gene using pair of primers GL F (5' TGTCTTC CTCGTCCTGCTGTTCC 3') and GL R (5' CAT ACTCGTCCCTTTCAGCCTCG 3').... more
    • by 
    •   16  
      Marine BiologyIchthyologyMarine EcologyBenthic Ecology
Dozens of marine fih species are known to form spawning aggregations, a behaviour that often increases the species vulnerability to fiheries. Therefore, it is widely recommended for aggregation sites to be considered a conservation... more
    • by 
    •   11  
      Evolutionary BiologyZoologyNatural HistoryBrazil
... 1–6. © Allerton Press, Inc., 2011 ... of amplification of a 734 bp fragment of the hLF gene using pair of primers GL F (5' TGTCTTC CTCGTCCTGCTGTTCC 3') and GL R (5' CAT ACTCGTCCCTTTCAGCCTCG 3').... more
    • by 
    •   17  
      Marine BiologyIchthyologyMarine EcologyBenthic Ecology