Nutrition and Cancer ISSN: 0163-5581 (Print) 1532-7914 (Online) Journal homepage: http://www.tandfonline.com/loi/hnuc20 Association of Genetic Variants of CYP2C19 and CYP2D6 with Esophageal Squamous Cell Carcinoma Risk in Northern India, Kashmir Gulzar Ahmad Bhat, Arshid Bashir Bhat, Mohd Maqbool Lone & Nazir Ahmad Dar To cite this article: Gulzar Ahmad Bhat, Arshid Bashir Bhat, Mohd Maqbool Lone & Nazir Ahmad Dar (2017): Association of Genetic Variants of CYP2C19 and CYP2D6 with Esophageal Squamous Cell Carcinoma Risk in Northern India, Kashmir, Nutrition and Cancer, DOI: 10.1080/01635581.2017.1299874 To link to this article: http://dx.doi.org/10.1080/01635581.2017.1299874 View supplementary material Published online: 03 Apr 2017. Submit your article to this journal View related articles View Crossmark data Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=hnuc20 Download by: [The UC San Diego Library] Date: 04 April 2017, At: 00:02 NUTRITION AND CANCER http://dx.doi.org/10.1080/01635581.2017.1299874 Association of Genetic Variants of CYP2C19 and CYP2D6 with Esophageal Squamous Cell Carcinoma Risk in Northern India, Kashmir Gulzar Ahmad Bhata, Arshid Bashir Bhata, Mohd Maqbool Loneb, and Nazir Ahmad Dara a Department of Biochemistry, University of Kashmir, Srinagar, India; bDepartment of Radiation Oncology, SK Institute of Medical Sciences, Srinagar, India ABSTRACT ARTICLE HISTORY Genetic polymorphism in xenobiotic metabolizing enzymes (XMEs) is associated with various malignancies. However, the association of esophageal cancer with XMEs is mixed. The current study was aimed to explore the association of genetic polymorphisms of cytochrome (CYP) 2C19 and CYP2D6 genotypes with esophageal squamous cell carcinoma (ESCC) risk in Kashmir, India. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and sequencing methods were used for genotyping of 492 ESCC cases and equal number of individually matched controls. Conditional logistic regression models were used to assess odds ratios (ORs) and 95% confidence intervals. Increased ESCC risk was observed in subjects with variant genotypes of CYP2C19 (OR D 3.3) or CYP2D6 (OR D 2.1) and risk was higher (OR D 4.6) in subjects who harbored both the genotypes. Almost same but higher risk turned when subjects were smokers and carried a variant genotype of CYP2C19 (OR D 4.4) or CYP2D6 (OR D 4.7). Risk was appreciably increased in subjects who had family history of any cancer and also harbored a variant genotype of either CYP2C19 (OR D 15.5) or CYP2D6 (OR D 9.7). Subjects harboring a variant genotype of CYP2D6 showed an added risk when they used biomass as fuel (OR D 4.6). In conclusion, variant genotypes of CYP2C19 and CYP2D6 are associated with an increased risk of ESCC. Received 15 May 2015 Accepted 13 January 2017 Introduction Number of environmental exposures and lifestyle factors are associated with esophageal squamous cell carcinoma (ESCC) risk (1). However, the risk associated with these factors is not consistent across different populations and among individuals who share similar exposures (2,3), which shows that exposure effect varies from individual to individual. Most toxic chemical exposures are metabolized by certain enzymes and either increase or decrease their toxic effects (4). However, genetic variations including polymorphism, in such enzymes alter their activity of handling the environmental chemicals (xenobiotics) and render them sometimes more efficient to activate procarcinogens into carcinogens and might contribute to cancer development. For example, cytochrome P450 (CYP) enzymes, the phase-1 xenobiotic metabolizing enzymes (XMEs), constitute such an important class of enzymes whose metabolic activity changes with their certain polymorphic variations (4). The cytochrome P450 (CYP) superfamily is a diverse group of enzymes, which act on substances from environment or drugs. Huge body of evidence is available for the relationship between cancer susceptibility and single-nucleotide polymorphisms in CYP genes. The CYP2 family members including CYP2C19 and CYP2D6 exhibit highest activity toward diet and tobacco-specific N-nitrosamines like N-nitrosonornicotene (N-NNN) and polyaromatic hydrocarbons (PAHs) (5) in other organisms as well as in humans (6,7). Both PAHs and nitrosamines have been consistently associated with the development of different malignancies, including ESCC (8). Due to very aggressive nature and poor survival rate, ESCC is currently the sixth most common death causing malignancy in the world (9). In Kashmiri population, ESCC is the leading malignancy in both men and women (10), and several possible factors including dietary habits (11), tobacco smoking and snuff (nass) chewing (12), and salt tea intake (13) are associated with its high risk. Furthermore, because of the above mentioned risk factors the population is exposed to a range of toxic chemicals like Nnitrosamines and PAHs (14). However, the various genetic contributors like XMEs studied in other populations are not studied well in this part of the high ESCC risk region. CONTACT Nazir Ahmad Dar [email protected] Department of Biochemistry, University of Kashmir, Hazratbal, Srinagar, J&K 190006, India. Color versions of one or more of the figures in the article can be found online at www.tandfonline.com/hnuc. Supplemental data for this article can be accessed on the publisher’s website. © 2017 Taylor & Francis Group, LLC G. A. BHAT ET AL. 2 Therefore, we conducted this study to explore the possible relationships between polymorphisms of CYP2C19 and CYP2D6 genes, and ESCC in Kashmir. Materials and Methods Subject Recruitment and Data Collection The hospital-based case-control study was carried out in Kashmir from February 2010 to December 2012. A total of 492 histopathologically confirmed ESCC cases and equal number of controls were recruited for the study. The ESCC cases were recruited in the Department of Radiation Oncology, Sheri-Kashmir Institute of Medical Sciences (SKIMS), Srinagar. All the cases were more than 18 years old, having no prior history of any malignancy. For each case, we recruited one control individually matched to the case for age (§5 years), sex, and place of residence. The various reasons of hospitalization and the details of wards in which controls were recruited are provided elsewhere (12). The controls were recruited within six months after their respective cases were recruited. The participation rate for both cases and controls were high (96% for cases and 98% for controls). A limited number of trained researchers conducted the interviews, and no proxies were used. Informed consent was obtained from all subjects, and the study was reviewed and approved by Institutional Ethics Committee of SKIMS. Data Collection Detailed information on age, sex, place of residence, ethnicity, religion, education, dietary data including intake of fresh fruits and vegetables, and other potential confounding factors of interest was collected using a questionnaire specifically designed for this population. For several tobacco products, information on lifelong history of use, with starting and stopping ages and daily amount of use, was obtained. Ever use of traditional, hookah, nass, and cigarette, was defined as the use of the respective product at least weekly for a period of 6 months or more. Information on ever alcohol use was also collected. Information on family history of cancer (FHC) was obtained from all the subjects. To assess the socioeconomic status (SES) of the subjects, information on potential parameters of SES was obtained including education level (highest level attained), monthly income (in INR), house type, cooking fuel, and ownership of several household appliances. Genetic Analysis Five milliliters of venous blood was collected from each subject in sterilized plastic vials containing EDTA (0.5 M; pH D 8.0) and stored at ¡80 C before DNA extraction. Genomic DNA was extracted from blood samples by using the phenol chloroform method (15). The extracted DNA was quantified and stored at 4 C until used for further analysis. Genotyping PCR was carried on Gradient (Biometra) and Eppendorf thermo cyclers. Amplification of these gene products was performed in a total volume of 25-ml reaction mixture containing 1X reaction buffer (50 mM KCL), 1.5 mM of MgCl2, 20 pmol of each primer, 200 mM of each dNTPs and 1 unit of DNA Taq polymerase (Fermentas, MBI, Vilnius, Lithuania). PCR conditions required to amplify specific fragment for each gene mutation are described elsewhere (16). PCR products were digested with a specific restriction endonucleases (Fermentas, MBI, Vilnius, Lithuania). The details of PCR conditions, primers, restriction enzyme, and length of expected fragments on digestion, mutant alleles, and change in nucleotide position of the studied genes are given in Table 1. 10% of the samples for each gene were randomly picked for sequencing to validate PCR-RFLP results. For Table 1. Primers, PCR conditions, restriction enzymes, and restriction digestion fragments of the studied genes. Gene CYP2C19 CYP2D6 Primers PCR conditions 0 0 FP5 - AATTACAACCAGAGCTTGGC-3 RP50 - TATCACTTTCCATAAAAGCAAG-30 0 0 FP5 -GCCTTCGCCAACCACTCCG ¡3 RP50 - AAATCCTGCTCTTCCGAGGC ¡30 94 C 60 s 61.7 C 30 s 72 C 30 s 32cycles 95 C 40 s 60.5 C 30 s 72 C 30 s 35cycles   ] ] RE MspI BstNI DP(bp) AP D 169 W D 118, 51 H D 169,118,51 M D 169 AP D 334 W D 233, 101 H D 334,233,101 M D 334 N.C. R. No G>A at 681 [Hyun-Ju Kim 2007] G>A at 1934 [Maja Krajinovic 1999] FP D forward primer, RP D reverse primer, AP D amplified product, RE D restriction enzyme, DP D digestion products, W D homozygous wild genotype, H D heterozygous genotype, M D homozygous mutant genotype, N.C. D nucleotide change, R. No D reference number. NUTRITION AND CANCER Table 2. Characteristics of esophageal squamous cell carcinoma cases and controls. a Characteristics Cases na (%) Controls na (%) Total Age (Years mean § S.D.) Fruit and vegetables (median g/day IQR) Ethnicity Kashmiri Other Gender Male Female Place of residence Urban Rural Education No formal school Primary (less than 5th) Middle (5th–8th) High school (9th–12th) College or above Religion Muslim Sikh Wealth score Quintile 1 (lowest) Quintile 2 Quintile 3 Quintile 4 Quintile 5 Tobacco smoking Never Ever Secondhand smoking Yes No Nass Never Ever Alcohol consumption Never Ever Family history of cancer (FHC) FHCC FHC¡ Tea consumption Sweet or Lipton tea Salted tea Salted tea temperature Warm Hot Brush frequency Don’t brush Once a week Twice or thrice a week Daily at least once Animal contact No contact Yes contact Allele type CYP2C19  1  2 CYP2D6 G A 492 (100) 492 (100) 60.2 § 11.25 61.57 § 11.17 1.8 (1.16) 3.2 (1.16) P value <0.001 <0.001 0.199 476 (96.7) 16 (3.3) 484 (98.4) 08 (1.6) 287 (58.3) 205 (41.7) 287 (58.3) 205 (41.7) 19 (3.9) 473 (96.1) 42 (8.5) 450 (91.5) 433 (88.0) 23 (4.7) 19 (3.9) 14 (2.8) 03 (0.6) 315 (64.0) 60 (12.2) 30 (6.1) 51 (10.4) 36(7.3) 487 (98.9) 05 (1.1) 489 (99.4) 03 (0.61) 281 (57.1) 77 (15.6) 42 (8.5) 51 (10.5) 41 (8.3) 96 (19.5) 94 (19.1) 101 (20.5) 96 (19.5) 105 (21.3) 164 (33.3) 328 (66.7) 249 (50.6) 243 (49.4) 110 (65.1) 59 (34.9) 160 (70.5) 67 (29.5) 354 (72.1) 137 (27.9) 429 (87.2) 59 (12.8) 486 (98.8) 06 (1.2) <0.001 173 (35.2) 319 (64.8) 492 (1.0) 0 (0.00) 09 (1.8) 483 (98.2) 21 (4.3) 471 (95.7) 179 (37.1) 304 (62.9) 231 (48.4) 246 (51.6) 111 (22.6) 256 (52.8) 61 (12.5) 64 (13.1) 36 (7.5) 217 (45.1) 105 (21.8) 123 (25.6) 3 sequencing, unpurified PCR products were sent to SciGenom Private Limited, Cochin, Kerala, India. The sequencing chromatograms were then compared with the original gene sequences for the expected results. Sequence scanner software (FinchTV Geospiza 1.4.0) was used for comparing the original gene sequence and the resulting chromatogram sequences. Statistical Analysis 0.001 <0.001 1.000 <0.001 <0.001 0.028 <0.001 1.00 38 (7.7) 454 (92.3) 0.033 0.001 Numbers and percentages by case status were calculated and presented for categorical variables. Conditional logistic regression models were used to calculate unadjusted and adjusted odds ratios (ORs) and 95% confidence intervals [95% confidence intervals (CIs)]. Confounders were selected based on the previous knowledge on ESCC etiology and our results of preliminary analysis (12). The adjusted risk estimates were obtained from multivariate models in which age, ethnicity, religion, place of residence (rural/urban), education level, animal contact, socioeconomic status, oral hygiene, FHC, tobacco smoking (including hookah, cigarette and bidi) nass, alcohol consumption, daily fruit and fresh vegetable intake, and hot beverages were included. Age was included in the multivariate models, because the age matching was not perfect (§5 years). Fruit and vegetable intake data (g/day) were transformed to logarithmic values following addition of 0.1 to original values. For genotype analysis, the studied genes were categorized into homozygous wild, heterozygous, homozygous mutant, and a variant group (the variant group is the combination of heterozygous and homozygous mutant). Conditional logistic regression models were used to assess gene-gene and gene-environment interactions. Two-sided P values <0.05 were considered as statistically significant. All statistical analyses were done by using Stata software, version 12 (STATA Corp., College Station, TX, USA). <0.001 Results <0.001 64 (13.0) 428 (87.0) 141 (28.7) 351 (71.3) 564 (57.3) 420 (42.7) 685 (69.6) 299 (30.4) 848 (86.2) 136 (13.8) 900 (91.5) 84 (8.5) P < 0.0001 P D 0.0002 D Cases and controls were individually matched; however, variation in number or in percentages may not be always equal because of some missing numbers.  1 and 2 D wild and mutant alleles of CYP2C19 gene. G and A D wild and mutant allele of CYP2D6 gene.  P-values were calculated using chi-square tests for categorical variables. In this study, 492 ESCC cases and equal number of matched controls were recruited. These included 287 men and 205 women in the ratio of 1.4:1. The general characteristics of cases and controls are presented in Table 2. The mean age (standard deviation) of cases and controls were 60.19 (§11.25) and 61.57 (§11.17) years, respectively. Maximum representation of cases were with low or no formal education and low socioeconomic status (P D <0.001). Tobacco smoking and snuff (nass) consumption was significantly higher in cases than in controls (P D <0.001). As compared to cases, controls had lower frequency of contact with animals, passive smoke exposure and positive FHC (P <0.05) whereas 4 G. A. BHAT ET AL. Figure 1. Chromatogram of CYP2C19 genotype showing G>A transition. controls were cleaning their teeth more frequently and were consuming fresh fruit and vegetable more often than cases (P <0.05). Salted tea, one of the most common lifestyle habits in Kashmiri population, is almost equally distributed among both subjects. Allelic Frequencies and Genotype Analysis The distribution of allelic and genotypic frequencies was compared in subjects, in order to find out a possible association of genetic alterations with the elevated risk of developing ESCC. The difference in major and minor allele distribution between cases and controls among CYP2C19 and CYP2D6 genes was statistically significant (P < 0.05), and the genotype frequencies were in agreement with HardyWeinberg Equilibrium (Table 2). PCR-RFLP results of CYP2C19 gene and its sequencing chromatograms are shown in Supplementary Fig. 1 and Fig. 1, respectively. Analysis of CYP2C19 and CYP2D6 genotypes individually as well as in combination with different environmental risk factors is presented in Table 3. The variant CYP2C19 genotype was significantly associated with increased ESCC risk (OR D 3.3; 95% CI D 1.9–5.6). When the analysis was restricted to some of the established environmental ESCC risk factors, a further increase in ESCC was observed in subjects harboring a variant genotype of CYP2C19. Subjects who carried a variant genotype and are ever tobacco smokers (OR D 4.4; 95%CI D 2.4–8.1) and had a positive history of any malignancy among their family members had very strong ESCC risk (OR D 15.5; 95% CI D 7.4–32.3). Female subjects carrying variant genotype showed slightly stronger ESCC risk (OR D 4.5; 95% CI D 1.8– 11.4) as compared to male subjects (OR D 2.8; 95% CI D 1.4–5.7). No significant changes in ESCC risk were observed in subjects who were using biomass as fuel and lived in poor-ventilated adobe houses in the presence of any of the genotypic combinations. However, subjects carrying a homozygous mutant genotype of CYP2C19 and are salted tea drinkers had higher ESCC risk (OR D 3.5; 95% CI D 1.5–8.5). PCR-RFLP results of CYP2D6 gene polymorphisms are presented in Supplementary Fig. 2, while Fig. 2 shows the sequencing chromatogram of CYP2D6 mutant genotype. The enhanced risk (OR D 2.1; 95% CI D 1.1–4.2) among subjects harboring variant genotype of CYP2D6 got synergistically amplified when they were active tobacco smokers as well (OR D 4.7; 95% CI D 2.4–9.2, Pinteraction D 0.013). Subjects with combination of FHC and variant (OR D 9.7; 95% CI D 3.6–25.9) or wild (OR D 5.5; 95% CI D 3.1–9.9) genotype of CYP2D6 presented a strong ESCC risk. Subjects with CYP2D6 variant genotype and are using biomass as fuel showed an increased ESCC risk (OR D 4.6; 95% CI D 1.5–14.1), and an enhanced ESCC risk was retained only by male subjects harboring a CYP2D6 variant genotype (OR D 5.3; 95% CI D 1.9– 14.3). Subjects carrying a heterozygous genotype of CYP2D6 and are salt tea drinkers are also at added risk (OR D 2.7; 95% CI D 1.2–5.9). There was an enhanced ESCC risk when an individual carried a combination of both variant genotypes (OR D 4.6; 95% CI D 2.0–10.8) (Table 4); however, the interaction results among the studied genotypes were insignificant (Pinteraction D 0.903) (data not shown). Gene-environmental Interaction Results Figure 2. Chromatogram of CYP2D6 genotype showing G>A transition. GEI results are presented in Table 5. The CYP2D6 gene was synergistically associated with tobacco smoking in enhancing the risk of ESCC (OR D 0.6; 95% CI D 0.4– 0.9; P D 0.013); however, the combined increase in ESCC risk among ever tobacco smokers harboring the CYP2C19 gene did not reveal any statistically significant interaction. Although most of the environmental exposures showed a strong combined risk in the presence of variant genotypes of both the genes, the interaction results were statistically insignificant (P > 0.05). NUTRITION AND CANCER 5 Table 3. OR and 95% CI of CYP2C19 and CYP2D6 genotypes in ESCC cases and controls stratified by smoking, family history, salted tea, fuel use, house type, and gender. CYP2C19 Genotypes/variable CYP2D6 1 Cases N(%) Controls N(%) UA OR (95% CI) Total 492(100) Wild 160 (32.5) Heterozygous 244 (49.6) Mutant 88 (17.9) 332 (67.5) (Variant)3 Tobacco smoking ¡ 49 (9.9) Wild C smoker 111 (22.6) Wild C smokerC Variant C smoker¡ 115 (23.4) 217 (44.1) Variant C smokerC Consumption of salt tea Wild C salt tea 159 (32.9) Heterozygous C salt tea 239 (49.5) Mutant C salt tea 85 (17.6) Family history of cancer (FHC) ¡ 104 (21.1) Wild C FHC 56 (11.4) Wild C FHCC 215 (43.7) Variant C FHC¡ C Variant C FHC 117 (23.8) Fuel Variant C other 02 (0.6) Wild C Biomass 325 (99.4) House type Variant C concrete 49 (18.8) Wild C Adobe 212 (81.2) Gender Wild C male 94 (32.7) Variant C male 193 (67.2) Wild C female 66 (32.2) Variant C female 139 (67.5) Meat consumption Wild C MN 28 (20.0) Variant C DW 111 (80.0) 2 A OR (95% CI) Cases N(%) Controls N(%) UA OR1 (95% CI) A OR2 (95% CI) 492(100) 256 (52.0) 173 (35.2) 63 (12.8) 236 (48.0) — Referent 2.3 (1.7–3.0) 2.3 (1.6–3.5) 2.3 (1.7–2.9) — Referent 2.9 (1.6–5.1) 3.1 (1. 9–8.5) 3.3 (1.9–5.6) 492(100) 369 (75.00) 110 (22.4) 13 (2.6) 123 (25.0) 492(100) 417 (84.8) 66 (13.4) 09 (1.8) 75 (15.2) Referent 1.9 (1.4–2.6) 1.8 (0.7–4.4) 1.8 (1.3–2.6) Referent 2.2 (1.1–4.2) 3.8 (0.4–37.0) 2.1 (1.1–4.0) 131 (26.6) 125 (25.4) 118 (24.0) 118 (24.0) Referent 2.9 (1.9–4.7) 2.8 (1.7–4.4) 5.7 (3.6–8.9) Referent 1.8 (0.9–3.4) 2.4 (1.3–4.4) 4.4 (2.4–8.1) 136 (27.6) 233 (47.4) 28 (5.7) 95 (19.3) 209 (42.5) 208 (42.3) 40 (8.1) 35 (7.1) Referent 2.0 (1.4–2.7) 0.9 (0.5–1.6) 4.9 (3.00–7.9) Referent 1.5 (0.9–2.3) 0.9 (0.4–2.0) 4.7 (2.4–9.2) 245 (52.0) 164 (34.8) 62 (13.2) Referent 2.3 (1.7–3.0) 2.1 (1.4–3.1) Referent 3.2 (1.6–6.3) 3.5 (1.5–8.5) 362 (74.9) 108 (22.4) 13 (2.7) 401 (85.1) 61 (13.0) 9 (1.9) Referent 2.1 (1.5–3.0) 1.9 (0.7–5.1) Referent 2.7 (1.22–5.9) 4.7 (0.4–50.9) 232 (47.1) 24 (4.9) 222 (45.1) 14 (2.9) Referent 4.5 (2.6–7.9) 2.1 (1.5 – 2.9) 14.9 (8.0–27.6) Referent 3.7 (1.8–7.4) 2.1 (1.4–3.2) 15.5 (7.4–32.3) 251 (51.1) 118 (24.0) 68 (13.3) 55 (11.2) 386 (78.5) 31 (6.3) 68 (13.8) 07 (1.4) Referent 5.6 (3.5–8.8) 1.7 (1.1–2.6) 9.7 (4.3–21.8) Referent 5.5 (3.1–9.9) 2.0 (1.2–3.4) 9.7 (3.6–25.9) 47 (18.8) 203 (81.2) Referent 0 Referent 0 20 (5.5) 120 (94.5) 66 (51.6) 349 (80.1) Referent 3.5 (2.0–5.9) Referent 4.6 (1.5–14.1) 189 (74.4) 65 (25.6) Referent 15.4 (6.2–38.0) Referent 20 (5.5) 32.4 (5.4 ¡195.2) 120 (94.5) 66 (51.6) 349 (80.1) Referent 3.5 (2.03–5.9) Referent 4.6 (1.5–14.1) 150 (52.0) 138 (47.9) 106 (52.1) 98 (48.0) Referent 2.2 (1.5–3.1) Referent 2.4 (1.6–3.7) Referent 2.9 (1.4–5.7) Referent 4.5 (1.8–11.4) 209 (72.8) 78 (27.2) 160 (78.1) 45 (21.9) 245 (85.2) 43 (14.9) 172 (84.3) 32 (15.7) Referent 2.3 (1.5–3.6) Referent 1.4 (0.9–2.4) Referent 5.3 (2.0–14.3) Referent 0.8 (0.3–2.4) 30 (15.2) 167 (84.8) Referent 07 (0.3–1.8) Referent 0.35 (0.1–2.1) 05 (2.0) 196 (98.0) 05 (1.9) 257 (98.1) Referent 1.0 (0.1–16.0) Referent — Abbreviations: OR D odds ratio; CI D confidence interval; FHC D family history of any cancer; MN D monthly or never; DW D daily or weekly. 1 UA OR D Unadjusted odds ratio; 2A OR D adjusted odds ratio; 3 variant indicates combined genotype, which has at least one variant allele. ORs (95% CIs) were obtained from conditional logistic regression models. Numbers may not add up to the total numbers due to missing data in some variables. 2 Adjusted for age, ethnicity, gender, place of residence, religion, education level, wealth score, animal contact, oral hygiene, log of fruits and vegetables, tobacco smoking (in form of hookah, cigarette or bidi), nass consumption, alcohol drinking, and family history of any cancer and salted tea. The variable under consideration was not additionally adjusted for it. Discussion We found that CYP2C19 and CYP2D6 gene polymorphisms are associated with ESCC risk. We observed an increased risk in tobacco smokers, in adobe house dwellers, and in subjects who used biomass as fuel, consumed salt tea, and had a positive FHC while harboring the variant genotype of either CYP2C19 or CYP2D6. We also observed an enhanced ESCC risk among male subjects carrying the variant genotype of CYP2D6 gene. The strong association of variant genotype of CYP2C19 on ESCC risk is due to the formation of a truncated protein by a single base pair mutation at 681G>A (17). The trimmed protein formation due to such mutation in turn lowered enzyme expression in the target tissue and reduced metabolism of preformed or activated carcinogens, hence the enhanced cancer risk of variant genotypes of CYP2C19 (18). An elevated risk to ESCC in variant genotypes harboring subjects and tobacco smokers suggests some possible biological interactions of CYP2C19 with tobacco smoking constituents, and this mechanism could be attributed to their poor ability to detoxify the carcinogens generated from tobacco smoke (19). Several studies on CYP2C19 polymorphism and its association with carcinogenesis have shown self-contradictory results. Recently, several studies related to CYP2C19 polymorphism and cancer susceptibility have reported that poor metabolizers or variant genotypes are associated with different malignancies particularly gastrointestinal tract cancers (20), including a synergistic interaction with environmental risk factors like alcohol consumption in modifying the susceptibility to squamous cell carcinoma of head and neck and ESCC (21,22). However, a few earlier studies reported the null associations of CYP2C19 poor metabolizers with certain malignancies (18). There was more susceptibility toward ESCC development among carriers of CYP2D6 variant genotype than homozygous wild genotype carriers in our study. 6 G. A. BHAT ET AL. Table 4. Genotypic combination results. 1 2 Combination Cases N(%) Controls N(%) UA OR1 (95% CI) A OR2 (95% CI) CYP2C19Wild C CYP2D6 wild CYP2C19Wild C CYP2D6variant CYP2C19variant C CYP2D6wild CYP2C19variant C CYP2D6variant 123 (26.3) 37 (7.9) 246 (52.6) 62 (13.3) 218 (44.9) 38 (7.8) 199 (40.9) 31 (6.4) Referent 1.7 (0.9–2.9) 2.3 (1.7–3.1) 3.5 (2.1–5.8) Referent 1.7 (0.7–4.0) 2.4 (1.4–4.0) 4.6 (2.0–10.8) UA ORD Unadjusted odds ratio. A ORD Adjusted odds ratio. The splice mutation at 1934 G to A analyzed in this study results in the loss of enzyme activity as compared to its wild-type allele (G) (23). The reduced metabolic activity toward its substrates leads to increased production of metabolites depending on the type of substrate. This metabolite production could lead to the formation of different adducts including DNA adducts in substrate-specific tissues, hence toxicity to different tissues. However, there are many reports with inconsistent results, which did not confirm any association between variant genotype of CYP2D6 and a cancer risk (24). A significant association of tobacco smoking with lung cancer in subjects carrying a CYP2D6 variant (G/ ACA/A) genotype could be due to reduced metabolism of carcinogenic compounds from tobacco smoke (25), to which our population is significantly exposed in the form of hookah smoking or due to secondhand smoke exposure from poor-ventilated adobe houses or biomass fuels (12,26). These observations are in agreement with some of the earlier but, nonesophageal malignancy studies, in which reduced tobacco- and nitrosaminespecific DNA adducts were reported in CYP2D6 variant genotype carrying subjects (27). While as other studies could not replicate these results and showed overall no influence on PAH metabolism in the presence of different genotypes of the CYP2D6 gene (28). It is pertinent to mention that till date, no study is available on the association of any of the CYP2D6 gene variants in alone, in combination with other genotypes, or with important lifestyle risk determinants toward ESCC risk. Table 5. Gene-environment interaction results. 1 Genotype/Exposure SE1 P value2 OR3 95% CI4 CYP2C19 C tobacco smoking CYP2D6 C tobacco smoking CYP2C19 C family history CYP2D6Cfamily history CYP2C19 C salted tea CYP2D6 C salted tea CYP2C19 C fuel CYP2D6 C fuel 0.17 0.12 0.17 0.28 0.72 0.80 0.34 0.25 0.332 0.013 0.266 0.831 0.677 0.423 0.258 0.842 1.2 0.6 0.8 1.1 0.8 1.5 1.3 0.9 0.8–1.5 0.4–0.9 0.5–1.2 0.6–1.8 0.3–2.1 0.6–3.8 0.8–2.2 0.6–1.6 SE D Standard error. Pvalue D Statistically significant results are in bold (P  0.05). OR D Odds ratio. 4 CI D Confidence interval. 2 3 A possible explanation of higher risk among adobe houses dwellers and subjects using biomass as fuel (29) can be related to elevated exposures. Previous studies had significantly associated passive tobacco smoking and also female exposure to kitchen smoke and fumes with cancer risk (30). In agreement with our results, earlier studies have reported that tobacco smoking, biomass fuels, as well as fumes generated during cooking have been associated with ESCC progression (31). An increased association of CYP2C19 and CYP2D6 variant genotype with ever history of any malignancy among relatives in our study suggests a genetic instability in certain chromosomes of tumor susceptibility genes or hints at high-density single-nucleotide polymorphism arrays, which allow identification of “identity-by-descent” segments in genomic DNAs as representative of shared common ancestral regions that could run in families (32). Although FHC itself is having a strong association with ESCC in our study. Some recent studies were consistent with these findings, as certain polymorphic alleles in combination with family history of upper gastrointestinal tract cancer were significantly associated with esophageal cancer risk (33). One of the interesting observations of our study was the occurrence of CYP2D6 variants more common among men as compared to women. The biological mechanism for such association is still not known but, one plausible explanation could be because of the more tobacco smoking prevalence among men as compared to women, although significant exposure to indoor smoking more in women cannot be ignored and hence a possible reason for higher risk in female subjects in our study in presence of CYP2C19 variant genotypes. The combination of above smoking exposures in both genders in combination with susceptible gene variants puts them at higher risk toward ESCC. In the presence of variant genotypes of CYP2C19 and CYP2D6, subjects who are consuming salt tea are at increased ESCC risk. Due to the consumption of salt tea, our population is exposed to range of N-nitrosamines (14), which in the absence of proper metabolizers in the form of XMEs like CYP2C19 and CYP2D6 puts a person more vulnerable to the development of ESCC. Till date, NUTRITION AND CANCER no reports are available about the role of above genotypes in modifying the risk of ESCC in the presence of salt tea. The major strengths of this study is adjustments of the results for multiple probable confounding factors. Similar to other hospital-based case-controls studies with retrospective exposure assessments, recall and selection bias can be weak points of this study, although same setting of cases and controls reduce this bias to some extent. Conclusion The study suggests that gene variants of CYP2C19 and CYP2D6 modify the risk of ESCC, and these genotypes in combination with exogenous risk factors provide a modifying effect on an individual toward ESCC development. Acknowledgments The authors are grateful to all the subjects who participated in this study. Declaration of Interest The authors declare that they have no conflicts of interest. Funding This study was financially supported in part by a research grant from Indian Council of Medical Research (ICMR), New Delhi, under the IRIS ID 5/13/37/2007/-NCD-III. References 1. Kamangar F, Chow WH, Abnet CC, and Dawsey SM: Environmental causes of esophageal cancer. Gastroenterol Clin North Am 38(1), 27–57, vii, 2009. 2. Louwman WJ, Aarts MJ, Houterman S, van Lenthe FJ, Coebergh JWW, et al.: A 50% higher prevalence of lifeshortening chronic conditions among cancer patients with low socioeconomic status. Br J Cancer 103(11), 1742– 1748, 2010. 3. Thrift AP, Nagle CM, Fahey PP, Russell AA, Smithers BM, et al.: The influence of prediagnostic demographic and lifestyle factors on esophageal squamous cell carcinoma survival. Int J Cancer 131(5), E759–E768, 2012. 4. Luo YP, Chen H, Khan MA, Chen F, Wan X, et al.: Genetic polymorphisms of metabolic enzymes-CYP1A1, CYP2D6, GSTM1, and GSTT1, and gastric carcinoma susceptibility. Tumour Biol 32(1), 215–222, 2011. 5. Crespi CL, Penman BW, Gelboin HV, and Gonzalez FJ: A tobacco smoke-derived nitrosamine, 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone, is activated by multiple human cytochrome P450s including the polymorphic human cytochrome P4502D6. Carcinogenesis 7, 1197– 1201, 1991. 7 6. Mirvish SS: Role of N-nitroso compounds (NOC) and Nnitrosation in etiology of gastric, esophageal, nasopharyngeal and bladder cancer and contribution to cancer of known exposures to NOC. Cancer Lett 93(1), 17–48, 1995. 7. Smith TJ, Liao A, Wang L-D, Yang G-Y, Starcic S, et al.: Characterization of xenobiotic-metabolizing enzymes and nitrosamine metabolism in the human esophagus. Carcinogenesis 19, 667–672, 1998. 8. Abedi-Ardekani B, Kamangar F, Hewitt SM, Hainaut P, Sotoudeh M, et al.: Polycyclic aromatic hydrocarbon exposure in oesophageal tissue and risk of oesophageal squamous cell carcinoma in north-eastern Iran. Gut 59(9), 1178–1183, 2010. 9. Mao WM, Zheng WH, and Ling ZQ: Epidemiologic risk factors for esophageal cancer development. Asian Pac J Cancer Prev 12(10), 2461–2466, 2011. 10. Rasool MT, Lone MM, Wani ML, Afroz F, Zaffar S, et al.: Cancer in Kashmir, India: burden and pattern of disease. J Cancer Res Ther 8(2), 243–246, 2012. 11. Khuroo MS, Zargar SA, Mahajan R, and Banday MA: High incidence of oesophageal and gastric cancer in Kashmir in a population with special personal and dietary habits. Gut 33(1), 11–15, 1992. 12. Dar NA, Bhat GA, Shah IA, Iqbal B, Kakhdoomi MA, et al.: Hookah smoking, nass chewing, and oesophageal squamous cell carcinoma in Kashmir, India. Br J Cancer 107(9), 1618–1623, 2012. 13. Dar NA, Bhat GA, Shah IA, Iqbal B, Rafiq R, et al.: Salt tea consumption and esophageal cancer: A possible role of alkaline beverages in esophageal carcinogenesis. Int J Cancer 2014. 14. Siddiqi MA, Tricker AR, Kumar R, Fazili Z, and Preussmann R: Dietary sources of N-nitrosamines in a high-risk area for oesophageal cancer–Kashmir, India. IARC Sci Publ 105, 210–213, 1991. 15. Sambrook J, and Russell D: Molecular cloning: a laboratory manual. 2001. 16. Bhat GA, Shah IA, Makhdoomi MA, Iqbal B, Rafiq R, et al.: CYP1A1 and CYP2E1 genotypes and risk of esophageal squamous cell carcinoma in a high-incidence region, Kashmir. Tumour Biol 2014. 17. De Morais SM, Wilkinson GR, Blaisdell J, Meyer UA, Nakamura K, et al.: Identification of a new genetic defect responsible for the polymorphism of (S)-mephenytoin metabolism in Japanese. Mol Pharmacol 46(4), 594–598, 1994. 18. Shi WX, and Chen SQ: Frequencies of poor metabolizers of cytochrome P450 2C19 in esophagus cancer, stomach cancer, lung cancer and bladder cancer in Chinese population. World J Gastroenterol 10(13), 1961–1963, 2004. 19. Sugimoto M, Furuta F, Shirai N, Nakamura A, Kajimura M, et al.: Poor metabolizer genotype status of CYP2C19 is a risk factor for developing gastric cancer in Japanese patients with Helicobacter pylori infection. Aliment Pharmacol Ther 22(10), 1033–1040, 2005. 20. Isomura Y, Yamaji Y, Ohta M, Seto M, Asaoka Y, et al.: A genetic polymorphism of CYP2C19 is associated with susceptibility to biliary tract cancer. J Gastroenterol Hepatol 45, 1045–1052, 2010. 21. Shi Y, Luo G, Zhang L, Shi J, Zhang D, et al.: Interaction between alcohol consumption and CYP 2C19 gene polymorphism in relation to oesophageal squamous cell carcinoma. PLoS One 7(9), e43412, 2012. 8 G. A. BHAT ET AL. 22. Yadav SSR, Ruwali M, Pant MC, Shukla P, Singh RL, and Parmar D: Interaction of drug metabolizing cytochrome P450 2D6 poor metabolizers with cytochrome P450 2C9 and 2C19 genotypes modify the susceptibility to head and neck cancer and treatment response. Mutat Res 684, 49–55, 2010. 23. Gaikovitch EA, Cascorbi I, Mrozikiewicz PM, Brockm€oller J, Fr€ otschl R, et al.: Polymorphisms of drug-metabolizing enzymes CYP2C9, CYP2C19, CYP2D6, CYP1A1, NAT2 and of P-glycoprotein in a Russian population. Eur J Clin Pharmacol 59(4), 303–312, 2003. 24. Topic E, Stefanovic M, Ivanisevic AM, Petrinovic R, and  cic I: The cytochrome P450 2D6 (CYP2D6) gene polyCur morphism among breast and head and neck cancer patients. Clin Chim Acta 296(1–2), 101–109, 2000. 25. Hirvonen A, Husgafvel-Pursiainen K, Anttila S, Karjalainen A, Pelkonen O, et al.: PCR-based CYP2D6 genotyping for Finnish lung cancer patients. Pharmacogenetics 3(1), 19–27, 1993. 26. Dar NA, Shah IA, Bhat GA, Makhdoomi MA, Iqbal B, et al.: Socioeconomic status and esophageal squamous cell carcinoma risk in Kashmir, India. Cancer Sci 104(9), 1231–1236, 2013. 27. Laforest L, Wikman H, Benhamou S, Saarikoski ST, Bouchardy C, et al.: CYP2D6 gene polymorphism in caucasian 28. 29. 30. 31. 32. 33. smokers: lung cancer susceptibility and phenotype-genotype relationships. Eur J Cancer 36(14), 1825–1832, 2000. Caporaso NE, Lerman C, Audrain J, Boyd NR, Main D, et al.: Nicotine metabolism and CYP2D6 phenotype in smokers. Cancer Epidemiol Biomarkers Prev 10(3), 261– 263, 2001. Zhang J, and Smith KR: Indoor air pollution: a global health concern. Br Med Bull 68, 209–225, 2003. Tung Y.H., et al.: Cooking oil fume-induced cytokine expression and oxidative stress in human lung epithelial cells. Environ Res 87(1), 47–54, 2001. Wornat MJ, Ledesma LB, and Sandrowitz AK: Polycyclic aromatic hydrocarbons identified in soot extracts from domestic coal-burning stoves of Henan Province, China. Environ Sci Technol 35(10), 1943–1952, 2001. Ko JM, Zhang P, Law S, Fan Y, Song Y-Q: Identity-bydescent approaches identify regions of importance for genetic susceptibility to hereditary esophageal squamous cell carcinoma. Oncol Rep 32(2), 860–870, 2014. Roth MJ, Wei W-Q, Baer J, Abnet CC, Wang G-Q, et al.: Aryl hydrocarbon receptor expression is associated with a family history of upper gastrointestinal tract cancer in a high-risk population exposed to aromatic hydrocarbons. Cancer Epidemiol Biomarkers Prev 18(9), 2391–2396, 2009.