High prevalence of oncogenic HPV-16 in cervical smears of asymptomatic women of eastern Uttar Pradesh, India: A population-based study

High prevalence of oncogenic HPV-16 in cervical smears of asymptomatic women of eastern Uttar Pradesh, India: A population-based study SHIKHA SRIVASTAVA1 , SADHANA GUPTA2 and JAGAT KUMAR ROY1,* 1 Cytogenetics Laboratory, Department of Zoology, Banaras Hindu University, Varanasi 221 005, India 2 Post-Partum Out Patient Department, Sir Sunderlal Hospital, Banaras Hindu University, Varanasi 221 005, India *Corresponding author (Fax, +91-542-2368457; Email, [email protected]) In developing countries like India, occurrence of Human papillomavirus (HPV) in cervical cancer as well as in the asymptomatic population was observed to be very high. Studies on HPV prevalence have been conducted in different parts of the country but no data were available from the eastern region of Uttar Pradesh (UP). The present study aimed to determine the status of HPV prevalence and its association with different socio-demographic factors in this population. Prevalence of HPV was investigated in a total of 2424 cervical scrape samples of asymptomatic women. Primer sets from L1 consensus region of viral genome were used to detect the presence of HPV, and the positive samples were genotyped by sequencing. Univariate binary logistic regression analysis was used to evaluate association of socio-demographic factors with HPV. 9.9% of the clinically asymptomatic women were found to be infected with HPV comprising 26 different genotypes. Among HPV-positive women, 80.8% showed single infection, while 15.4% harboured multiple infections. HPV-16 (63.7%) was the most prevalent, followed by HPV-31 (6.7%), HPV-6 (5.4%), HPV-81 (4.6%) and HPV-33 (4.2%). Significant association of HPV with non-vegetarian diet (P<0.05) and rural residential areas (P<0.01) were observed. High prevalence of HPV-16 in asymptomatic women of this population, a frequency comparable to invasive cervical cancers, highlights an urgent need for a therapeutic HPV vaccine covering HPV-16 and other high-risk types to provide protection against the disease. [Srivastava S, Gupta S and Roy JK 2012 High prevalence of oncogenic HPV-16 in cervical smears of asymptomatic women of eastern Uttar Pradesh, India: A population-based study. J. Biosci. 37 63–72] DOI 10.1007/s12038-012-9181-y 1. Introduction Cervical cancer, the second most common gynaecological malignancy worldwide, has been reported to occur in abundance in different populations. According to World Health Organization (WHO 2010), in India approximately 1,34,420 women are diagnosed with the disease every year, and of them 72,825 die. The major causative factor of the disease is understood to be Human papillomavirus (HPV), a double-stranded DNA virus. More than 100 HPV types are known to occur that are categorized into three broad categories depending upon their oncogenic potential: highKeywords. risk types including HPV-16, -18, -31, -33, -35, -39, -45, -51, -52, -56, -58, -59, -68, -73 and -82; intermediate types including HPV-26, -53, -66 and low-risk types including HPV-6, -11, -40, -42, -43, -44, -54, -61, -70, -72, -81 and -CP6108 (Munoz et al. 2003). Infection with high-risk HPV types is the critical aetiological factor in the development of cervical cancer. Certain cervical intraepithelial neoplasias (CINs) with persistent HPV infection progress to invasive cervical cancer although a fraction of them regress during the course of time – 60% in case of CIN-1, 40% of CIN-2 and 33% of CIN-3 (Ostor 1993). Approximately 40% of all CINs persist and only about 1% of CIN-1, 5% of CIN-2 Asymptomatic; cervix cancer; HPV; HPV genotypes; socio-demographic factors Abbreviations used: CI, confidence interval; CIN, cervical intraepithelial neoplasia; HPV, Human papillomavirus; OR, odds ratio http://www.ias.ac.in/jbiosci Published online: 27 January 2012 J. Biosci. 37(1), March 2012, 63–72, * Indian Academy of Sciences 63 64 S Srivastava, S Gupta and JK Roy and 15% of CIN-3 advanced to invasive cancers (Ostor 1993). Since only a certain fraction of HPV-infected CINs progress to invasive cancer after a long latent period and the incidence of tumours are less frequent than the HPV infection, additional events also play crucial role in making HPV infection persistent, leading to oncogenicity. These cofactors may be genetic, immunological as well as sociodemographic, e.g., lower age of conception, high parity, use of oral contraceptives, diet, smoking, etc. It was also evidenced that women co-infected with multiple HPV-type infections comprising of one or more high-risk types were prone to persistent HPV infection and hence advancement of the disease. Although biological significance of multiple HPV-type infection is not known, it seems that they act synergistically accelerating the process of disease progression (Trottier et al. 2006). HPV-infected asymptomatic women remain at risk of developing the disease, and hence its screening is indispensable. Many studies have been performed in different populations of India to determine the prevalence of HPV and their types but no study has yet been reported on the eastern UP population. Therefore, this study was designed to determine the prevalence of HPV and its genotypes in asymptomatic women of Varanasi and adjoining areas and also to study the different risk factors involved in the persistence of the virus and progression of the disease. 2. Materials and methods 2.1 Study group After obtaining institutional ethical clearance, cervical scrape samples were collected from women visiting the Post-Partum Out Patient Department (PP-OPD) of Sir Sunderlal Hospital, Varanasi between October 2005 and December 2010 for family planning, medical termination of pregnancy or for routine gynaecological examination. Several healthcare camps were also organized in the nearby villages to collect the samples from women living in rural areas. All the women were physically examined and cervical scrape samples were collected and stored for HPV testing. The women selected were asymptomatic with no previous history of HPV infection or any cervical neoplasia and were clinically normal. Unmarried women, women in their second or third trimester of pregnancy or with past history of hysterectomy were not included in the study. Since HPV infection is a sexually transmitted disease, there were less chances of infection in unmarried women and, in the Indian scenario, it is not possible to get the correct information regarding premarital sexuality. Consent was taken from each of the participants included in the study. A questionnaire form consisting of questions related to different sociodemographic factors including age of women, marital status, parity, age of conception, diet, socio-economic status, place of residence, history of any disease or HPV infection, pre and post-menopause status and pregnancy were filled and recorded for each participant. 2.2 Sample collection and DNA extraction After pelvic examination, exfoliated cells from the ectocervix region were collected from each woman using a wooden Ayers’ spatula. For sample collection, Ayers’ spatula was inserted in the cervix using its long arm and rotated in clockwise direction. A total of 2480 women aged 17 to 80 years were examined and samples were collected in 5 mL Table 1. Oligonucleotide sequences used as primers for detection of HPV and its different types S. No. Primer sequence (5′-3′) Ann Temp Region Product size (bp) MY09/11 FP- GCM CAG GGW CAT AAY AAT GG RP- CAA CTT CAT CCA CGT TAC ACC FP- AAT GCC TGT GTT CAT TGC TG RP- TTC AAG GTC AGC CCC TAC AC FP- AAG GCC AAC TAA ATG TCA C RP- CTG CTT TTA TAC TAA CCG G FP- TGA GGT ACC ATT CGA TAT TT RP- TAG CAA AAA GCT GCT TCA CGC FP- TAA GCT CGG CAT TGG AAA TAC CCT RP- CCT TCC TCC TAT GTT GTG GAA TCG FP- AAC GCC ATG AGA GGA CAC AAG RP- ACA CAT AAA CGA ACT GTG GTG FP- CCCGAGGCAACTGACCTATA RP- GGGGCACACTATTCCAAATG FP- GAA GAG CCA AGG ACA GGT AC RP- CAA CTT CAT CCA CGT TAC ACC 50°C L1 450 38°C L1 150 50°C LCR 217 51°C L1 118 55°C E6 350 58°C E7 211 57°C E7 230 GP 5+/6+ HPV 16 HPV 18 HPV 31 HPV 33 HPV 35 β-globin J. Biosci. 37(1), March 2012 55°C 268 High prevalence of oncogenic HPV-16 in cervical smears of asymptomatic women of eastern UP pre-chilled PBS, immediately kept on ice, transported to the lab and stored at −70°C until further use. DNA was extracted from each cervical scrape sample according to the protocol previously described by Gravitt et al. (1998). Briefly, samples were vortexed properly to dislodge the cells from the spatula, centrifuged at 3000 rpm, and the pellet was resuspended in 600 μL of lysis buffer (0.3% SDS, 1xTE) and incubated with 80 μg of proteinase K at 55°C for 16 h. Then extractions were performed using phenol:chloroform:isoamyl alcohol and chloroform:isoamyl alcohol, and the DNA was precipitated with 1/10 volume of 3 M sodium acetate and Table 2. Frequency of high- and low-risk HPV types detected in 240 HPV-infected women HPV type High-risk type 16 18 31 33 35 39 45 51 56 58 59 67 68 72 73 Low-risk type 6 11 41 42 54 61 70 81 86 90 Intermediaterisk type 66 Multiple infections Not genotyped Total positive No. of women No. of women Total no. of with single with multiple HPV-infected HPV infection HPV infections women (%) 166 (69.2%) 133 6 4 6 2 1 2 1 3 3 2 1 1 1 0 26 (10.8%) 7 3 0 3 1 1 1 7 1 2 2 37 (15.4%) 20 3 12 4 5 0 2 3 1 1 2 2 0 1 2 153 (63.7) 9 (3.7) 16 (6.7) 10 (4.2) 7 (2.9) 1 (0.4) 4 (1.7) 4 (1.7) 4 (1.7) 4 (1.7) 4 (1.7) 3 (1.2) 1 (0.4) 2 (0.8) 2 (0.8) 6 2 1 3 0 0 0 4 2 1 13 (5.4) 5 (2.1) 1 (0.4) 6 (2.5) 1 (0.4) 1 (0.4) 1 (0.4) 11 (4.6) 3 (1.2) 3 (1.2) 2 4 (1.7) 10 (4.2%) 240 (9.9) 65 0.7 volume of isopropanol, dried and dissolved in TE (Tris-EDTA, pH 8.0) buffer. Samples were electrophoresed on 1% agarose gel to check the quality of the DNA. Quantification of the samples was carried out using Nanodrop spectrophotometer (Nanodrop, ND-1000). 2.3 HPV detection by PCR PCR was first performed for human β-globin gene, which serves as an internal control to check the integrity and adequacy of DNA. The primer set used for the amplification of β-globin gene was PC04 and GH20 (Vossler et al. 1995), which generate a 268 bp amplicon. Samples negative for β-globin gene were excluded from further analysis. PCR for HPV detection was carried out using MY09/11 (Baay et al. 1996) and GP5+/6+ (Evans et al. 2005) primers of L1 consensus region. 25 μL of reaction containing 50 ng DNA samples, 10 pmol of each forward and reverse primers, 4 μL of dNTP mix (containing 200 μM each of dATP, dTTP, dCTP and dGTP), and 0.3 U of Taq polymerase (Bangalore Genie) was set up in 1X PCR buffer (10 mM Tris Cl pH 8.3, 50 mM KCl, 1.5 mM MgCl2) provided along with the enzyme. Positive and negative controls were kept in each reaction along with the samples. Positive controls used were known HPV-positive DNA, and the reaction without DNA serves as negative control. DNA was amplified using thermocycler (Applied Biosystems) and the PCR products were checked on 2% agarose gel having ethidium bromide under UV transilluminator. A 450 bp amplicon was detected Figure 1. Agarose gel showing amplification of different HPV genotypes in cervical scrape samples using type-specific primers. M: pUC12-HinfI marker, S1: HPV-16 (217 bp), S2: HPV-18 (118 bp), S3: HPV-31 (350 bp), S4: HPV-33 (211 bp), S5: HPV35 (230 bp). J. Biosci. 37(1), March 2012 66 S Srivastava, S Gupta and JK Roy with MY09/MY11 and 150 bp with GP5+/6+ primer sets, respectively. Primer sequences used are given in table 1. 2.4 HPV genotyping HPV-positive PCR amplicons were excised from agarose gel and purified using Gel extraction kit (Fermentas, USA) according to the manufacturer’s protocol. The purified products were subjected to automated DNA sequencer (Applied Biosystems 3130 four capillary Genetic Analyser; ABI, USA) using Big Dye terminator v1.1 cycle sequencing kit (ABI) according to the manufacturer’s protocol. GP6+ primer was used for sequencing as it detects a 34 to 50 bp hyper-variable region upstream to GP5+ primer site. It can be used as a signature sequence for most of the HPV types except for some variants (Lee et al. 2009). Sequence alignment was done by ClustalW and NCBI BLAST algorithm. Samples showing more than 95% identities with the GenBank database were considered as matched genotypes. Samples showing multiple genotypes were differentiated by the presence of overlapping peaks. Mixed infections were verified using type-specific primers of HPV-16, -18, -31 (Vinayagamoorthy et al. 2003), -33 and -35 (Karlsen et al. 1996). Clones for HPV-31, -33 and -35 were used as positive controls during the PCR, while known HPV-positive DNA samples were used as positive control for HPV-16 and -18. 2.5 Statistical analysis Data were statistically analysed using SPSS statistical software (version 16.0). Univariate binary logistic regression analysis was performed to assess the strength of association of HPV and different demographic factors. Odds ratio at 95% confidence interval was calculated. The tests were considered significant if P-value is ≤0.05. Stepwise backward logistic regression analysis was performed to evaluate the most significantly associated factors. 3. Results A total of 2480 women participants were screened for HPV infection; however, samples of 56 women were excluded due to negative results for β-globin. From each woman complete questionnaire form along with the consent was collected. All samples were first analysed for HPV positivity by PCR using L1 consensus primer sets, and then the amplified regions were sequenced to detect the genotypes. Samples with multiple infections were further confirmed by PCR using type-specific primers. Table 2 gives a summarized picture of different HPV types detected in the analysed population and a representative picture of J. Biosci. 37(1), March 2012 PCR-amplified products is shown in figure 1. In total, 240 (9.9%) women were found to acquire HPV infection although genotyping for 10 samples was not done due to inadequate DNA amount. Twenty-six different HPV genotypes were detected including 15 high-risk, 10 low-risk and 1 intermediate-risk types. 166 (69.2%) women were infected with single high-risk HPV-type, while single low-risk and intermediate-risk types were 26 (10.8%) and 2 (0.8%), respectively. Multiple infections comprising two or three different HPV types were observed in 37 (15.4%) women. Infection with two different types of HPV was more common than with three or more types of infection (table 3). HPV-16 was observed to be the most prevalent high-risk types (63.7%) comprising both single and multiple infections followed by HPV-31 (6.7%), HPV-33 (4.2%) and HPV-18 (3.7%) in the high-risk group. In the low-risk group HPV-6 (5.4%) and HPV-81 (4.6%) were the most frequent types, followed by HPV-42 (2.5%) and HPV-11 (2.1%). Table 4 gives a closer look of the data showing presence of HPV in relation to different socio-demographic parameters. The different factors taken into consideration were age Table 3. Distribution of multiple HPV genotypes present in HPV-infected women Multiple HPV types HPV HPV HPV HPV HPV HPV HPV HPV HPV HPV HPV HPV HPV HPV HPV HPV HPV HPV HPV HPV HPV HPV HPV HPV 16/18 16/31 16/33 16/42 16/90 16/11 33/35 51/35 59/45 59/73 18/56 35/51 58/86 42/73 81/66 6/66 6/67 6/81 16/18/72 16/45/86 16/6/67 35/6/42 33/35/11 81/51/41 No. of infected women % of infected women 1 12 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 0.4 5.0 0.4 0.4 0.4 0.4 0.8 0.4 0.4 0.4 0.4 0.4 0.4 0.4 0.4 0.4 0.4 0.8 0.4 0.4 0.4 0.4 0.4 0.4 High prevalence of oncogenic HPV-16 in cervical smears of asymptomatic women of eastern UP 67 Table 4. Association of selected socio-demographic parameters with HPV-positive and HPV-negative women using univariate binary logistic regression analysis Socio-demographic factors Age (years) ≤25 26–35 36–45 ≥46 Parity 0–1 2 3 ≥4 Age at first intercourse (years) ≤ 20 >20 Place of residence Rural Urban Diet Non-veg Veg Income group Low Middle Pregnancy Yes No Menopause Pre Post a No. of casesa HPV-positive % infection Odds ratio (CI 95%) P-value 742 1298 249 109 68 126 30 15 9.2 9.7 12.0 13.7 0.68 (0.38–1.22) 0.72 (0.41–1.25) 0.88 (0.46–1.68) 1.0 (reference) 0.19 0.24 0.70 435 794 580 598 45 60 61 73 10.3 7.5 10.5 12.2 1.0 (reference) 0.67 (0.45–0.99) 0.95 (0.64 –1.41) 1.09 (0.74 –1.61) 1152 1115 127 112 11.0 10.0 1.12 (0.86–1.46) 1.0 (reference) 0.38 1086 1307 129 108 11.8 8.3 1.42 (1.08–1.85) 1.0 (reference) 0.01 1229 1158 137 102 11.1 8.8 1.31 (0.99–1.72) 1.0 (reference) 0.05 1049 1342 117 109 11.1 8.1 1.22 (0.93–1.59) 1.0 (reference) 0.15 385 2024 46 193 11.9 9.5 1.22 (0.86–1.72) 1.0 (reference) 0.26 2280 136 222 17 9.7 12.5 0.75 (0.45–1.25) 1.0 (reference) 0.27 0.05 0.79 0.66 Due to some missing data, numbers may not add up to total. of the women, diet, place of residence, income groups, parity, age at first intercourse, pre- and post-menopause status and pregnancy (Ist trimester). Univariate binary as well as backward logistic regression analysis results showed diet and place of residence as the significantly associated factors with HPV infection. Women taking non-vegetarian diet showed higher association (P≤0.05) with HPV than women taking vegetarian diet. Further, women belonging to rural population showed significant association with HPV infection (P≤0.01) in comparison to women living in urban areas. A non-significant positive association of HPV with parity was observed, indicating an increase in risk of HPV infection with the increase in number of births, while women having two pregnancies with the lowest OR value (0.67) were found to show the least association with HPV (P≤0.05). An increase in association of HPV infection was also observed with the increase in age of the women. Although not statistically significant, pregnant women (11.9%) and women belonging to lower income group (11.1%) showed high percentage of HPV infection, consequently making them a highly susceptible group. Interestingly, post-menopausal women showed greater risk of infection (12.5%) in comparison with pre-menopausal women (9.7%). Although women in their pre-menopausal status were inversely correlated to HPV infection (OR= 0.75; 95% CI 0.45–1.25), showing they were at low-risk level yet they were more susceptible to low and intermediate HPV-type infection in comparison to post-menopausal women (figure 2A). The frequency of HPV-16 also shows an increasing trend with age, with lower infection in women less than 25 years of age and increases with age, hence showing positive correlation (figure 2B). J. Biosci. 37(1), March 2012 68 S Srivastava, S Gupta and JK Roy (A) 90 80 70 60 50 pre M 40 post M 30 20 10 0 High Multiple Low Intermediate HPV types (B) % of HPV infected women 120 100 80 High risk 60 HPV 16 Low risk 40 20 0 <25 26-35 36-45 >46 Age (years) < _ 25 26_35 36_45 > _ 46 Total HPV +ve 68 126 30 15 No. of high-risk HPV 53 105 26 15 No. of low-risk HPV 17 22 3 0 No. of HPV16 (%) 42 72 24 14 Age (years) Figure 2. (A) Prevalence of high- and low-risk HPV types among pre- and post-menopausal women. (B) Frequency of occurrence of high-risk HPV types, HPV-16 and low-risk HPV types with increase in age. Not much difference in the frequency of high and lowrisk HPV-type infection in different socio-demographic factors was observed. But, with increase in age, an increase in the frequency of oncogenic (high-risk) HPV-type infection was observed, while the opposite is true for nononcogenic (low-risk) HPV types (figure 2B). J. Biosci. 37(1), March 2012 The present study shows that the risk of HPV infection increases significantly with residence in rural areas and non-vegetarian diet, while other factors like increase in age, parity, low income group and pregnancy might have some influence although no association was observed with young age and the age at first sexual intercourse. High prevalence of oncogenic HPV-16 in cervical smears of asymptomatic women of eastern UP 4. Discussion In India, cervical cancer ranks first among all the female malignancies, and as observed, it is mainly associated with HPV infection. So HPV screening is one of the best ways to check if a woman is at the risk of developing cervical cancer. We have studied the overall HPV incidence in Varanasi and its adjoining areas along with detecting different prevalent types in this population. A total of 2424 women, asymptomatic for any cervical disease, were screened for HPV infection. 9.9% of the women were found to be infected with either high- or low-risk HPV types and some of them were co-infected with multiple HPV types. This is in accordance with the other populations studied in India (Bhatla et al. 2008; Kerkar et al. 2011) but different from the data available from other countries. HPV infection was reported to be 26.8% in the US (Dunne et al. 2007), 46% in Gabon (Si-Mohamed et al. 2005), 13.3% in southeast China (Ye et al. 2010), 15.1% in the UK (Cotton et al. 2007), 15.9% in Italy (Centurioni et al. 2005) and 21.25% in American-Indian women (Bell et al. 2007). Our study demonstrates that out of 26 different HPV types detected, HPV-16 was the most prevalent, followed by HPV-6 and -81. The frequency of HPV-16 as observed in the population under study was 6.3% (figure 3), although a lower prevalence rate (4.7%) was reported in southern Asian countries (WHO 2010). Such a high frequency of HPV-16 was not reported in other regions of India (Clifford et al. 2005; Franceschi et al. 2005; Aggarwal et al. 2006; Kerkar et al. 2011) but was reported in eastern Asia (6.4%) and Eastern Europe (7.4%) (de Sanjose et al. 2007). In this study we further tried to determine the association of different socio-demographic factors with HPV infection. 69 We found that non-vegetarian diet and rural settings act as significant independent predictors for HPV infection (also reported earlier in north Indian population [Aggarwal et al. 2006]). Many studies reported that vegetarians have lower risk of HPV infection because of the presence of fruits and vegetables in their diet which are rich source of antioxidants like vitamin C, E, β-carotene and presence of folate (or in the form of folic acid) (Sedjo et al. 2002). Folate deficiency is known to cause reduced immunity (Dhur et al. 1991). It was found that women with high circulating concentration of folate and β-carotene were twice as less likely to develop persistent HPV infection and had greater likelihood of clearing them, and also the women with lower folate level and infected with high-risk type HPV-16 were 9 times more likely to develop CIN-2+ (Piyathilake et al. 2010). It was observed earlier by National Nutrition Monitoring Bureau, India, that the level of these micronutrients were less in rural population (Rao et al. 2010) and as observed in this study, the frequency of HPV-16 was very high in the rural population. Although we did not check the level of folate in these samples, this may be one of the contributing factors towards acquisition, persistence and progression of HPV infection. In many studies young age (Verteramo et al. 2006; Datta et al. 2010) and age at first intercourse (Flores et al. 2008) were found to be associated with HPV infection but our study demonstrated no such association with these factors. In a study (Jacobs et al. 2000), it was reported that high-risk HPV-type infection decreases with age while there was constant prevalence of low-risk types. On the other hand, our study indicated an increase in frequency of high-risk HPV-type infection with increase in age and a decrease in trend in the low-risk HPV type with increasing age. This may be due to changes in immune and hormonal system in older 6.3 HPV 16 0.66 HPV 31 0.53 HPV 6 HPV 81 0.45 HPV 33 0.41 HPV 18 0.37 HPV 35 0.28 HPV 42 0.24 HPV 11 0.21 HPV 45 0.16 0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 5 5.5 6 6.5 7 % of HPV prevalence Figure 3. Ten most frequent HPV types observed in asymptomatic women of eastern UP, India. J. Biosci. 37(1), March 2012 70 S Srivastava, S Gupta and JK Roy women which impair clearing of HPV infection especially of the high-risk types. In younger age group women, low and intermediate HPV types were more prevalent than in older women, which may be due to the high frequency of metaplastic changes taking place in the cervix (Burd 2003). Further, in our study multiple types of HPV infection were also observed in women of younger age group only (≤30 years). It is yet to be seen if this observation has a significance or is due to the limited number of samples. Association of HPV infection with post-menopausal women (although not statistically significant) is being shown in our study for the first time. Earlier reports (Althoff et al. 2009) show persistent HPV infection in perimenopausal women mainly. As oestrogen is an important immuno-modulating hormone and stimulator of humoral immunity, an association of HPV with post-menopausal women observed here may be due to lower oestrogen level in post-menopausal women. Further, in this study, pregnant women in their first trimester of pregnancy were also included. Risk of HPV infection was observed to be higher in them than in women who were not pregnant. Since it is known that the level of oestrogen was low in first trimester than in second and third trimesters of pregnancy (Nobbenhuis et al. 2002), it is likely that the low level of oestrogen is responsible for reduced immunity. In the present study, PCR-based method for HPV detection was employed using two primer sets, GP5+/6+ and MY09/11, both of them belonging to the L1 consensus region. Since these primers can detect a large spectrum of HPV types, they were used most frequently for HPV detection, but there is also a drawback in using them. In most of the cases, integration of HPV takes place by disrupting L1, E1 or E2 regions, hence making these disrupted regions unamplified and assessing them as false HPV-negative, consequently leading to underestimation of the prevalence. So, including other regions (E6/E7/LCR) for the detection of HPV may be beneficial, but since we obtained a comparable frequency of HPV-16-positive individuals in our study and in studies reported from other labs on asymptomatic populations, as well as in cervical cancer samples (not included in this study), it is likely that our result gives a true representation of the population. In India there is lack of screening programmes because of which large numbers of women remain undetected for HPV infection and cervical lesions in their initial stages. As this study shows that old age group women possess higher frequency of HPV infection, this emphasizes that these women should not be spared from screening. Further, the information generated by the study regarding the distribution of different HPV types in this population is significant and can be used for proper utilization of the present J. Biosci. 37(1), March 2012 prophylactic vaccines or for the generation of a new vaccine against a set of HPV types. Currently developed prophylactic vaccines are bivalent (Cervarix, GlaxoSmithKline Biologicals) and quadrivalent (Gardasil, Merck & Co.), which target only a set of HPV types 16/18 or 16/18/6/11, respectively. Although these vaccines can reduce the cervical cancer incidence, for the efficacy of the vaccines it is important to know the prevalence of different HPV types in the given population to be immunized. In UP, there was no epidemiological data of cervical cancer from National Cancer Registry Programme (NCRP) established by Indian Council for Medical Research (India), but a study including population of the districts Mahoba, Lalitpur, Agra and Banda have been shown to have highest prevalence of cervical cancer among all the female malignancies, although HPV genotypes are not known (Ganjewala 2009). Crude Incidence Rate (CIR) for cervical cancer was observed to be very high in Mahoba and Banda (28.83 and 27.63 per 100,000 persons, respectively) (Ganjewala 2009). Also the population of eastern UP covered under this study is exposed more to HPV-16, 31, 33, 6 and 81; hence, there is a need for vaccination covering these types. The study showed high frequency of HPV-16 in the given population, indicating an increase in risk of CINs in future, and hence there is an urgent need for the development of a therapeutic vaccine for this region. Acknowledgements We are grateful to the hospital staff of PP-ODP for their cooperation in cervical scrape sample collection. We thank Dr Attila Lorincz for providing us clones of HPV-31 and HPV-35 and Dr Gerard Orth for the clone of HPV-33. We also thank Prof KK Singh and Ms Shilpi for their help with statistics. The help of Dr MR Pillai in re-examining HPV genotypes of some randomly chosen samples, is duly acknowledged. This study was supported by the grant from Department of Biotechnology, India. References Aggarwal R, Gupta S, Nijhawan R, Suri V, Kaur A, Bhasin V and Arora SK 2006 Prevalence of high-risk human papillomavirus infections in women with benign cervical cytology: a hospital based study from North India. Indian J. Cancer 43 110–116 Althoff KN, Paul P, Burke AE, Viscidi R, Angaramoorthy M and Gravitt PE 2009 Correlates of cervicovaginal human papillomavirus detection in perimenopausal women. J. Women. Health 18 1341–1346 Baay MF, Quint WG, Koudstaal J, Hollema H, Duk JM, Burger MP, Stolz E and Herbrink P 1996 Comprehensive study of several general and type-specific primer pairs for detection of human papillomavirus DNA by PCR in paraffin-embedded cervical carcinomas. J. Clin. Microbiol. 34 745–747 High prevalence of oncogenic HPV-16 in cervical smears of asymptomatic women of eastern UP Bell MC, Schmidt-Grimminger D, Patrick S, Ryschon T, Linz L and Chauhan SC 2007 There is a high prevalence of human papillomavirus infection in American Indian women of the Northern Plains. Gynecol. Oncol. 107 236–241 Bhatla N, Dar L, Patro AR, Kumar P, Pati SK, Kriplani A, Gulati A, Broor S, et al. 2008 Human papillomavirus-type distribution in women with and without cervical neoplasia in north India. Int. J. Gynecol. Pathol. 27 426–430 Burd EM 2003 Human papillomavirus and cervical cancer. Clin. Microbiol. Rev. 16 1–17 Centurioni MG, Puppo A, Merlo DF, Pasciucco G, Cusimano ER, Sirito R and Gustavino CA 2005 Prevalence of human papillomavirus cervical infection in an Italian asymptomatic population. BMC Infect. Dis. 5 77 Clifford GM, Gallus S, Herrero R, Munoz N, Snijders PJF, Vaccarella S, Anh PT, Ferreccio C, et al. 2005 Worldwide distribution of human papillomavirus types in cytologically normal women in the International Agency for Research on Cancer HPV prevalence surveys: a pooled analysis. Lancet 366 991–998 Cotton SC, Sharp L, Seth R, Masson LF, Little J, Cruickshank ME, Neal K, Waugh N and TOMBOLA Group 2007 Lifestyle and socio-demographic factors associated with high-risk HPV infection in UK women. Br. J. Cancer 97 133–139 Datta P, Bhatla N, Dar L, Patro A R, Gulati A, Kriplani A and Singh N 2010 Prevalence of human papillomavirus infection among young women in North India. Cancer Epidemiol. 34 157–161 de Sanjose S, Diaz M, Castellsague X, Clifford G, Bruni L, Munoz N and Bosch FX 2007 Worldwide prevalence and genotype distribution of cervical human papillomavirus DNA in women with normal cytology: a meta-analysis. Lancet Infect. Dis. 7 453–459 Dhur A, Galan P and Hercberg S 1991 Folate status and the immune system. Prog. Food Nutr. Sci. 15 43–60 Dunne EF, Unger ER, Sternberg M, McQuillan G, Swan DC, Patel SS and Markowitz LE 2007 Prevalence of HPV infection among females in the United States. JAMA 297 813–819 Evans MF, Adamson CSC, Simmons-Arnold L and Cooper K 2005 Touchdown General Primer (GP5+/GP6+) PCR and optimized sample DNA concentration support the sensitive detection of human papillomavirus. BMC Clin. Pathol. 5 10 Flores YN, Bishai DM, Shah KV, Lazcano-Ponce E, Lörincz A, Hernández M, Ferris D and Salmerón J 2008 Risk factors for cervical cancer among HPV positive women in Mexico. Salud Publica Mex. 50 49–58 Franceschi S, Rajkumar R, Snijders PJF, Arslan A, Mahe C, Plummer M, Sankaranarayanan R, Cherian J, Meijer CJLM and Weiderpass E 2005 Papillomavirus infection in rural women in southern India. Br. J. Cancer 92 601–606 Ganjewala D 2009 Prevalence of cancers in some parts of Madhya Pradesh and Uttar Pradesh in India. Acad. J. Cancer Res. 2 12– 18 Gravitt PE, Peyton CL, Apple RJ and Wheeler CM 1998 Genotyping of 27 Human Papillomavirus types by using L1 71 consensus PCR products by a single-hybridization, Reverse Line Blot detection method. J. Clin. Microbiol. 36 3020– 3027 Jacobs MV, Walboomers JMM, Snijders PJF, Voorhorst FJ, Verheijen RHM, Fransen-Daalmeijer N and Meijer CJLM 2000 Distribution of 37 mucosotropic HPV types in women with cytologically normal Cervical Smears: the age-related patterns for high-risk and low-risk types. Int. J. Cancer 87 221–227 Karlsen F, Kalantari M, Jenkins A, Pettersen E, Kristensen G, Holm R, Johansson B and Hagmar B 1996 Use of multiple PCR primer sets for optimal detection of human papillomavirus. J. Clin. Microbiol. 34 2095–2100 Kerkar SC, Latta S, Salvi V and Pramanik JM 2011 Human Papillomavirus infection in asymptomatic population. Sex. Reprod. Health. 2 7–11 Lee SH, Vigliotti VS, Vigliotti JS and Pappu S 2009 Validation of human papillomavirus genotyping by signature DNA sequence analysis. BMC Clin. Pathol. 9 3 Munoz N, Bosch FX, de Sanjose S, Herrero R, Castellsague X, Shah KV, Snijders PJF and Meijer CJLM 2003 International Agency for Research on Cancer Multicenter cervical Cancer Study Group. Epidemiologic classification of human papillomavirus types associated with cervical cancer. New Engl. J. Med. 348 518–527 Nobbenhuis MAE, Helmerhorst TJM, Van Den Brule AJC, Rozendaal L, Bezemer PD, Voorhorst FJ and Meijer CJLM 2002 High-risk human papillomavirus clearance in pregnant women: trends for lower clearance during pregnancy with a catch-up postpartum. Br. J. Cancer 87 75–80 Ostor AG 1993 Natural history of cervical intraepithelial neoplasia: a critical review. Int. J. Gynecol. Pathol. 12 186–192 Piyathilake CJ, Badiga S, Paul P, Vijayaraghavan K, Vedantham H, Sudula M, Sowjanya P, Ramakrishna G, Shah KV, Partridge EE and Gravitt PE 2010 Indian women with higher serum concentrations of folate and vitamin B12 are significantly less likely to be infected with carcinogenic or high-risk (HR) types of human papillomaviruses (HPVs). Int. J. Women. Health 2 7–12 Rao KM, Balakrishna N, Arlappa N, Laxmaiah A and Brahmam GNV 2010 Diet and Nutritional Status of Women in India. J. Hum. Ecol. 29 165–170 Sedjo RL, Roe DJ, Abrahamsen M, Harris RB, Craft N, Baldwin S and Giuliano AR 2002 Vitamin A, carotenoids, and risk of persistent oncogenic human papillomavirus infection. Cancer Epidemiol. Biomarkers Prev. 11 876–884 Si-Mohamed A, Ndjoyi-Mbiguino A, Cuschieri K, Onas IN, Colombet I, Ozouaki F, Goff JL, Cubie H and Belec L 2005 High prevalence of high-risk oncogenic human papillomaviruses harboring atypical distribution in women of childbearing age living in Libreville, Gabon. J. Med. Virol. 430–438 Trottier H, Mahmud S, Costa MC, Sobrinho JP, Duarte-Franco E, Rohan TE, Ferenczy A, Villa LL and Franco EL 2006 Human papillomavirus infections with multiple types and risk of cervical neoplasia. Cancer Epidemiol. Biomarkers Prev. 15 1274–1280 Verteramo R, Pierangeli A, Calzolari E, Patella A, Recine N, Mancini E, Marcone V, Masciangelo R, et al. 2006 Direct sequencing of HPV DNA detected in gynaecologic outpatients in Rome, Italy. Microbes Infect. 8 2517–2521 J. Biosci. 37(1), March 2012 72 S Srivastava, S Gupta and JK Roy Vinayagamoorthy T, Mulatz K and Hodkinson R 2003 Nucleotide sequence-based multitarget identification. J. Clin. Microbiol. 413284–3292 Vossler JL, Forbes BA and Adelson MD 1995 Evaluation of the polymerase chain reaction for the detection of human papillomavirus from urine. J. Med. Virol. 45 354–360 WHO/ICO Information Centre on HPV and Cervical Cancer (HPV Information Centre) 2010 Human papillomavirus and related cancers in India. Summary Report 2010 Ye J, Cheng X, Chen X, Ye F, Lu W and Xie X 2010 Prevalence and risk profile of cervical human papillomavirus infection in Zhejiang Province, southeast China: a population-based study. Virol. J. 7 66 MS received 20 October 2011; accepted 29 December 2011 Corresponding editor: RITA MULHERKAR : J. Biosci. 37(1), March 2012