WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 8/7/24) consider helping me pay to finish my education!
banned from BLAST for being too sexy
hellsitegenetics reblogged
Hi guys, Gaming Peter here to explain the joke. Boy, at first when I saw this meme about a 3 day no gaming challenge I was freakin' angry! No gaming for 3 days!? But then I remembered, and this is freakin' hilarious by the way, February only has 28 days! I can keep gaming. Freakin' sweet!
why are you doing this to me it's november
String identified: g, Gag t t a t . , at t a t at a a gag cag a a' ag! gag a!? t t , a t a' a t a, a a a! ca gag. a' t! a g t t t'
Closest match: Agrochola macilenta genome assembly, chromosome: 22 Common name: Yellow-Line Quaker
hellsitegenetics reblogged
academic who writes a paper and just puts "credit to original author :)" for all their citations
String identified: acac t a a a t t "ct t ga at :)" a t ctat
Closest match: Alburnus alburnus genome assembly, chromosome: 16 Common name: Common Bleak
Anonymous asked:
how do you pick which asks to BLAST? it seems like you’d get swamped with a ridiculous amount of them, do they take forever to go through?
i wish i could say i have a system for going through asks, but the fact of the matter is that i get anywhere from 30-60 asks per day, and as a human with responsibilities it's just not feasible to get to all of them.
but, even if i don't BLAST all of them, i usually do *see* most of them, along with tags and comments you guys leave on posts. and, with that, i'd like to also thank you guys for the lovely words :) i'm glad you guys are having fun, and even though i'm absolutely swamped, i do still intend to focus on keeping things silly (and sharing fun facts, where i can) <3
hellsitegenetics reblogged
Anonymous asked:
Why do we as a society keep coming back to sex jokes?
Penis blast hilarious
penis blast nefarious
diverse types of penis blast call the penis blast various
penis blast electrical
penis blast delectable
penis blast campaigning call the penis blast electable
String identified: a a ct cg ac t ? at a at a t at ca t at a at ctca at cta at caagg ca t at cta
Closest match: Agapetus fuscipes genome assembly, chromosome: 7 Common name: Caddisfly
hellsitegenetics reblogged
Anonymous asked:
I’ve come to make an announcement: Shadow the Hedgehog’s a bitch ass mother fucker. He pissed on my fucking wife. That’s right, he took his hedgehog fuckin' quilly dick out and he pissed on my fucking wife, and he said his dick was THIS BIG. And I said “that’s disgusting!” So I’m making a callout post on my twitter dot com: "Shadow the Hedgehog, you got a small dick, it’s the size of this walnut except WAY smaller." And guess what, here’s what my dong looks like: PFFFFFFFFGJT. That’s right baby. All point, no quills, no pillows, look at that it looks like two balls and a bong. He fucked my wife so guess what, I’m gonna FUCK THE EARTH. THATS RIGHT THIS IS WHAT YOU GET, MY SUPER LAZER PISS. Except I’m not gonna piss on the earth, I’m gonna go higher. I’m pissing on the MOOOOOON! How do you like that, OBAMA? I PISSED ON THE MOON, YOU IDIOT! You have twenty-three hours before the piss d r o p l e t s hit the fucking earth, now get out of my fucking sight before I piss on you too!
String identified: ’ c t a a act: a t gg’ a tc a t c. cg . Tat’ gt, t gg c' c t a cg , a a c a T G. A a “tat’ gtg!” ’ ag a cat t ttt t c: "a t gg, gt a a c, t’ t t at ct A a." A g at, ’ at g : GT. Tat’ gt a. A t, , , at tat t t a a a g. c g at, ’ ga C T AT. TAT GT T AT GT, A . ct ’ t ga t at, ’ ga g g. ’ g t ! tat, AA? T , T! a tt-t t t t t cg at, gt t cg gt t!
Closest match: Molanna angustata genome assembly, chromosome: 4 Common name: Hood casemaker fly
hellsitegenetics reblogged
wontonsoupinthemorning-deactiva
message to all bitches
please survive
Source: CNN
hellsitegenetics reblogged
breakfast
that looks so good. can i ask you something?
thank you!
no.
String identified: aat tatg.caatg? ta! .
Closest match:
that's what you get for putting my ass under your little microscope. suffer the curse of my anomalous properties.
hellsitegenetics reblogged
breakfast
that looks so good. can i ask you something?
thank you!
no.
String identified: aat tatg.caatg? ta! .
Closest match:
hellsitegenetics reblogged
neutroisenjolras-moved-deactiva
open rp
“Feh.. It’s me, Inuyasha, the half-demon. I can defeat every demon who crosses my path. You think you can take me?”
jarofrobots
Macklemore pointed to the door. “go away, Inuyasha” he mackled
String identified:
Closest match: Antiaris toxicaria isolate JCLG002 chromosome 6 Common name: Upas Tree
#tumblr genetics#genetics#biology#science#inuyasha#macklemore#tumblr heritage#plants#trees#flowers#fruits#poison#what an awesome tree!!!#in chinese its name literally means “arrow poison tree”#because the latex derived from it would be used to coat arrowheads used in warfare!#it grows all over south asia and has a lot of names in lots of different languages because of it#i believe Upas was the malaysian name for it#apparently the toxin quickly causes heart attacks#and was historically noted as being SO potent that a multitude of poems were written about it#sick!
hi! it would be a BLAST if you could encourage all your usamerican followers to VOTE uwu
String identified: ! t a AT c cag a aca t T
Closest match: Responsible Voter Moth
hellsitegenetics reblogged
You look so much cuter in your pointy red hat sweetie, now wait here in the garden, Mommy has guests~
#gnomekink #gnomek1nk #gnomification #gnomepost #spicy #gnc #nsfw #nfst #gnomeblr #emptyspaces
String identified: c ct t at t, at t ga, a gt~ g #g #gcat #gt #c #gc # #t #g #tac
Closest match: Omphaloscelis lunosa genome assembly, chromosome: 1 Common name: Lunar Underwing
hellsitegenetics reblogged
“hi welcome to mcdonalds what can i get for you?”
“yeah can i get a deluxe quarter pounder with cheese?”
“absolutely, do you want the meal or just the sandwich?’
“uuuuuh hold on”
*fishes something out of my pocket*
“mikey what do i do?”
“get the fries. youll need the energy in the coming days”
*stuffs it back in my pocket*
“uhh yes please the meal would be great”
world heritage post
String identified: ctcaatcagtacagtaattcatattattactgtctatgtttgtcgattacctatagattagt
Closest match: Udea ferrugalis genome assembly, chromosome: 11 Common name: Rusty Dot Pearl
hellsitegenetics reblogged
nothing bottom jeans and boots with the nothing
the whole club was gone
String identified:
Closest match:
hellsitegenetics reblogged
Anonymous asked:
Merry Christmas!
i am being gaslit
Anonymous asked:
how many followers have you collected on the tumblr??
one. it's just you and me :)
Anonymous asked:
Merry Christmas!