Reference Gene Selection for RT-qPCR Normalization in Toxoplasma gondii Exposed to Broxaldine
by
, , ,
Yanhua Qiu
1,2,3,4
,
Yubin Bai
1,2,3,
Weiwei Wang
1,2,3,
Qing Wang
1,2,3,
Shulin Chen
4,* and
Jiyu Zhang
1,2,3,* 1
Key Laboratory of New Animal Drug Project of Gansu Province, Lanzhou 730050, China
2
Key Laboratory of Veterinary Pharmaceutical Development, Ministry of Agriculture and Rural Affairs, Lanzhou 730050, China
3
Lanzhou Institute of Husbandry and Pharmaceutical Sciences, Chinese Academy of Agricultural Sciences, Lanzhou 730050, China
4
College of Veterinary Medicine, Northwest Agriculture & Forestry University, Yangling 712100, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2024, 25(21), 11403; https://doi.org/10.3390/ijms252111403
Submission received: 12 September 2024
/
Revised: 18 October 2024
/
Accepted: 21 October 2024
/
Published: 23 October 2024
(This article belongs to the Section Molecular Biology)
Abstract
:Reverse transcription–quantitative real-time polymerase chain reaction (RT-qPCR) is widely used to accurately assess target gene expression. Evaluating gene expression requires the selection of appropriate reference genes. To identify reliable reference genes for Toxoplasma gondii (T. gondii) under varying concentrations of broxaldine (BRO), we employed the ΔCt method, BestKeeper, NormFinder, GeNorm, and the comprehensive web-based platform RefFinder to assess the expression stability of ten candidate reference genes in T. gondii. Herein, our findings reveal that the stability of these candidate reference genes is influenced by different experimental conditions. Under normal conditions, the most stable genes were TGME49_205470 and TGME49_226020. However, the most stable genes differed when BRO concentrations were at 1, 2, and 4 μg/mL. Across all samples, TGME49_247220 and TGME49_235930 were identified as the most stable reference genes. Moreover, we also confirmed the stability of TGME49_247220 and TGME49_235930 as reference genes through RT-qPCR assays. The present study provides a foundation for applying the RT-qPCR method to investigate target gene expression following BRO treatment in T. gondii.
1. Introduction
Reverse transcription–quantitative real-time polymerase chain reaction (RT-qPCR) has become an effective tool for assessing mRNA levels due to its high reproducibility, strong specificity, and capacity for high throughput [1]. Nevertheless, several key principles must be followed to ensure reliable results. These include using high-quality RNA and using primers with strong specificity and good amplification efficiency, as well as selecting stable mRNA reference genes to ensure accurate data correction and standardization [2,3]. In RT-qPCR experiments, researchers typically select widely used reference genes for normalizing gene expression [4]. However, numerous studies have shown that these commonly used reference genes, such as GAPDH and β-Actin, display variable expression levels under different conditions [5,6,7].
Toxoplasma gondii (T. gondii) is one of the most successful parasites worldwide [8]. Of note, acute infections can be fatal for individuals with compromised or weakened immune systems, while chronic infections have been linked to various neurological disorders [9]. Toxoplasmosis remains a significant global public health challenge, with effective chemotherapy being the primary strategy for combating this disease [10]. Our previous studies have shown that broxaldine (BRO) has beneficial effects on both T. gondii tachyzoites and bradyzoites, potentially influencing the organism’s autophagy, mitochondrial dysfunction, and neutral lipid synthesis [11]. Nonetheless, the precise mechanism by which BRO affects T. gondii remains elusive. RNA-seq data following treating T. gondii with BRO suggest that BRO may influence the expression of commonly used reference genes in T. gondii. Therefore, to improve the reliability of gene expression analysis, it is crucial to investigate the selection of reference genes in T. gondii in response to varying concentrations of BRO.
The present study evaluated the stability of ten candidate reference genes in T. gondii under varying concentrations of BRO. To assess the reliability and accuracy of these reference genes, the expression patterns of fifteen genes were analyzed under different experimental conditions involving BRO, utilizing transcriptome data and findings from previous research.
2. Results
2.1. Primer Specificity and Amplification Efficiency
Total RNA was extracted from T. gondii treated with BRO at concentrations of 4, 2, and 1 μg/mL. Analysis using 1% agarose gel electrophoresis showed a distinct band in the total RNA sample from T. gondii, with no evidence of degradation or contamination (Figure S1). The measured OD260/OD280 ratios were approximately 2.0, indicating that the RNA’s concentration, purity, and integrity met the established standards.
The RT-qPCR results showed that, under varying concentrations of BRO, all candidate reference genes produced a single band of the expected size on a 1% agarose gel, and the melting curves displayed a single peak (Figures S2 and S3), indicating good primer specificity. In addition, the correlation coefficients of the standard curves for the candidate reference genes were high (R2 > 0.990). Amplification efficiency was calculated using the formula E = (10^(−1/slope) − 1) × 100%. All ten candidate reference genes demonstrated satisfactory amplification efficiency, as illustrated in Figure S4 and Table 1.
2.2. Candidate Reference Gene Expression Analysis
The Ct value serves as an inverse indicator of gene expression, with lower Ct values indicating higher gene expression levels [12]. We analyzed the expression levels of ten candidate reference genes using RT-qPCR (Figure 1). The results showed that the Ct values of the candidate reference genes ranged from 19.6 to 31.5. Notably, TGME49_289690 (GAPDH1) had the lowest Ct value across varying concentrations of BRO, suggesting that GAPDH1 exhibited the highest expression level.
2.3. Candidate Reference Gene Expression Stability Analysis
2.3.1. ∆Ct Analysis
The stability of candidate reference genes was evaluated using ΔCt analysis, with the gene exhibiting the lowest mean standard deviation (mSD) considered the most stable [13]. The analysis identified TGME49_205470 as the most stable gene within the control group, while TGME49_247220 emerged as the most stable gene across all samples. Conversely, TGME49_316400 was found to be the least stable gene (Table 2 and Figure 2).
2.3.2. BestKeeper Analysis
In the BestKeeper analysis, a smaller standard coefficient of variation (SD) of the Ct value indicates greater stability in gene expression, with genes showing an SD greater than 1 considered unstable [14]. Our findings demonstrate that ten candidate genes exhibited stable expression (SD < 1) in both the control group and the BRO 1 μg/mL and BRO 4 μg/mL groups. However, in the BRO 2 μg/mL group, only TGME49_247220, TGME49_205470, and TGME49_235930 displayed stable expressions (Table 3). Across all samples, TGME49_212300 emerged as the most stable gene, while TGME49_316400 was the least stable (Table 3 and Figure 2).
2.3.3. NormFinder Analysis
In the NormFinder analysis, a lower stability value indicates greater gene stability. Our results show that TGME49_205470 is the most stable gene in the control group. Among all samples analyzed, TGME49_209030 emerged as the most stable gene overall, while TGME49_316400 was identified as the least stable gene (Table 4 and Figure 2).
2.3.4. GeNorm Analysis
Next, we used geNorm to evaluate gene expression stability across different samples. Candidate genes were ranked based on their average expression M value, with genes exhibiting M < 1.5 considered suitable for normalization analysis [15]. A lower M value indicates greater stability in gene expression. In the control group, the M values of candidate genes ranged from 0.01 to 0.04, while in the BRO group, the values ranged from 0.06 to 0.26. This suggests that gene expression was more stable in the control group compared to the BRO group (Figure 3A–D). Among all samples, TGME49_247220 and TGME49_235930 showed the highest stability in expression, whereas TGME49_316400 demonstrated the least stability (Figure 3E).
In addition to assessing the expression stability of candidate reference genes, geNorm can identify the optimal number of reference genes by analyzing pairwise variation (Vn/Vn+1) [15,16]. The results of this study show that across various concentrations of BRO, the V2/3 ratio for each gene in all samples consistently remained below the threshold of 0.15 (Figure 4). This finding indicates that two reference genes are sufficient to achieve optimal performance in gene expression analysis.
2.3.5. RefFinder Analysis
Finally, we used RefFinder to conduct a comprehensive analysis of the four methods. The results showed that, in the control group, TGME49_205470 exhibited the highest stability. In the BRO 1 μg/mL group, TGME49_247220 was the most stable. In the BRO 2 μg/mL group, TGME49_226020 demonstrated the greatest stability. In the BRO 4 μg/mL group, TGME49_205470 again showed the highest stability. Across all samples, TGME49_247220 and TGME49_235930 were identified as the most stable genes, while TGME49_316400 was found to be the least stable (Figure 5).
2.4. Verification of Reference Genes
We combined transcriptome data and selected six genes to validate the stability of the reference genes TGME49_247220 and TGME49_235930. The results indicated that the relative expression levels of TGME49_245980, TGME49_273130, TGME49_268970, TGME49_247520, TGME49_260190, and TGME49_252360 were consistent with the transcriptome data (Figure 6). Additionally, BRO influenced the expression of autophagy, mitochondrial, and lipid-related genes in T. gondii (Figure 7), which is consistent with our previous studies [11]. In summary, our results suggest that TGME49_247220 and TGME49_235930 can be used as stable reference genes for RT-qPCR experiments involving BRO.
3. Discussion
Studies have shown that reference gene expression levels can fluctuate under various experimental conditions [13,17]. Therefore, identifying suitable reference genes for specific contexts is crucial for precise gene expression analysis. T. gondii, an intracellular parasitic eukaryote, shares common reference genes with other eukaryotes, such as actin, GAPDH, and tubulin. Nevertheless, there is a lack of studies confirming the widespread and stable expression of these genes in T. gondii.
Based on the RNA-seq data of T. gondii subjected to varying concentrations of BRO, we identified stably expressed genes across different conditions to screen for suitable reference genes. The stability of these genes was assessed using two parameters: the coefficient of variation (CV) and the maximum fold change (MFC). Specifically, the MFC value for stably expressed genes must be less than 2, while the CV must be below 4% [18]. These two parameters indicate very low standard deviations and are widely recognized as essential criteria for selecting candidate reference genes [19]. Following these criteria, we identified seven stably expressed genes. Additionally, we selected three of the most commonly used reference genes in T. gondii. These genes are all genes encoding proteins involved in maintaining cellular functions.
In this study, we employed ΔCt, BestKeeper, geNorm, and NormFinder to evaluate candidate reference genes of T. gondii in response to varying concentrations of BRO. The results showed notable differences in reference gene stability as assessed by different software tools, likely due to variations in the algorithms used [20]. To address this, we utilized the online tool RefFinder to integrate the four algorithms and produce a final stability ranking. The findings reveal that at a BRO concentration of zero (specifically 0.1% DMSO), the most stable internal reference gene in T. gondii is TGME49_205470. Conversely, TGME49_209030 (ACT1), a commonly used reference gene, was identified as the most unstable (Figure 5). For BRO concentrations of 1, 2, and 4 μg/mL, the most stable reference genes were inconsistent, specifically TGME49_247220, TGME49_226020, and TGME49_205470, respectively. When combining all data from each group for stability ranking, the results indicate the following order of stability under varying BRO concentrations: TGME49_247220 > TGME49_235930 > TGME49_209030 > TGME49_212300 > TGME49_220950 > TGME49_205470 > TGME49_226020 > TGME49_289690 > TGME49_249180 > TGME49_316400.
Studies have shown that using multiple reference genes improves the accuracy of gene expression level assessments compared to relying on a single reference gene [16]. The geNorm software helps analyze pairwise variation (V value) to determine the optimal number of reference genes needed. Specifically, when the ratio Vn/Vn+1 is less than 0.15, it indicates that the appropriate number of reference genes is n. In this study, the V2/V3 values across various BRO treatment concentrations consistently fell below 0.15, suggesting that two reference genes are the most suitable.
To validate the selected reference genes, we compared the relative expression levels of six genes with the fragments per kilobase million (FPKM) values obtained from transcriptome analysis and found the results to be consistent. Additionally, we selected genes associated with autophagy, mitochondria, and lipid metabolism in T. gondii to conduct RT-qPCR experiments based on our previous research. Our results indicated that among the autophagy-related genes, BRO significantly decreased the expression of ATG3 and ATG7 while markedly increasing the expression of ATG8. The ATG8 protein is a central component in the autophagy process of T. gondii and serves as the most widely used marker for autophagosomes [21,22]. Among the mitochondria-related genes, BRO significantly reduced the expression of CYP450mt, ATPB, and ICAP2. The CYP450mt enzyme is a steroidogenic enzyme localized in the mitochondria, and the CYP450mt gene is essential for the survival of T. gondii [23]. ATPB and ICAP2 are subunits of T. gondii ATP synthase, playing a crucial role in ATP synthesis within the parasite [24]. Among lipid-related genes, BRO significantly reduced the expression of ASH4 and ACS1 while markedly increasing the expression of DGAT. The ASH4 protein is an enzyme involved in lipid metabolism, and its absence can lead to the accumulation of phospholipids and neutral lipids within the T. gondii [25]. ACS1 is closely associated with the neutral lipid metabolism of T. gondii. Following the deletion of ACS1, the level of lipid droplets in T. gondii increases [26]. The DGAT enzyme is a crucial triacylglycerol synthase and plays a significant role in the synthesis of neutral lipids [27,28]. Our results, consistent with previous studies, indicate that BRO can influence autophagy, mitochondrial function, and lipid synthesis in T. gondii.
In summary, under the influence of BRO, TGME49_247220 and TGME49_235930 were identified as the most appropriate reference genes for the RT-qPCR analysis of T. gondii.
4. Materials and Methods
4.1. Culture of T. gondii and Treatment with BRO
African green monkey kidney (Vero) cells were obtained from the cell bank of the Chinese Academy of Sciences, while RH tachyzoites were generously provided by the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences. The Vero cells were cultured in DMEM (Gibco, Beijing China) supplemented with 10% fetal bovine serum (FBS, Gibco, Beijing China). T. gondii was cultivated in a monolayer of Vero cells in DMEM containing 3% FBS.
RH tachyzoites were added to a monolayer of Vero cells at a multiplicity-of-infection (MOI) ratio of 2:1. After 8 h, BRO was administered at concentrations of 4, 2, and 1 μg/mL, along with 0.1% DMSO for the control group, and the cells were incubated for 24 h. Following treatment, a cell scraper was used to detach the cells, and a 27 G needle was utilized to disrupt them three times in order to release the T. gondii tachyzoites. The mixture was centrifuged at 200× g for 5 min, and then the supernatant was passed through a 3 μm filter to remove cell debris. Finally, the supernatant was centrifuged again at 1500× g for 10 min to obtain the T. gondii pellet. Experiments were performed using three independent replicates. For the RNA-Seq data used in this article, the sample preprocessing method aligns with the aforementioned description.
4.2. Total RNA Extraction and Reverse Transcription
After washing the T. gondii pellet twice with phosphate-buffered saline (PBS, Solarbio, Beijing China), total RNA was extracted using RNAiso Plus (Takara, Beijing China) according to the manufacturer’s instructions. The concentration of the extracted RNA was measured using NanoDrop™ One (Thermo Scientific, Waltham, MA, USA), and the quality was assessed through agarose gel electrophoresis. After confirming satisfactory RNA quality, we used the PrimeScript™ RT Reagent Kit with gDNA Eraser (Takara, Beijing, China) to perform a reverse transcription reaction for complementary DNA (cDNA) synthesis.
4.3. Selection of Reference Genes and Primer Design
We selected ten genes for screening. Among these, TGME49_209030 (ACT1) [29], TGME49_316400 (TUBA1) [30], and TGME49_289690 (GAPDH1) [31] are the most commonly used reference genes for T. gondii. Additionally, the genes TGME49_220950, TGME49_205470, TGME49_235930, TGME49_212300, TGME49_226020, TGME49_249180, and TGME49_247220 were chosen based on their expression values (FPKM) from the T. gondii transcriptome (Table 5). These genes exhibit a low coefficient of variation (CV < 4%) and a narrow maximum fold change (MFC < 2) [32]. The MFC is defined as the ratio of the standard deviation of the FPKM values to the mean, while the CV is calculated as the ratio of the highest to the lowest FPKM values [18]. Primers were designed, and their specificity was assessed using NCBI’s Primer-BLAST tool. The primers were synthesized by Wuhan Qingke Biotechnology Company, and the primer sequences are listed in Table 6.
4.4. RT-qPCR Assay
The RT-qPCR reaction was performed using the TB Green® Premix Ex Taq™ II kit (Takara, Beijing China), with cDNA from T. gondii treated with BRO and 0.1% DMSO at varying concentrations (4, 2, and 1 μg/mL) as the template. The cDNA concentration was measured and diluted to a starting concentration of 50 ng/μL. This cDNA was then further diluted in a 1:5 ratio to create six dilutions (50, 10, 2, 0.4, 0.08, and 0.016 ng/μL). The reaction mixture consisted of 10 μL of TB Green Premix Ex Taq II (Tli RNaseH Plus) (2×), 0.8 μL each of upstream and downstream primers (10 μM), 0.4 μL of ROX Reference Dye II (50×), 2 μL of the cDNA template, and 6 μL of ddH2O. A two-step PCR reaction was carried out using the QuantStudio™ 6 Flex Real-Time PCR system (Thermo Scientific, Waltham, MA, USA). The amplification program included an initial denaturation step at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 34 s. Finally, a melting curve analysis was performed.
4.5. Stability Analysis of Candidate Reference Genes
The stability of the ten candidate reference genes was evaluated using the ΔCt method [13], BestKeeper [14], NormFinder [33], and GeNorm [15]. GeNorm was used to aggregate variation values and determine the optimal number of reference genes for normalization. To ensure the proper functioning of the four algorithms and to obtain a comprehensive stability ranking based on the experimental data, we employed the online tool RefFinder (https://blooge.cn/RefFinder/, accessed on 11 May 2024).
4.6. Verification of Reference Genes
Based on the transcriptome data, three upregulated and three downregulated genes were selected to validate the two most stable reference genes identified: TGME49_247220 and TGME49_235930. Our previous studies have demonstrated that BRO can induce autophagy, mitochondrial dysfunction, and neutral lipid accumulation in T. gondii [11]. To further validate the stability of TGME49_247220 and TGME49_235930 as reference genes, we selected nine genes associated with autophagy, mitochondria, and lipid metabolism in T. gondii for RT-qPCR analysis. The primer sequences for these fifteen genes are provided in Table S1. The RT-qPCR data were analyzed using the 2−ΔΔCt method [34], with each experiment performed in triplicate.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms252111403/s1.
Author Contributions
Y.Q.: conceptualization, methodology, software, validation, formal analysis, investigation, data curation, writing—original draft preparation, writing—review and editing, visualization. Y.B.: resources, formal analysis, writing—review and editing, visualization. W.W.: resources, data curation. Q.W.: resources. S.C.: supervision, project administration. J.Z.: supervision, resources, project administration, writing—review and editing, funding acquisition. All authors have read and agreed to the published version of the manuscript.
Funding
This work was supported by the Earmarked Fund for China Agriculture Research System (grant CARS-37), and the Innovation Project of Chinese Academy of Agricultural Sciences (grant 25-LZIHPS-05).
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
The NCBI database provides access to high-throughput data. The accession number associated with the RNA-seq data presented in this study is PRJNA1153788.
Conflicts of Interest
The authors declare no conflicts of interest.
References
- Nolan, T.; Hands, R.E.; Bustin, S.A. Quantification of mRNA using real-time RT-PCR. Nat. Protoc. 2006, 1, 1559–1582. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [PubMed]
- Caballero-Solares, A.; Hall, J.R.; Xue, X.; Rise, M.L. Reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) for gene expression analyses. Methods Mol. Biol. 2022, 2508, 319–340. [Google Scholar] [CrossRef] [PubMed]
- Shu, X.; Hua, G.; Zheng, X.; Chen, Z.; Zhang, J.; Zhuang, W.; Chen, J. Screening of reliable reference genes for the normalization of RT-qPCR in chicken oviduct tract. Poult. Sci. 2024, 103, 103980. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Chen, Z.; Zhang, J.; Zhuang, W.; Zheng, X. Screening of reliable reference genes for the normalization of RT-qPCR in chicken gastrointestinal tract. Poult. Sci. 2023, 102, 103169. [Google Scholar] [CrossRef]
- Lin, J.; Redies, C. Histological evidence: Housekeeping genes beta-actin and GAPDH are of limited value for normalization of gene expression. Dev. Genes. Evol. 2012, 222, 369–376. [Google Scholar] [CrossRef]
- Barber, R.D.; Harmer, D.W.; Coleman, R.A.; Clark, B.J. GAPDH as a housekeeping gene: Analysis of GAPDH mRNA expression in a panel of 72 human tissues. Physiol. Genomics 2005, 21, 389–395. [Google Scholar] [CrossRef]
- Lourido, S. Toxoplasma gondii . Trends Parasitol. 2019, 35, 944–945. [Google Scholar] [CrossRef]
- Cossu, G.; Preti, A.; Gyppaz, D.; Gureje, O.; Carta, M.G. Association between toxoplasmosis and bipolar disorder: A systematic review and meta-analysis. J. Psychiatr. Res. 2022, 153, 284–291. [Google Scholar] [CrossRef]
- Antczak, M.; Dzitko, K.; Dlugonska, H. Human toxoplasmosis—Searching for novel chemotherapeutics. Biomed. Pharmacother. 2016, 82, 677–684. [Google Scholar] [CrossRef]
- Qiu, Y.; Zhai, B.; Bai, Y.; Lin, H.; Wu, L.; Luo, W.; Shi, M.; Chen, S.; Zhang, J. In vitro and in vivo activity evaluation and mode of action of broxaldine on Toxoplasma gondii. Int. J. Parasitol. Drugs Drug. Resist. 2024, 25, 100552. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Yang, C.; Liu, Q.; Zhang, X.; Mei, X.; Zhang, T.; Ning, J. Validation and evaluation of reference genes for quantitative real-time PCR analysis in Mythimna loreyi (Lepidoptera: Noctuidae). Insects 2024, 15, 185. [Google Scholar] [CrossRef] [PubMed]
- Shi, L.; Cai, Y.; Yao, J.; Zhang, Q.; He, B.; Lin, S. Reference genes selection and validation for Cinnamomum burmanni by real-time quantitative polymerase chain reaction. Int. J. Mol. Sci. 2024, 25, 3500. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Ishikawa, T.; Michiue, T.; Zhu, B.L.; Guan, D.W.; Maeda, H. Stability of endogenous reference genes in postmortem human brains for normalization of quantitative real-time PCR data: Comprehensive evaluation using geNorm, NormFinder, and BestKeeper. Int. J. Legal. Med. 2012, 126, 943–952. [Google Scholar] [CrossRef]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, RESEARCH0034. [Google Scholar] [CrossRef]
- Zhang, K.; Fan, W.; Chen, D.; Jiang, L.; Li, Y.; Yao, Z.; Yang, Y.; Qiu, D. Selection and validation of reference genes for quantitative gene expression normalization in Taxus spp. Sci. Rep. 2020, 10, 22205. [Google Scholar] [CrossRef]
- Liu, H.; Lu, Y.; Wang, X.; Wang, X.; Li, R.; Lu, C.; Lan, X.; Chen, Y. Selection and validation of reference genes for RT-qPCR analysis in tibetan medicinal plant Saussurea Laniceps callus under abiotic stresses and hormone treatments. Genes 2022, 13, 904. [Google Scholar] [CrossRef]
- de Jonge, H.J.; Fehrmann, R.S.; de Bont, E.S.; Hofstra, R.M.; Gerbens, F.; Kamps, W.A.; de Vries, E.G.; van der Zee, A.G.; Te, M.G.; ter Elst, A. Evidence based selection of housekeeping genes. PLoS ONE 2007, 2, e898. [Google Scholar] [CrossRef]
- Eisenberg, E.; Levanon, E.Y. Human housekeeping genes, revisited. Trends Genet. 2013, 29, 569–574. [Google Scholar] [CrossRef]
- Chatelain, P.; Blanchard, C.; Astier, J.; Klinguer, A.; Wendehenne, D.; Jeandroz, S.; Rosnoblet, C. Reliable reference genes and abiotic stress marker genes in Klebsormidium nitens. Sci. Rep. 2022, 12, 18988. [Google Scholar] [CrossRef]
- Slobodkin, M.R.; Elazar, Z. The Atg8 family: Multifunctional ubiquitin-like key regulators of autophagy. Essays. Biochem. 2013, 55, 51–64. [Google Scholar] [CrossRef] [PubMed]
- Leveque, M.F.; Berry, L.; Cipriano, M.J.; Nguyen, H.; Striepen, B.; Besteiro, S. Autophagy-related protein ATG8 has a noncanonical function for apicoplast inheritance in Toxoplasma gondii. mBio 2015, 6, e01446-15. [Google Scholar] [CrossRef] [PubMed]
- Asady, B.; Samples, V.; Romano, J.D.; Levitskaya, J.; Lige, B.; Khare, P.; Le, A.; Coppens, I. Function and regulation of a steroidogenic CYP450 enzyme in the mitochondrion of Toxoplasma gondii. PLoS Pathog. 2023, 19, e1011566. [Google Scholar] [CrossRef] [PubMed]
- Huet, D.; Rajendran, E.; van Dooren, G.G.; Lourido, S. Identification of cryptic subunits from an apicomplexan ATP synthase. Elife 2018, 7, e38097. [Google Scholar] [CrossRef] [PubMed]
- Onguka, O.; Babin, B.M.; Lakemeyer, M.; Foe, I.T.; Amara, N.; Terrell, S.M.; Lum, K.M.; Cieplak, P.; Niphakis, M.J.; Long, J.Z.; et al. Toxoplasma gondii serine hydrolases regulate parasite lipid mobilization during growth and replication within the host. Cell Chem. Biol. 2021, 28, 1501–1513.e5. [Google Scholar] [CrossRef]
- Charital, S.; Shunmugam, S.; Dass, S.; Alazzi, A.M.; Arnold, C.; Katris, N.J.; Duley, S.; Quansah, N.A.; Pierrel, F.; Govin, J.; et al. The acyl-CoA synthetase Tg ACS1 allows neutral lipid metabolism and extracellular motility in Toxoplasma gondii through relocation via its peroxisomal targeting sequence (PTS) under low nutrient conditions. mBio 2024, 15, e0042724. [Google Scholar] [CrossRef]
- Nolan, S.J.; Romano, J.D.; Coppens, I. Host lipid droplets: An important source of lipids salvaged by the intracellular parasite Toxoplasma gondii. PLoS Pathog. 2017, 13, e1006362. [Google Scholar] [CrossRef]
- Nolan, S.J.; Romano, J.D.; Kline, J.T.; Coppens, I. Novel approaches to kill Toxoplasma gondii by exploiting the uncontrolled uptake of unsaturated fatty acids and vulnerability to lipid storage inhibition of the parasite. Antimicrob. Agents. Chemother. 2018, 62, e00347-18. [Google Scholar] [CrossRef]
- Li, M.; Sang, X.; Zhang, X.; Li, X.; Feng, Y.; Yang, N.; Jiang, T. A metabolomic and transcriptomic study revealed the mechanisms of lumefantrine inhibition of Toxoplasma gondii. Int. J. Mol. Sci. 2023, 24, 4902. [Google Scholar] [CrossRef]
- Mayoral, J.; Di Cristina, M.; Carruthers, V.B.; Weiss, L.M. Toxoplasma gondii: Bradyzoite differentiation in vitro and in vivo. Methods Mol. Biol. 2020, 2071, 269–282. [Google Scholar] [CrossRef]
- Biddau, M.; Bouchut, A.; Major, J.; Saveria, T.; Tottey, J.; Oka, O.; Van-Lith, M.; Jennings, K.E.; Ovciarikova, J.; DeRocher, A.; et al. Two essential Thioredoxins mediate apicoplast biogenesis, protein import, and gene expression in Toxoplasma gondii. PLoS Pathog. 2018, 14, e1006836. [Google Scholar] [CrossRef] [PubMed]
- Carvalho, D.M.; de Sa, P.H.; Castro, T.L.; Carvalho, R.D.; Pinto, A.; Gil, D.J.; Bagano, P.; Bastos, B.; Costa, L.F.; Meyer, R.; et al. Reference genes for RT-qPCR studies in Corynebacterium pseudotuberculosis identified through analysis of RNA-seq data. Antonie. Van. Leeuwenhoek. 2014, 106, 605–614. [Google Scholar] [CrossRef] [PubMed]
- Andersen, C.L.; Jensen, J.L.; Orntoft, T.F. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Figure 1.
The expression levels of ten candidate reference genes were evaluated at different concentrations of broxaldine (BRO). (A) Control group with 0.1% DMSO; (B) BRO at 1 μg/mL; (C) BRO at 2 μg/mL; (D) BRO at 4 μg/mL; (E) all samples.
Figure 1.
The expression levels of ten candidate reference genes were evaluated at different concentrations of broxaldine (BRO). (A) Control group with 0.1% DMSO; (B) BRO at 1 μg/mL; (C) BRO at 2 μg/mL; (D) BRO at 4 μg/mL; (E) all samples.
Figure 2.
Assessment of the stability of ten candidate reference genes using four different methods—the ΔCt method, BestKeeper, NormFinder, and GeNorm—was performed. The size of each bubble represents the stability value, with larger bubbles indicating lower stability.
Figure 2.
Assessment of the stability of ten candidate reference genes using four different methods—the ΔCt method, BestKeeper, NormFinder, and GeNorm—was performed. The size of each bubble represents the stability value, with larger bubbles indicating lower stability.
Figure 3.
Average expression stability M of ten candidate reference genes under different concentrations of BRO. (A) Control group of 0.1% DMSO; (B) BRO 1 μg/mL; (C) BRO 2 μg/mL; (D) BRO 4 μg/mL; (E) all samples.
Figure 3.
Average expression stability M of ten candidate reference genes under different concentrations of BRO. (A) Control group of 0.1% DMSO; (B) BRO 1 μg/mL; (C) BRO 2 μg/mL; (D) BRO 4 μg/mL; (E) all samples.
Figure 4.
Pairwise variation values for all samples and groups.
Figure 5.
Comprehensive analysis of the stability of ten candidate reference genes using RefFinder. The size of the bubbles represents the geometric mean, with smaller bubbles indicating lower values and greater stability.
Figure 5.
Comprehensive analysis of the stability of ten candidate reference genes using RefFinder. The size of the bubbles represents the geometric mean, with smaller bubbles indicating lower values and greater stability.
Figure 6.
The expression levels of genes in RT-qPCR and RNA-seq experiments were assessed at varying concentrations of BRO. Data were analyzed using GraphPad Prism 9 software (San Diego, CA, USA). The results are presented as the mean ± SEM.
Figure 6.
The expression levels of genes in RT-qPCR and RNA-seq experiments were assessed at varying concentrations of BRO. Data were analyzed using GraphPad Prism 9 software (San Diego, CA, USA). The results are presented as the mean ± SEM.
Figure 7.
The expression levels of T gondii genes following treatment with 4 μg/mL BRO were assessed. Specifically, the expression levels of genes associated with autophagy (A), lipids (B), and mitochondria (C) in T. gondii were analyzed. Data were collected using GraphPad Prism 9 software, and the results are presented as the mean ± SEM. Statistical analysis was performed using Sidak’s two-way ANOVA with multiple comparisons. ****, p < 0.0001; ***, p < 0.001; **, p < 0.01.
Figure 7.
The expression levels of T gondii genes following treatment with 4 μg/mL BRO were assessed. Specifically, the expression levels of genes associated with autophagy (A), lipids (B), and mitochondria (C) in T. gondii were analyzed. Data were collected using GraphPad Prism 9 software, and the results are presented as the mean ± SEM. Statistical analysis was performed using Sidak’s two-way ANOVA with multiple comparisons. ****, p < 0.0001; ***, p < 0.001; **, p < 0.01.
Table 1.
Amplification efficiency parameters of candidate reference genes.
| Gene | Standard Curve | Efficiency | Correlation Coefficient (R2) |
|---|---|---|---|
| TGME49_220950 | y = −3.553x + 26.75 | 91.18% | 0.999 |
| TGME49_205470 | y = −3.319x + 30.79 | 100.12% | 0.995 |
| TGME49_235930 | y = −3.462x + 31.07 | 94.47% | 0.997 |
| TGME49_212300 | y = −3.445x + 32.96 | 95.11% | 0.998 |
| TGME49_226020 | y = −3.364x + 31.19 | 98.27% | 0.998 |
| TGME49_289690 | y = −3.243x + 31.46 | 103.40% | 0.992 |
| TGME49_249180 | y = −3.507x + 33.73 | 92.82% | 0.994 |
| TGME49_316400 | y = −3.428x + 30.92 | 95.76% | 0.995 |
| TGME49_209030 | y = −3.276x + 28.69 | 101.95% | 0.999 |
| TGME49_247220 | y = −3.217 + 32.36 | 104.57% | 0.996 |
Table 2.
Analysis of the mSD values of candidate reference genes using ΔCt method.
| Gene | Control | BRO 1 μg/mL | BRO 2 μg/mL | BRO 4 μg/mL | Total |
|---|---|---|---|---|---|
| TGME49_289690 | 0.12 | 0.26 | 0.17 | 0.20 | 0.40 |
| TGME49_247220 | 0.07 | 0.18 | 0.19 | 0.19 | 0.33 |
| TGME49_209030 | 0.14 | 0.18 | 0.14 | 0.24 | 0.34 |
| TGME49_220950 | 0.10 | 0.20 | 0.19 | 0.22 | 0.39 |
| TGME49_316400 | 0.09 | 0.20 | 0.16 | 0.21 | 0.83 |
| TGME49_205470 | 0.06 | 0.28 | 0.24 | 0.18 | 0.37 |
| TGME49_249180 | 0.14 | 0.19 | 0.19 | 0.79 | 0.55 |
| TGME49_212300 | 0.11 | 0.20 | 0.18 | 0.23 | 0.42 |
| TGME49_235930 | 0.09 | 0.20 | 0.21 | 0.18 | 0.34 |
| TGME49_226020 | 0.10 | 0.54 | 0.14 | 0.19 | 0.46 |
Table 3.
BestKeeper was used to analyze the SD of candidate reference genes.
| Gene | Control | BRO 1 μg/mL | BRO 2 μg/mL | BRO 4 μg/mL | Total |
|---|---|---|---|---|---|
| TGME49_289690 | 0.26 | 0.10 | 1.04 | 0.53 | 1.04 |
| TGME49_247220 | 0.32 | 0.21 | 0.91 | 0.56 | 0.90 |
| TGME49_209030 | 0.38 | 0.22 | 1.05 | 0.71 | 1.02 |
| TGME49_220950 | 0.31 | 0.29 | 1.13 | 0.51 | 0.97 |
| TGME49_316400 | 0.35 | 0.19 | 1.08 | 0.68 | 1.54 |
| TGME49_205470 | 0.31 | 0.37 | 0.86 | 0.60 | 1.04 |
| TGME49_249180 | 0.42 | 0.28 | 1.13 | 0.72 | 1.11 |
| TGME49_212300 | 0.39 | 0.31 | 1.04 | 0.68 | 0.85 |
| TGME49_235930 | 0.32 | 0.31 | 0.88 | 0.62 | 0.94 |
| TGME49_226020 | 0.31 | 0.42 | 1.02 | 0.63 | 0.89 |
Table 4.
The stability value of candidate reference genes was analyzed using NormFinder.
| Gene | Control | BRO 1 μg/mL | BRO 2 μg/mL | BRO 4 μg/mL | Total |
|---|---|---|---|---|---|
| TGME49_289690 | 0.10 | 0.18 | 0.11 | 0.09 | 0.24 |
| TGME49_247220 | 0.04 | 0.04 | 0.15 | 0.04 | 0.12 |
| TGME49_209030 | 0.12 | 0.05 | 0.05 | 0.18 | 0.05 |
| TGME49_220950 | 0.08 | 0.14 | 0.16 | 0.08 | 0.26 |
| TGME49_316400 | 0.04 | 0.11 | 0.11 | 0.11 | 0.79 |
| TGME49_205470 | 0.03 | 0.21 | 0.21 | 0.01 | 0.15 |
| TGME49_249180 | 0.12 | 0.11 | 0.15 | 0.79 | 0.44 |
| TGME49_212300 | 0.08 | 0.12 | 0.12 | 0.18 | 0.33 |
| TGME49_235930 | 0.05 | 0.11 | 0.18 | 0.07 | 0.12 |
| TGME49_226020 | 0.07 | 0.52 | 0.01 | 0.04 | 0.35 |
Table 5.
Transcriptome FPKM, CV, and MFC of candidate reference genes for T. gondii.
| Gene | FPKM | CV (%) | MFC | |||
|---|---|---|---|---|---|---|
| Control | BRO 1 μg/mL | BRO 2 μg/mL | BRO 4 μg/mL | |||
| TGME49_220950 | 795.5 | 809.98 | 810.17 | 828.2 | 1.65 | 1.04 |
| TGME49_205470 | 255.29 | 263.88 | 269.57 | 277.13 | 3.46 | 1.09 |
| TGME49_235930 | 170.62 | 177.18 | 182.85 | 182.87 | 3.26 | 1.07 |
| TGME49_212300 | 247.93 | 257.77 | 260.49 | 268.05 | 3.22 | 1.08 |
| TGME49_226020 | 365.64 | 372.79 | 381.07 | 391.27 | 2.92 | 1.07 |
| TGME49_247220 | 545.4 | 569.4 | 583.65 | 594.77 | 3.72 | 1.09 |
| TGME49_249180 | 58.97 | 60.57 | 63.02 | 63.5 | 3.46 | 1.08 |
| TGME49_316400 (TUBA1) | 1180.95 | 594.29 | 318.97 | 264 | 71.22 | 4.47 |
| TGME49_209030 (ACT1) | 513.44 | 402.78 | 304.58 | 294.56 | 26.97 | 1.74 |
| TGME49_289690 (GAPDH1) | 390.98 | 311.95 | 289.81 | 384.62 | 14.83 | 1.35 |
Table 6.
Information on candidate reference genes and primer sequences for T. gondii.
| Gene | Gene Description | Primer Sequences (5′→3′) | Product Size (bp) |
|---|---|---|---|
| TGME49_220950 | mitochondrial association factor 1 (MAF1) | F: CGGCAACCTGAACAACAACG R: CCTTGCACTGGGTACTGCTG | 162 |
| TGME49_205470 | translation elongation factor 2 family protein, putative | F: ATCATGGACCCGATCTGCAC R: TCCCTGTCGTCACCCTTGA | 100 |
| TGME49_235930 | domain K- type RNA binding proteins family protein | F: TATCCTTGGCTCTGGCGGT R: GCTGCATGACGAAACCGATG | 158 |
| TGME49_212300 | dense granule protein GRA32 | F: GGAATCGGAAGGGGCGTATT R: GCAGGGCTTGGAACTTGTTG | 72 |
| TGME49_226020 | transporter, major facilitator family protein | F: TGCTTGCGGGATATTGGCT R: TGCGAAGTAGCCTCCCATTG | 125 |
| TGME49_289690 | glyceraldehyde-3-phosphate dehydrogenase GAPDH1 | F: ATTTTGCTTGGGATTCGAGGA R: TGCAGGGTAACGATCAAAAAATG | 93 |
| TGME49_249180 | bifunctional dihydrofolate reductase-thymidylate synthase | F: CAGACTACACAGGTCAGGGC R: CACAACAAGTGACAAGGCGG | 145 |
| TGME49_316400 | alpha tubulin TUBA1 | F: GCCAAGTGTGATCCTCGTCA R: GGCTGGTAGTTGATACCGCA | 170 |
| TGME49_209030 | actin ACT1 | F: TCGGAATGGAGGAGAAGGACTGC R: AGTTCGTTGTAGAAGGTGTGATGCC | 148 |
| TGME49_247220 | udix-type motif 9 isoform a family protein | F: AATGGGAGACTTCAGGTGGC R: GCGTAACTATGAGCGGTCCA | 106 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Qiu, Y.; Bai, Y.; Wang, W.; Wang, Q.; Chen, S.; Zhang, J. Reference Gene Selection for RT-qPCR Normalization in Toxoplasma gondii Exposed to Broxaldine. Int. J. Mol. Sci. 2024, 25, 11403. https://doi.org/10.3390/ijms252111403
AMA Style
Qiu Y, Bai Y, Wang W, Wang Q, Chen S, Zhang J. Reference Gene Selection for RT-qPCR Normalization in Toxoplasma gondii Exposed to Broxaldine. International Journal of Molecular Sciences. 2024; 25(21):11403. https://doi.org/10.3390/ijms252111403
Chicago/Turabian StyleQiu, Yanhua, Yubin Bai, Weiwei Wang, Qing Wang, Shulin Chen, and Jiyu Zhang. 2024. "Reference Gene Selection for RT-qPCR Normalization in Toxoplasma gondii Exposed to Broxaldine" International Journal of Molecular Sciences 25, no. 21: 11403. https://doi.org/10.3390/ijms252111403
APA StyleQiu, Y., Bai, Y., Wang, W., Wang, Q., Chen, S., & Zhang, J. (2024). Reference Gene Selection for RT-qPCR Normalization in Toxoplasma gondii Exposed to Broxaldine. International Journal of Molecular Sciences, 25(21), 11403. https://doi.org/10.3390/ijms252111403
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
