Next Article in Journal
From Prediction to Precision: Explainable AI-Driven Insights for Targeted Treatment in Equine Colic
Previous Article in Journal
Use of Immunostimulants in Shrimp Farming—A Bioeconomic Perspective
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 15
Issue 2
10.3390/ani15020125
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Dietary γ-Aminobutyric Acid Promotes Growth and Immune System Performance and Improves Erythropoiesis and Angiogenesis in Gibel Carp (Carassius auratus gibelio)

by
Xinlan Bai
1,
Lu Zhang
2,
Hualiang Liang
1,3,
Dongyu Huang
3,
Mingchun Ren
1,3,* and
Haifeng Mi
2,*
1
Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081, China
2
Tongwei Agricultural Development Co., Ltd., Key Laboratory of Nutrition and Healthy Culture of Aquatic, Livestock and Poultry, Ministry of Agriculture and Rural Affairs, Healthy Aquaculture Key Laboratory of Sichuan Province, Chengdu 610093, China
3
Key Laboratory of Integrated Rice-Fish Farming Ecology, Ministry of Agriculture and Rural Affairs, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, China
*
Authors to whom correspondence should be addressed.
Animals 2025, 15(2), 125; https://doi.org/10.3390/ani15020125
Submission received: 25 November 2024 / Revised: 3 January 2025 / Accepted: 6 January 2025 / Published: 7 January 2025
(This article belongs to the Section Aquatic Animals)
Browse Figures
Versions Notes

Simple Summary

This study explored the effects of γ-aminobutyric acid (GABA) on growth, immunity, erythropoiesis, and angiogenesis in Gibel carp (Carassius auratus gibelio). Gibel carp were fed with five levels of GABA for a total of eight weeks. This study showed that the growth performance of Gibel carp was improved, the immune performance was enhanced, and the expression of erythropoietic and angiogenic genes was also enhanced. In conclusion, GABA had a positive effect on the growth of Gibel carp.

Abstract

This experiment aimed to investigate the effect of dietary supplementation of γ-aminobutyric acid (GABA) on the growth performance, immune response, and oxygen-transport-related factors of Gibel carp (Carassius auratus gibelio). An eight-week culturing experiment was designed with five experimental diets, with the actual GABA content being 368 mg/kg (G1, control group), 449 mg/kg (G2), 527 mg/kg (G3), 602 mg/kg (G4), and 675 mg/kg (G5). The results showed that the level of 527 mg/kg (G3) of GABA significantly increased the specific growth rate (SGR), weight gain rate (WGR), and final body weight (FBW) of Gibel carp, while the levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), total cholesterol (TC), and glucose (GLU) were also increased significantly. In addition, 527 mg/kg (G3) and 602 mg/kg (G4) of GABA significantly increased the total antioxidant capacity (T-AOC). The mRNA expression of tnf-α, tgf-β, and il-10 was significantly increased at the level of 449 mg/kg (G2). In terms of oxygen-carrying capacity, the mRNA expression of epo, tf, tfr1, ho-1, and vegf was markedly increased at the level of 449 mg/kg (G2). In conclusion, dietary GABA supplementation can boost growth performance, enhance the immune system, and increase oxygen-carrying capacity in Gibel carp.

1. Introduction

With the increasing emphasis on healthier diets, aquatic-animal-derived foods such as pelagic fish and salmon have become widely sought after due to their considerably higher nutrient content compared to cattle and sheep [1]. The increased global demand for blue food has led to greater challenges for the aquaculture industry [2]. In 2022, aquaculture accounted for 59% of global fishery production [3], with members of the Cyprinidae family being the main species produced globally, accounting for 18% of total aquatic animal production [3]. With the increasing demand, the aquaculture industry has undergone a shift from coarse to intensive farming [4], and the degree of aquaculture intensification has increased. However, this intensification has been accompanied by a greater susceptibility of fish to the occurrence and spread of disease [5]. One effective way to enhance disease resistance and improve the immunity of fish is the application of feed additives [4].
As a non-protein amino acid, γ-aminobutyric acid (GABA) is widely found in both plants and animals, being first discovered in potato tubers by Steward in 1949 [6]. GABA can promote the growth of plants and animals. In plants, GABA participates in the plant life cycle [7] and has a positive regulatory effect on plant growth and yield [8,9]. In livestock and poultry, GABA has been shown to promote the growth of broiler chickens by significantly increasing their feed intake (FI) and body weight (BW), as well as reducing their feed conversion ratio (FCR) [10]. It has also been shown to promote the growth of beef cattle [11] and pigs [12] through an increase in average daily gain (ADG) and a decrease in FCR. In aquatic animals, dietary GABA improves the growth performance of Nile tilapia (Oreochromis niloticus) [13,14] and Pacific oysters (Crassostrea gigas) [15]. Similar results have been found in pharaoh cuttlefish (Sepia pharaonis) [16], Jian carp (Cyprinus carpio var. Jian) [17], whiteleg shrimp (Litopenaeus vannamei) [18,19], juvenile olive flounder (Paralichthys olivaceus) [20], and grass carp (Ctenopharyngodon idellus) [21].
GABA is also involved in the immune system regulation of both plants and animals. GABA helps plants to cope with environmental stresses and effectively increases their antioxidant properties [22,23]. In livestock and poultry, the addition of exogenous GABA alleviated the stress of broiler chickens caused by high-density farming [24] and attenuated the oxidative stress and inflammatory response induced by dexamethasone (DEX) [10]. Similarly, GABA decreased the expression of pro-inflammatory factors and increased the activity of antioxidant enzymes in pigs [25]. In aquatic animals, GABA has been shown to serve an essential function within the immune system of sticklebacks (Gasterosteus aculeatus) [26]. GABA also enhances the immune response and antioxidant status of Nile tilapia [13,14] and maintains immune homeostasis, while inhibiting phagocytosis and the apoptosis of immune cells in Pacific oysters [15]. The dietary addition of GABA has been demonstrated to mitigate oxidative stress in pharaoh cuttlefish [16]. Furthermore, dietary GABA has been shown to lessen tissue damage and attenuate inflammatory responses in largemouth bass (Micropterus salmoides), thereby enhancing its antioxidant capacity [27]. Additionally, dietary GABA serves to modulate the inflammatory response of Chinese mitten crabs (Eriocheir sinensis) by diminishing detrimental metabolites [28]. GABA also helps organisms to increase their oxygen-carrying capacity [29,30,31,32]. Studies have shown that GABA is inextricably linked to the generation of vascular networks [33,34] and also has direct vasodilatory effects [35]. For example, with the help of GABA, mrigal carp (Cirrhinus mrigala) [29] and crucian carp (Carassius carassius) [36] increased their oxygen-carrying capacity through vasodilation. However, current research on GABA mainly focuses on immunity and antioxidant aspects [13,21,37], with less research on its effects on oxygen-carrying capacity. Therefore, it is urgently required to carry out relevant research to investigate the impact of GABA supplementation on the oxygen-carrying capacity of Gibel carp, while also exploring its role in the growth and immunity of Gibel carp.
Plasma status is closely linked to the health of fish. Plasma biochemical indicators, such as alanine aminotransferase (ALT) and aspartate aminotransferase (AST), are released into the plasma when liver tissue is damaged and are considered liver injury markers [38]. However, they also play a role in nutrient metabolism [39]. In fish, superoxide dismutase (SOD) and catalase (CAT) are considered the main antioxidant enzymes [40]. The level of malondialdehyde (MDA) is an indicator of the degree of oxidative stress damage. And increased MDA levels can cause cell damage and produce biological toxicity [41]. Total antioxidant capacity (T-AOC) serves as an index to assess all antioxidant capabilities, including enzymatic and nonenzymatic antioxidant activities [42]. Hypoxia-inducible transcription factor 1 (HIF-1) is one of the most important regulatory factors in the body’s response to hypoxia; it maintains the normal function of cells by regulating metabolism and blood vessels in hypoxic environments [43]. It regulates erythropoiesis and angiogenesis by controlling downstream target genes, thereby helping the body to enhance its oxygen-carrying capacity.
Gibel carp (Carassius auratus), an important economic fish species in China, accounts for about 10% of freshwater fishery resources [44]. However, environmental stresses such as global weather changes [45,46], intensive aquaculture [4], and drug abuse [47,48], which lead to growth inhibition, have been shown to reduce immunity and affect the respiratory system and oxygen-carrying capacity in Gibel carp [49]. These stresses result in major economic losses. In addition, with the shift to intensive farming, Gibel carp subjected to the consequent stressful conditions have reduced organismal immunity. As such, these fish are more likely to die when afflicted by disease, which results in yield loss [4]. Although the important functions of GABA [50] and its precursors glutamate [51,52] and glutamine [53,54,55] within animal immune systems are well known, they have been relatively little studied in Gibel carp. Therefore, this study aimed to investigate the effect of adding dietary GABA on the growth, antioxidant properties, immune response, and oxygen-carrying capacity of Gibel carp.

2. Materials and Methods

2.1. Diet Preparation

This study divided fish into five groups. The feed formula is listed in Table 1. The formulations had the same ingredients except for the different GABA contents. The first to fifth groups corresponded to the additional GABA levels of 0 mg/kg (G1, control group), 90 mg/kg (G2), 180 mg/kg (G3), 270 mg/kg (G4), and 360 mg/kg (G5), respectively. The composition of the GABA content in each experimental diet was evaluated and analyzed using high-performance liquid chromatography (HPLC, Sykam, Free State of Bavaria, Eresing, Germany) following the procedure of Lee et al. [56]. The measured value of each group was 368 mg/kg (G1), 449 mg/kg (G2), 527 mg/kg (G3), 602 mg/kg (G4), and 675 mg/kg (G5), respectively. The ingredients were mixed with the help of water and oil according to Table 1 and were pelletized on a feeder (F-26(II), South China University of Technology, Guangzhou, China). After drying the feed, we placed them in proper self-sealing bags and then stored them at −20 °C for later use.

2.2. Experimental Management

The current study was conducted at the Wuxi Fisheries College of Nanjing Agricultural University (Wuxi, China). To achieve domestication prior to experimentation, Gibel carp were staged in net cages (1 m × 1 m × 1 m) for 14 days. With three repetitions in each group, three hundred fish with a mean weight of 41.87 ± 0.04 g were taken and randomly divided into 15 floating cages (1 m × 1 m × 1 m) and kept for eight weeks. Throughout the farming process, Gibel carp were fed to satiation until they stopped swimming to the surface to feed, with feedings conducted at 8 a.m. and 4 p.m. The temperature range was 30 ± 2 °C, the dissolved oxygen level was kept above 6.0 mg/L, the pH level was within 7.0 to 7.8, and total ammonia nitrogen was below 0.1 mg/L throughout the feeding process.

2.3. Sample Collection

Samples were collected after a 24 h fasting period at the end of the 8-week aquaculture experiment. All Gibel carp were weighed for each cage. With the use of MS-222 (100 mg/L), nine fish from each group (three fish from each replicate) were selected randomly after anesthesia, and blood was collected, with the plasma being obtained via centrifugation (3500× g, 10 min, 4 °C). These fish were then harvested for intestinal tissue to analyze the intestinal antioxidant indices. Finally, two fish from each cage, selected according to the principle of randomness, were stored at −20 °C for the determination of whole body composition. All samples were stored in a freezer at −80 °C for further analysis.

2.4. Chemical Analysis

Using the method of AOAC (2003) [57], the crude protein, ash, and crude lipid content of the feed and whole body composition were measured. In brief, we first placed the sample in a glass container and dried it in an oven at 105 °C to obtain the moisture content. Then, we crushed the sample into a powder and stored it in a self-sealing bag for subsequent use. We measured the crude protein content of the dried sample with a Haineng K1100 instrument (Jinan Haineng Instrument Co., Ltd., Jinan, China) using the Kjeldahl method. We analyzed the crude lipid content of the powdered sample using the Soxhlet extraction method on an automatic analyzer (Haineng SOX606, Jinan Haineng Instrument Co., Ltd., Jinan, China) and obtained the ash data by calcining the sample in a muffle furnace (XL-2A, Hangzhou Zhuochi Instrument Co., Ltd., Hangzhou, China) at 560 °C for 6 h. The indices of plasma biochemical analysis were evaluated using a Mindray BS-400 analyzer (Shenzhen, China), a method also mentioned in our previous studies [39]. Indices were measured using the machine and corresponding Mindray kits in accordance with the manufacturer’s protocols. The detection indices were as follows: alanine aminotransferase (ALT), albumin (ALB), aspartate aminotransferase (AST), total cholesterol (TC), total protein (TP), triglycerides (TG), and glucose (GLU).
Indicators of intestinal antioxidant capacity, such as SOD and CAT, and the contents of nonenzymes, such as MDA and T-AOC, were measured using commercial kits from Nanjing Jiancheng Bioengineering Institute (Nanjing, China), following the instructions provided in the reagent manuals. See our previous study for specific methods [58].

2.5. Gene Expression Analysis

The primers used are listed in Table 2. Through the use of RNA extraction reagents (Vazyme, Nanjing, China), RNA was extracted from the liver tissue of the Gibel carp. We then quantified RNA. A PCR system was activated and operated as per the predetermined settings. The procedure for a One-Step SYBR Prime Script TM PLUS RT-PCR kit (Takara, Dalian, China) is as follows: reverse transcription for 5 min at 42 °C, pre-denaturation for 10 s at 95 °C, and then denaturation at 95 °C for 5 s and 60 °C for 30 s, 40 cycles. Stable β-actin was used as a nonregulated reference gene, as previously used in a Gibel carp study [58], and no significant changes were found in this study or the previous one. The mRNA levels were calculated based on the standard curve method [59].

2.6. Data Analysis

The data were subjected to normality and homogeneity tests. Using SPSS (22.0), data were analyzed via one-way ANOVA and Tukey’s test for pairwise comparison (p < 0.05). The statistics are shown as the mean ± standard error.

3. Results

3.1. Growth Performance

Table 3 indicates the growth performance of the Gibel carp. As shown in the table, the level of 527 mg/kg (G3) of GABA significantly increased the specific growth rate (SGR), weight gain rate (WGR), and final body weight (FBW) (p < 0.05) of the fish compared to the control group. It also helped to reduce the FCR (p > 0.05). However, the FCR was increased by the level of 675 mg/kg (G5) (p > 0.05).

3.2. Whole Body Composition

Table 4 indicates the body composition of the Gibel carp. Regarding the four indices, no significant difference between each component and the control group was found (p > 0.05). The crude lipid content was elevated by the level of 602 mg/kg (G4) of GABA, but there was no significant difference compared with the control group (p > 0.05).

3.3. Plasma Biochemistry

Table 5 shows the plasma biochemistry results. When GABA was added at a level of 602 mg/kg (G4), the levels of ALB, TP, and TG were significantly reduced compared to the control group (p < 0.05). When GABA was added at a level of 527 mg/kg (G3), the levels of AST, ALT, TC, and GLU were increased significantly compared to the control group (p < 0.05). When the GABA level was 602 mg/kg (G4), the level of TC decreased significantly compared to the control group (p < 0.05).

3.4. Plasma Enzymatic Indices

Table 6 presents the plasma antioxidant indices. It can be seen that the contents of T-AOC were significantly increased at the levels of 527 mg/kg(G3) and 602 mg/kg (G4) mg/kg (p < 0.05). For SOD, CAT, and MDA, there was no significant difference between each group and the control group (p > 0.05). However, SOD and CAT had better vitality at the level of 449 mg/kg (G2) (p > 0.05). At the level of 675 mg/kg (G5), the level of MDA showed the lowest value (p > 0.05).

3.5. Nrf2 Signaling Pathway

The gene expression of Nrf2 signaling pathway-related factors is shown in Figure 1. As Figure 1B shows, sod was significantly increased with the GABA level of 449 mg/kg (G2) (p < 0.05). However, as shown in Figure 1A,C,D, nrf2, cat, and gpx did not significantly differ from the control group (p > 0.05).

3.6. Liver Inflammatory Factor Genes

Figure 2 illustrates the expression levels of pro-inflammatory factors. There was no significant difference between the additive and control group in the expression of il-1β, as shown in Figure 2A (p > 0.05). As Figure 2B shows, the mRNA expression of tnf-α was increased significantly at 449 mg/kg (G2) of GABA (p < 0.05). As shown in Figure 2C,D, tgf-β and il-10 were significantly increased at the level of 449 mg/kg (G2) (p < 0.05).

3.7. Genes Related to Vascular Regeneration and Iron Metabolism

In Figure 3C–F, it can be seen that the expression of et1, vegf, angpt1, and ho-1 peaked at the level of 449 mg/kg (G2) (p < 0.05). Ho-1 and vegf were increased significantly at this level (p < 0.05). As shown in Figure 3B, the expression of nos was significantly decreased at 449 mg/kg (G2) of GABA (p < 0.05). As shown in Figure 3A, the expression of hif-1 in each group showed no significant difference compared to the control group (p > 0.05). The expression of genes related to iron metabolism in fish can be seen in Figure 4. As shown in Figure 4A–C, epo, tf, and tfr1 were all significantly increased at the level of 449 mg/kg (G2) of GABA, and the gene expression peaked at this level (p < 0.05).

4. Discussion

In this study, it was found that the level of 527 mg/kg (G3) of GABA significantly improved the growth performance of Gibel carp to a certain extent. However, excess GABA did not promote the growth of Gibel carp but rather inhibited it. Similar results were found in whiteleg shrimp [18,19], where dietary supplementation with GABA promoted growth to a certain extent, but the growth performance did not consistently improve with an increase in the added amounts. Similarly, a moderate supplementation of dietary GABA also enhanced the growth performance of the Chinese mitten crab [55]. As such, the addition of GABA did not show a dose/effect response, which indicates that there was a suitable range of GABA addition, and excessive GABA supplementation might reduce growth performance. This is most likely caused by excessive GABA affecting the Ca2+ levels in Gibel carp pituitary cells, leading to an inhibition of the release of growth hormones [56]. In this study, GABA was effective in promoting the growth of Gibel carp when added at 527 mg/kg (G3). Interestingly, according to the quadratic regression analysis of FE, the optimal level of GABA in pharaoh cuttlefish [16] and Jian carp [17] was 55.3 and 96.75 mg/kg, respectively, perhaps due to the differences in species and size. This finding also favors GABA as a dietary additive in fish feeds. In relation to whole fish body composition, the addition of GABA increased the crude protein content of Gibel carp to some extent; however, the difference was not significant. Similar outcomes were found in grass carp [21] and whiteleg shrimp [18]. For glutamine, the precursor of GABA had a significant effect on the crude protein content of gilthead seabream (Sparus aurata) [57] and Jian carp [61]. The enhancement of protein retention in fish bodies may be due to the added dietary GABA being broken down after ingestion by the organism, thereby improving the nutritional metabolism of the Gibel carp liver. This might also explain the level of crude protein content of Gibel carp in this study.
The central and integrative role of plasma in fish physiology means that plasma status can generally reflect fish health [18,62,63]. In the present study, the level of 527 mg/kg (G3) GABA significantly increased levels of AST, ALT, and TC. The addition of GABA also increased the level of AST and ALT in crucian carp (Carassius carassius) [37]. By contrast, higher doses of GABA significantly reduced the viability of ALT and AST in Chinese mitten crab larvae [64]. ALT and AST were also involved in nutrient metabolism [39]. Thus, it can be concluded that the elevation of ALT and AST levels in this study was due to the vigorous nutrient metabolism in the fish rather than tissue injury. A similar conclusion was found in largemouth bass [65]. The significantly higher GLU of all the groups that added different levels of GABA also supports this view at some levels. In addition, TP and TG showed a fluctuating trend with an initial rise followed by a decline, with a significant decrease at 602 mg/kg (G4), which is further evidence of vigorous metabolism. This has also been observed in largemouth bass [65].
As an intermediate product of oxygen metabolism, excessive ROS leads to oxidative stress in the organism [66]. In response to oxidative stress, antioxidant-related molecules such as SOD and CAT come into effect [67]. In previous studies, the antioxidant capacity of grass carp was enhanced by the addition of both glutamate—a precursor of GABA [68]—and dietary amino butyric acid [21]. Similar results were found not only in grass carp but also in whiteleg shrimp [19], Chinese mitten crab [64], and even in mammals [69]. However, in this study, the levels of MDA, as well as the activities of CAT and SOD, did not show a significant correlation with the level of GABA addition. This difference might be due to the different species, specification sizes, and the culture environment. Similar to this study, feeding GABA did not significantly alter the SOD of olive flounder [70]. However, it was found that T-AOC showed a significant enhancement in this study at GABA additions of 527 mg/kg (G3) and 602 mg/kg (G4). Similarly, by enhancing T-AOC activity, GABA also significantly improved the antioxidant capacity in turbot (Scophthalmus maximus L.) [71] and growing minks (Neovison vison) [72]. In addition, the GABA level of 449 mg/kg (G2) upregulated the mRNA expression of nrf2, which, in turn, increased the expression of downstream cat, sod, and gpx, as well as ho-1-related genes. Among them, sod and ho-1 were also significantly increased at the level of 449 mg/kg (G2), which indicated that GABA has the ability to mobilize antioxidant enzymes to assist the Gibel carp in resisting oxidative stress. This is why sod increased significantly, whereas SOD did not, suggesting that it is likely that transcriptional regulation of genes alters the process of gene expression [73]. Accordingly, a certain amount of GABA might help the organism alleviate the damage caused by oxidative stress and improve the activity of antioxidant enzymes in coping with oxidative stress.
Inflammation is a self-defense response when an organism is subjected to internal or external stimuli. Studies have demonstrated that GABA lowers the generation of inflammatory cytokines through the activation of specific receptors [74,75]. Tnf-α is a key driver of immune responses [76], but in fish, tnf-α exhibits the complexity of cytokine-regulated immunity [77]. Tnf-α acts as an activator and mediator of phagocytosis in rainbow trout (Oncorhynchus mykiss) [78] and goldfish (Carassius auratus L.) macrophages [79], which suggests that pro-inflammatory factors also contribute substantially to the body’s fight against infection. In the context of this study, tnf-α was significantly increased at the level of 449 mg/kg (G2). Moreover, tnf-α can enhance the resistance to infection by increasing the killing power of macrophages and stimulating the immune system. The results of this experiment revealed that the level of GABA did not significantly affect the mRNA expression of il-1β. Meanwhile, the mRNA expressions of il-10 and tgf-β, as factors playing a role in fighting inflammation, demonstrated a similar trend to the mRNA expression of tnf-α, with significantly higher expression at the level of 449 mg/kg (G2). The mRNA expression of il-10 and tgf-β has been shown to serve a regulatory function in fish immunity [80,81]. Dietary GABA enhanced immunity in Jian carp by significantly increasing the mRNA expression of il-10 [17], and GABA-induced elevation expression of tnf-α and tgf-β was also present in Nile tilapia [82], which is similar to our experimental results. The significant increase in its expression at this dosage occurred because the levels of 449 mg/kg (G2) made Gibel carp more sensitive to infection and made it easier for them to mobilize the body to respond to the stimulus. However, it did not cause tissue damage. Hence, the significant increase in tnf-α at 449 mg/kg (G2) might play a role in stimulating the immune system, which in turn mobilizes factors tgf-β and il-10 to respond positively against the impending inflammation, thus improving the body’s resistance to infection and immunity.
There are many ways for an organism to improve its oxygen-carrying capacity [83]. In a previous study, exogenous GABA supplementation increased the oxygen-carrying capacity of mrigal carp and contributed to a reduction in the upregulation of hif-1 [29], which mirrors the results of the present study. Downstream hif-1α, et1, vegf, angpt1, epo, tf, and tfr1 factors showed the same trend as hif-1α, except nos. The elevated mRNA expression of angpt1 and the significant increase in mRNA of vegf when GABA was added at the level of 449 mg/kg (G2) also indicated the promotional effect of GABA on the angiogenesis of Gibel carp. Similar conclusions could also be drawn in relation to mice [84]. In terms of vascular tone, the mRNA expression of et1 showed an opposite trend to the mRNA expression of nos. The level of 449 mg/kg (G2) of GABA promoted the mRNA expression of et1 and increased the vascular tone of Gibel carp, whereas the mRNA expression of nos was significantly reduced at the level of 449 mg/kg (G2). Unlike endothelial GABA [85], exogenous GABA showed a tendency to inhibit the mRNA expression of nos, which might be due to the inhibition by tgf-β [86]. In addition, the level of 449 mg/kg (G2) of GABA significantly promoted the mRNA expression of epo, tf, and tfr1. This also indicated that GABA can promote the production of erythrocytes, iron transport proteins, and their receptors in Gibel carp, as well as improve the oxygen-carrying capacity of the organism.

5. Conclusions

Our experimental results suggest that 527 mg/kg (G3) of GABA can significantly improve the growth performance and metabolism of Gibel carp and that 449 mg/kg (G2) of GABA can enhance immunity by modulating inflammatory factors and achieve optimal levels of iron metabolism and angiogenesis factors. In summary, our research indicates that the optimal amount of GABA to promote the growth of Gibel carp is 527 mg/kg (G3), and the optimal amount to enhance the immunity and oxygen-carrying capacity of Gibel carp is 449 mg/kg (G2). This study provides basic guidelines for the practical application of GABA supplementation and feeding strategies.

Author Contributions

Conceptualization, L.Z. and D.H.; methodology, L.Z.; formal analysis, X.B.; investigation, X.B.; resources, H.L.; data curation, M.R., H.M. and L.Z.; writing—original draft preparation, X.B.; writing—review and editing, M.R., H.M. and L.Z.; project administration, D.H. All authors have read and agreed to the published version of the manuscript.

Funding

This study was financially supported by the National Key R&D Program of China (2023YFD2400601), the earmarked fund for CARS (CARS-46), the National Natural Science Foundation of China (32102806).

Institutional Review Board Statement

This study was approved by the Laboratory Animal Ethics Committee of the Freshwater Fisheries Research Center (LAECFFRC-2023-03-03).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

Lu Zhang and Haifeng Mi are employed by Tongwei Agricultural Development Co., Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships. Lu Zhang and Haifeng Mi made important contributions to the experimental technique.

References

  1. Golden, C.D.; Koehn, J.Z.; Shepon, A.; Passarelli, S.; Free, C.M.; Viana, D.F.; Matthey, H.; Eurich, J.G.; Gephart, J.A.; Fluet-Chouinard, E.; et al. Aquatic Foods to Nourish Nations. Nature 2021, 598, 315–320. [Google Scholar] [CrossRef] [PubMed]
  2. Naylor, R.L.; Kishore, A.; Sumaila, U.R.; Issifu, I.; Hunter, B.P.; Belton, B.; Bush, S.R.; Cao, L.; Gelcich, S.; Gephart, J.A.; et al. Blue Food Demand across Geographic and Temporal Scales. Nat. Commun. 2021, 12, 5413. [Google Scholar] [CrossRef] [PubMed]
  3. FAO. Blue Transformation in Action. In Brief to the State of World Fisheries and Aquaculture; FAO: Rome, Italy, 2024. [Google Scholar]
  4. Dawood, M.A.O.; Koshio, S. Recent Advances in the Role of Probiotics and Prebiotics in Carp Aquaculture: A Review. Aquaculture 2016, 454, 243–251. [Google Scholar] [CrossRef]
  5. Chen, Y.; Zhu, X.; Yang, Y.; Han, D.; Jin, J.; Xie, S. Effect of Dietary Chitosan on Growth Performance, Haematology, Immune Response, Intestine Morphology, Intestine Microbiota and Disease Resistance in Gibel Carp (Carassius auratus gibelio). Aquac. Nutr. 2014, 20, 532–546. [Google Scholar] [CrossRef]
  6. Steward, F.C. γ-Aminobutyric Acid: A Constituent of Potato Tubers? Science 1949, 110, 439–440. [Google Scholar]
  7. Michaeli, S.; Fromm, H. Closing the Loop on the GABA Shunt in Plants: Are GABA Metabolism and Signaling Entwined? Front. Plant Sci. 2015, 6, 419. [Google Scholar] [CrossRef] [PubMed]
  8. Ali, M.M.; Ashrafuzzaman, M.; Ismail, M.R.; Shahidullah, S.M.; Prodhan, A. Influence of Foliar Applied GABA on Growth and Yield Contributing Characters of White Gourd (Benincasa Hispida). Int. J. Agric. Biol. 2010, 12, 373–376. [Google Scholar]
  9. Ashrafuzzaman, M.; Ismail, M.R.; Fazal, K.A.I.; Uddin, M.K.; Prodhan, A. Effect of GABA Application on the Growth and Yield of Bitter Gourd (Momordica charantia). Int. J. Agric. Biol. 2010, 12, 129–132. [Google Scholar]
  10. Fathi, M.; Saeedyan, S.; Kaoosi, M. Gamma-Amino Butyric Acid (GABA) Supplementation Alleviates Dexamethasone Treatment-Induced Oxidative Stress and Inflammation Response in Broiler Chickens. Stress 2023, 26, 2185861. [Google Scholar] [CrossRef]
  11. Guo, K.; Cao, H.; Zhu, Y.; Wang, T.; Hu, G.; Kornmatitsuk, B.; Luo, J. Improving Effects of Dietary Rumen Protected Γ-aminobutyric Acid Additive on Apparent Nutrient Digestibility, Growth Performance and Health Status in Heat-stressed Beef Cattle. Anim. Sci. J. 2018, 89, 1280–1286. [Google Scholar] [CrossRef] [PubMed]
  12. Bi, C.; Yin, J.; Yang, W.; Shi, B.; Shan, A. Effects of Dietary Γ-aminobutyric Acid Supplementation on Antioxidant Status, Blood Hormones and Meat Quality in Grow-ing-finishing Pigs Undergoing Transport Stress. J. Anim. Physiol. Anim. Nutr. 2020, 104, 590–596. [Google Scholar] [CrossRef] [PubMed]
  13. Ruenkoed, S.; Nontasan, S.; Phudkliang, J.; Phudinsai, P.; Pongtanalert, P.; Panprommin, D.; Mongkolwit, K.; Wangkahart, E. Effect of Dietary Gamma Aminobutyric Acid (GABA) Modulated the Growth Performance, Immune and Antioxidant Capac-ity, Digestive Enzymes, Intestinal Histology and Gene Expression of Nile Tilapia (Oreochromis niloticus). Fish Shellfish. Immunol. 2023, 141, 109056. [Google Scholar] [CrossRef] [PubMed]
  14. Temu, V.; Kim, H.; Hamidoghli, A.; Park, M.; Won, S.; Oh, M.; Han, J.-K.; Bai, S.C. Effects of Dietary Gamma-Aminobutyric Acid in Juvenile Nile Tilapia, Orechromis niloticus. Aquaculture 2019, 507, 475–480. [Google Scholar] [CrossRef]
  15. Li, M.; Qiu, L.; Wang, L.; Wang, W.; Xin, L.; Li, Y.; Liu, Z.; Song, L. The Inhibitory Role of γ-Aminobutyric Acid (GABA) on Immunomodulation of Pacific Oyster Crassostrea Gigas. Fish Shellfish. Immunol. 2016, 52, 16–22. [Google Scholar] [CrossRef] [PubMed]
  16. Li, J.; Jiang, M.; Han, Q.; Peng, R.; Jiang, X. Effects of Γ-aminobutyric Acid Supplementation on the Growth Performance, Serum Biochemical Indices and Antioxidant Status of Pharaoh Cuttlefish, Sepia Pharaonis. Aquac. Nutr. 2020, 26, 1026–1034. [Google Scholar] [CrossRef]
  17. Chen, X.; Gao, C.; Du, X.; Xu, H.; Wang, G.; Zhang, D. Effects of Dietary Γ-aminobutyric Acid Levels on the Growth, Serum Biochemical Indexes, Immune-related Signalling Mole-cules of Jian Carp. Aquac. Res. 2021, 52, 1096–1105. [Google Scholar] [CrossRef]
  18. Bae, J.; Hamidoghli, A.; Farris, N.W.; Olowe, O.S.; Choi, W.; Lee, S.; Won, S.; Ohh, M.; Lee, S.; Bai, S.C. Dietary γ-Aminobutyric Acid (GABA) Promotes Growth and Resistance to Vibrio Alginolyticus in Whiteleg Shrimp Li-topenaeus Vannamei. Aquac. Nutr. 2022, 2022, 9105068. [Google Scholar] [CrossRef]
  19. Xie, S.-W.; Li, Y.-T.; Zhou, W.-W.; Tian, L.-X.; Li, Y.-M.; Zeng, S.-L.; Liu, Y.-J. Effect of Γ-aminobutyric Acid Supplementation on Growth Performance, Endocrine Hormone and Stress Tolerance of Juve-nile Pacific White Shrimp, Litopenaeus Vannamei, Fed Low Fishmeal Diet. Aquac. Nutr. 2017, 23, 54–62. [Google Scholar] [CrossRef]
  20. Lee, S.; Moniruzzaman, M.; Farris, N.; Min, T.; Bai, S.C. Interactive Effect of Dietary Gamma-Aminobutyric Acid (GABA) and Water Temperature on Growth Performance, Blood Plasma Indices, Heat Shock Proteins and GABAergic Gene Expression in Juvenile Olive Flounder Paralichthys Olivaceus. Metabolites 2023, 13, 619. [Google Scholar] [CrossRef]
  21. Wu, F.; Liu, M.; Chen, C.; Chen, J.; Tan, Q. Effects of Dietary Gamma Aminobutyric Acid on Growth Performance, Antioxidant Status, and Feeding-related Gene Ex-pression of Juvenile Grass Carp, Ctenopharyngodon Idellus. J. World Aquac. Soc. 2016, 47, 820–829. [Google Scholar] [CrossRef]
  22. Shelp, B.J.; Aghdam, M.S.; Flaherty, E.J. γ-Aminobutyrate (GABA) regulated plant defense: Mechanisms and opportunities. Plants 2021, 10, 1939. [Google Scholar] [CrossRef] [PubMed]
  23. Cao, Z.; Chen, H.; Zhou, C.; Gong, M.; Li, Y.; Shao, Y.; Wu, Y.; Bao, D. Exogenous γ-Aminobutyric Acid (GABA) Enhanced Response to Abiotic Stress in Hypsizygus Marmoreus by Improving My-celial Growth and Antioxidant Capacity. Metabolites 2024, 14, 94. [Google Scholar] [CrossRef] [PubMed]
  24. Jeong, S.-B.; Kim, Y.B.; Lee, J.-W.; Kim, D.-H.; Moon, B.-H.; Chang, H.-H.; Choi, Y.-H.; Lee, K.-W. Role of Dietary Gamma-Aminobutyric Acid in Broiler Chickens Raised under High Stocking Density. Anim. Nutr. 2020, 6, 293–304. [Google Scholar] [CrossRef] [PubMed]
  25. Zhang, S.; Zhao, J.; Hu, J.; He, H.; Wei, Y.; Ji, L.; Ma, X. Gama-Aminobutyric Acid (GABA) Alleviates Hepatic Inflammation via GABA Receptors/TLR4/NF-κB Pathways in Grow-ing-Finishing Pigs Generated by Super-Multiparous Sows. Anim. Nutr. 2022, 9, 280–290. [Google Scholar] [CrossRef] [PubMed]
  26. Kutyrev, I.A.; Franke, F.; Kurtz, J.; Scharsack, J.P. In Vitro Effects of the Neuroactive Substances Serotonin and γ-Aminobutyric Acid on Leucocytes from Sticklebacks (Gas-terosteus aculeatus). Fish Shellfish. Immunol. 2019, 87, 286–296. [Google Scholar] [CrossRef] [PubMed]
  27. Wang, Z.; Zhou, Q.; Tu, J.; Wang, Y.; Song, R.; Chu, Z.; Li, S.; Li, J.; Zhang, H.; Zhang, M. Ameliorative Effect of Gamma-Aminobutyric Acid on the Antioxidant Status and Ammonia Stress Resistance of Micropterus Salmoides. Aquac. Rep. 2023, 32, 101734. [Google Scholar] [CrossRef]
  28. Zhang, C.; Liu, J.; Wang, X.; Li, E.; Song, M.; Yang, Y.; Qin, C.; Qin, J.; Chen, L. Comprehensive Transcriptional and Metabolomic Analysis Reveals the Neuroprotective Mechanism of Dietary Gamma-Aminobutyric Acid Response to Hypoxic Stress in the Chinese Mitten Crab (Eriocheir sinensis). Fish Shellfish. Immunol. 2023, 135, 108663. [Google Scholar] [CrossRef] [PubMed]
  29. Varghese, T.; Kumar, R.V.J.; Anand, G.; Dasgupta, S.; Pal, A.K. Dietary GABA Enhances Hypoxia Tolerance of a Bottom-Dwelling Carp, Cirrhinus Mrigala by Modulating HIF-1α, Thyroid Hormones and Metabolic Responses. Fish Physiol. Biochem. 2020, 46, 199–212. [Google Scholar] [CrossRef] [PubMed]
  30. Salvatierra, A.; Pimentel, P.; Almada, R.; Hinrichsen, P. Exogenous GABA Application Transiently Improves the Tolerance to Root Hypoxia on a Sensitive Genotype of Prunus Root-stock. Environ. Exp. Bot. 2016, 125, 52–66. [Google Scholar] [CrossRef]
  31. Lü, G.; Liang, Y.; Wu, X.; Li, J.; Ma, W.; Zhang, Y.; Gao, H. Molecular Cloning and Functional Characterization of Mitochondrial Malate Dehydrogenase (mMDH) Is Involved in Exoge-nous GABA Increasing Root Hypoxia Tolerance in Muskmelon Plants. Sci. Hortic. 2019, 258, 108741. [Google Scholar] [CrossRef]
  32. Zhang, C.; He, J.; Wang, X.; Yang, Y.; Huang, Q.; Qiao, F.; Shi, Q.; Qin, J.; Chen, L. Gamma-Aminobutyric Acid Enhances Hypoxia Tolerance of Juvenile Chinese Mitten Crab (Eriocheir sinensis) by Regulating Respiratory Metabolism and Alleviating Neural Excitotoxicity. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2022, 260, 109409. [Google Scholar] [CrossRef] [PubMed]
  33. Won, C.; Lin, Z.; Kumar T, P.; Li, S.; Ding, L.; Elkhal, A.; Szabó, G.; Vasudevan, A. Autonomous Vascular Networks Synchronize GABA Neuron Migration in the Embryonic Forebrain. Nat. Commun. 2013, 4, 2149. [Google Scholar] [CrossRef] [PubMed]
  34. Li, S.; Kumar T, P.; Joshee, S.; Kirschstein, T.; Subburaju, S.; Khalili, J.S.; Kloepper, J.; Du, C.; Elkhal, A.; Szabó, G. Endothelial Cell-Derived GABA Signaling Modulates Neuronal Migration and Postnatal Behavior. Cell Res. 2018, 28, 221–248. [Google Scholar] [CrossRef] [PubMed]
  35. Kocharyan, A.; Fernandes, P.; Tong, X.-K.; Vaucher, E.; Hamel, E. Specific Subtypes of Cortical GABA Interneurons Contribute to the Neurovascular Coupling Response to Basal Forebrain Stimulation. J. Cereb. Blood Flow Metab. 2008, 28, 221–231. [Google Scholar] [CrossRef] [PubMed]
  36. Nilsson, G.E.; Renshaw, G.M. Hypoxic Survival Strategies in Two Fishes: Extreme Anoxia Tolerance in the North European Crucian Carp and Natural Hypoxic Preconditioning in a Coral-Reef Shark. J. Exp. Biol. 2004, 207, 3131–3139. [Google Scholar] [CrossRef] [PubMed]
  37. Yan, Z.; Liu, B.; Liu, J.; Guo, Z.; Kou, Y.; Lu, W.; Sun, J.; Li, Y. Enhancing Resilience to Chronic Ammonia Stress in Crucian Carp (Carassius carassius) through Dietary Gamma-Aminobutyric Acid (GABA) Supplementation: Effects on Growth Performance, Immune Function, Hepatotoxicity, and Apoptosis. Aquac. Rep. 2024, 37, 102259. [Google Scholar] [CrossRef]
  38. Wang, K.; Zhang, L.; Liang, H.; Ren, M.; Mi, H.; Huang, D.; Gu, J. Effects of Dietary Ferroporphyrin Supplementation on Growth Performance, Antioxidant Capacity, Immune Response, and Oxygen-Carrying Capacity in Gibel Carp (Carassius auratus gibelio). Animals 2024, 14, 3104. [Google Scholar] [CrossRef]
  39. Yi, C.; Liang, H.; Huang, D.; Yu, H.; Xue, C.; Gu, J.; Chen, X.; Wang, Y.; Ren, M.; Zhang, L. Phenylalanine Plays Important Roles in Regulating the Capacity of Intestinal Immunity, Antioxidants and Apoptosis in Largemouth Bass (Micropterus salmoides). Animals 2023, 13, 2980. [Google Scholar] [CrossRef] [PubMed]
  40. Kohen, R.; Nyska, A. Invited Review: Oxidation of Biological Systems: Oxidative Stress Phenomena, Antioxidants, Redox Reactions, and Methods for Their Quantification. Toxicol. Pathol. 2002, 30, 620–650. [Google Scholar] [CrossRef] [PubMed]
  41. Parvez, S.; Raisuddin, S. Protein Carbonyls: Novel Biomarkers of Exposure to Oxidative Stress-Inducing Pesticides in Freshwater Fish Channa punctata (Bloch). Environ. Toxicol. Pharmacol. 2005, 20, 112–117. [Google Scholar] [CrossRef]
  42. Kusano, C.; Ferrari, B. Total Antioxidant Capacity: A Biomarker in Biomedical and Nutritional Studies. J. Cell Mol. Biol. 2008, 7, 1–15. [Google Scholar]
  43. Ryan, H.E.; Lo, J.; Johnson, R.S. HIF-1α Is Required for Solid Tumor Formation and Embryonic Vascularization. EMBO J. 1998, 17, 3005–3015. [Google Scholar] [CrossRef] [PubMed]
  44. Li, Z.; Wang, Z.-W.; Wang, Y.; Gui, J.-F. Crucian carp and gibel carp culture. In Aquaculture in China: Success Stories and Modern Trends; John Wiley & Sons: Hoboken, NJ, USA, 2018; pp. 149–157. [Google Scholar] [CrossRef]
  45. Nadermann, N.; Seward, R.K.; Volkoff, H. Effects of Potential Climate Change-Induced Environmental Modifications on Food Intake and the Expression of Appetite Regulators in Goldfish. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2019, 235, 138–147. [Google Scholar] [CrossRef] [PubMed]
  46. Jacquin, L.; Gandar, A.; Aguirre-Smith, M.; Perrault, A.; Le Hénaff, M.; De Jong, L.; Paris-Palacios, S.; Laffaille, P.; Jean, S. High Temperature Aggravates the Effects of Pesticides in Goldfish. Ecotoxicol. Environ. Saf. 2019, 172, 255–264. [Google Scholar] [CrossRef]
  47. Zhang, M.; Cai, Z.; Zhang, G.; Zhang, Y.; Xue, N.; Zhang, D.; Pan, X. Effectively Reducing Antibiotic Contamination and Resistance in Fishery by Efficient Gastrointestine-Blood Delivering Dietary Millispheres. J. Hazard. Mater. 2021, 409, 125012. [Google Scholar] [CrossRef] [PubMed]
  48. Wang, C.; Lu, G.; Cui, J. Responses of AChE and GST Activities to Insecticide Coexposure in Carassius auratus. Environ. Toxicol. 2012, 27, 50–57. [Google Scholar] [CrossRef] [PubMed]
  49. Sollid, J.; Weber, R.E.; Nilsson, G.E. Temperature Alters the Respiratory Surface Area of Crucian Carp Carassius Carassius and Goldfish Carassius auratus. J. Exp. Biol. 2005, 208, 1109–1116. [Google Scholar] [CrossRef] [PubMed]
  50. Auteri, M.; Zizzo, M.G.; Serio, R. GABA and GABA Receptors in the Gastrointestinal Tract: From Motility to Inflammation. Pharmacol. Res. 2015, 93, 11–21. [Google Scholar] [CrossRef]
  51. Jiang, J.; Yin, L.; Li, J.-Y.; Li, Q.; Shi, D.; Feng, L.; Liu, Y.; Jiang, W.-D.; Wu, P.; Zhao, Y. Glutamate Attenuates Lipopolysaccharide-Induced Oxidative Damage and mRNA Expression Changes of Tight Junction and Defensin Proteins, Inflammatory and Apoptosis Response Signaling Molecules in the Intestine of Fish. Fish Shellfish. Immunol. 2017, 70, 473–484. [Google Scholar] [CrossRef]
  52. Li, J.; Wang, C.; Wang, L.; Xu, Q.; Zhao, Z.; Luo, L.; Du, X. Effects of Glutamate in Low-phosphorus Diets on Growth Performance, Antioxidant Enzyme Activity, Immune-related Gene Expression and Resistance to Aeromonas Hydrophila of Juvenile Mirror Carp (Cyprinus carpio). Aquac. Nutr. 2020, 26, 1329–1339. [Google Scholar] [CrossRef]
  53. Wellington, M.O.; Hulshof, T.G.; Ernst, K.; Balemans, A.; Page, G.I.; Van Hees, H.M. Impact of L-arginine and L-glutamine Supplementation on Growth Performance and Immune Status in Weanling Pigs Chal-lenged with Escherichia coli F4. J. Anim. Sci. 2023, 101, skad138. [Google Scholar] [CrossRef] [PubMed]
  54. He, Y.; Dong, X.; Yang, Q.; Liu, H.; Zhang, S.; Chi, S.; Tan, B. Glutamine Improves Growth and Intestinal Health in Juvenile Hybrid Groupers Fed High-Dose Glycinin. Fish Shellfish. Immunol. 2023, 141, 109003. [Google Scholar] [CrossRef]
  55. Zhang, S.; Li, X.; Yuan, T.; Guo, X.; Jin, C.; Jin, Z.; Li, J. Glutamine Inhibits Inflammation, Oxidative Stress, and Apoptosis and Ameliorates Hyperoxic Lung Injury. J. Physiol. Biochem. 2023, 79, 613–623. [Google Scholar] [CrossRef]
  56. Lee, D.G.; Cho, S.; Lee, J.; Cho, S.H.; Lee, S. Analysis of γ-Aminobutyric Acid Content in Fermented Plant Products by HPLC/UV. J. Appl. Biol. Chem. 2015, 58, 303–309. [Google Scholar] [CrossRef]
  57. Association of Official Analytical Chemists. Official Methods of Analysis; Association of Official Analytical Chemists: Washington, DC, USA, 1990. [Google Scholar]
  58. Zhang, L.; Zhang, L.; Liang, H.; Huang, D.; Ren, M. Effects of Taurine and Vitamin C on the Improvement of Antioxidant Capacity, Immunity and Hypoxia Tolerance in Gibel Carp (Carrassius auratus gibeilo). Antioxidants 2024, 13, 1169. [Google Scholar] [CrossRef] [PubMed]
  59. Zhao, F.; Xu, P.; Xu, G.; Huang, D.; Zhang, L.; Ren, M.; Liang, H. Dietary Valine Affects Growth Performance, Intestinal Immune and Antioxidant Capacity in Juvenile Largemouth Bass (Micropterus salmoides). Anim. Feed Sci. Technol. 2023, 295, 115541. [Google Scholar] [CrossRef]
  60. Sun, L.; Wang, Q.; Wang, R.; Sun, K.; Li, S.; Lin, G.; Lei, P.; Xu, H. Effect of Dietary Poly-γ-Glutamic Acid on Growth, Digestive Enzyme Activity, Antioxidant Capacity, and TOR Pathway Gene Expression of Gibel Carp (Carassius auratus gibelio). Aquac. Rep. 2022, 27, 101412. [Google Scholar] [CrossRef]
  61. Zhao, Y.; Zhang, T.-R.; Li, Q.; Feng, L.; Liu, Y.; Jiang, W.-D.; Wu, P.; Zhao, J.; Zhou, X.-Q.; Jiang, J. Effect of Dietary L-glutamate Levels on Growth, Digestive and Absorptive Capability, and Intestinal Physical Barrier Func-tion in Jian Carp (Cyprinus carpio Var. Jian). Anim. Nutr. 2020, 6, 198–209. [Google Scholar] [CrossRef] [PubMed]
  62. Geyer, P.E.; Holdt, L.M.; Teupser, D.; Mann, M. Revisiting Biomarker Discovery by Plasma Proteomics. Mol. Syst. Biol. 2017, 13, 942. [Google Scholar] [CrossRef] [PubMed]
  63. Ji, K.; He, J.; Liang, H.; Ren, M.; Ge, X.; Masagounder, K. Response of Gibel Carp (Carassius auratus gibelio) to Increasing Levels of Dietary Lysine in Zero Fish Meal Diets. Aquac. Nutr. 2021, 27, 49–62. [Google Scholar] [CrossRef]
  64. Zhang, C.; He, J.; Wang, X.; Su, R.; Huang, Q.; Qiao, F.; Qin, C.; Qin, J.; Chen, L. Dietary Gamma-Aminobutyric Acid (GABA) Improves Non-Specific Immunity and Alleviates Lipopolysaccharide (LPS)-Induced Immune Overresponse in Juvenile Chinese Mitten Crab (Eriocheir sinensis). Fish Shellfish. Immunol. 2022, 124, 480–489. [Google Scholar] [CrossRef] [PubMed]
  65. Yi, C.; Huang, D.; Yu, H.; Gu, J.; Liang, H.; Ren, M. Enzymatically Hydrolyzed Poultry By-Product Supplementation, Instead of Fishmeal, Alone Improves the Quality of Large-mouth Bass (Micropterus salmoides) Back Muscle without Compromising Growth. Foods 2023, 12, 3485. [Google Scholar] [CrossRef] [PubMed]
  66. Mittler, R.; Vanderauwera, S.; Suzuki, N.; Miller, G.; Tognetti, V.B.; Vandepoele, K.; Gollery, M.; Shulaev, V.; Van Breusegem, F. ROS Signaling: The New Wave? Trends Plant Sci. 2011, 16, 300–309. [Google Scholar] [CrossRef] [PubMed]
  67. Xu, M.; Rui, D.; Yan, Y.; Xu, S.; Niu, Q.; Feng, G.; Wang, Y.; Li, S.; Jing, M. Oxidative Damage Induced by Arsenic in Mice or Rats: A Systematic Review and Meta-Analysis. Biol. Trace Elem. Res. 2017, 176, 154–175. [Google Scholar] [CrossRef] [PubMed]
  68. Zhao, Y.; Hu, Y.; Zhou, X.-Q.; Zeng, X.-Y.; Feng, L.; Liu, Y.; Jiang, W.-D.; Li, S.-H.; Li, D.-B.; Wu, X.-Q.; et al. Effects of Dietary Glutamate Supplementation on Growth Performance, Digestive Enzyme Activities and Antioxidant Capacity in Intestine of Grass Carp (Ctenopharyngodon idella). Aquac. Nutr. 2015, 21, 935–941. [Google Scholar] [CrossRef]
  69. Wang, D.M.; Wang, C.; Liu, H.Y.; Liu, J.X.; Ferguson, J.D. Effects of Rumen-Protected γ-Aminobutyric Acid on Feed Intake, Lactation Performance, and Antioxidative Status in Early Lactating Dairy Cows. J. Dairy Sci. 2013, 96, 3222–3227. [Google Scholar] [CrossRef] [PubMed]
  70. Bae, J.; Hamidoghli, A.; Won, S.; Choi, W.; Lim, S.-G.; Kim, K.-W.; Lee, B.-J.; Hur, S.-W.; Bai, S.C. Evaluation of Seven Different Functional Feed Additives in a Low Fish Meal Diet for Olive Flounder, Paralichthys olivaceus. Aquaculture 2020, 525, 735333. [Google Scholar] [CrossRef]
  71. Li, C.; Tian, Y.; Ma, Q.; Zhang, B. Dietary Gamma-Aminobutyric Acid Ameliorates Growth Impairment and Intestinal Dysfunction in Turbot (Scophthalmus maximus L.) Fed a High Soybean Meal Diet. Food Funct. 2022, 13, 290–303. [Google Scholar] [CrossRef] [PubMed]
  72. Li, Y.; Zhen, S.; Sun, F.; Cao, L.; Wang, L. Effects of γ-Aminobutyric Acid on Growth Performance, Immunity, Antioxidant Capacity, and Intestinal Microbiota of Growing Minks. Vet. Sci. 2024, 11, 398. [Google Scholar] [CrossRef]
  73. Zhang, S.; Xue, J.; Zheng, J.; Wang, S.; Zhou, J.; Jiao, Y.; Geng, Y.; Wu, J.; Hannafon, B.N.; Ding, W.-Q. The Superoxide Dismutase 1 3′UTR Maintains High Expression of the SOD1 Gene in Cancer Cells: The Involvement of the RNA-Binding Protein AUF-1. Free Radic. Biol. Med. 2015, 85, 33–44. [Google Scholar] [CrossRef] [PubMed]
  74. Reyes-García, M.G.; Hernández-Hernández, F.; Hernández-Téllez, B.; García-Tamayo, F. GABA (A) Receptor Subunits RNA Expression in Mice Peritoneal Macrophages Modulate Their IL-6/IL-12 Production. J. Neuroimmunol. 2007, 188, 64–68. [Google Scholar] [CrossRef] [PubMed]
  75. Bergeret, M.; Khrestchatisky, M.; Tremblay, E.; Bernard, A.; Gregoire, A.; Chany, C. GABA Modulates Cytotoxicity of Immunocompetent Cells Expressing GABAA Receptor Subunits. Biomed. Pharmacother. 1998, 52, 214–219. [Google Scholar] [CrossRef] [PubMed]
  76. Pfeffer, K. Biological Functions of Tumor Necrosis Factor Cytokines and Their Receptors. Cytokine Growth Factor Rev. 2003, 14, 185–191. [Google Scholar] [CrossRef] [PubMed]
  77. Roca, F.J.; Mulero, I.; López-Muñoz, A.; Sepulcre, M.P.; Renshaw, S.A.; Meseguer, J.; Mulero, V. Evolution of the Inflammatory Response in Vertebrates: Fish TNF-Is a Powerful Activator of Endothelial Cells but Hardly Activates Phagocytes. J. Immunol. 2008, 181, 5071–5081. [Google Scholar] [CrossRef]
  78. Hong, S.; Li, R.; Xu, Q.; Secombes, C.J.; Wang, T. Two Types of TNF-α Exist in Teleost Fish: Phylogeny, Expression, and Bioactivity Analysis of Type-II TNF-A3 in Rainbow Trout Oncorhynchus Mykiss. J. Immunol. 2013, 191, 5959–5972. [Google Scholar] [CrossRef] [PubMed]
  79. Grayfer, L.; Walsh, J.G.; Belosevic, M. Characterization and Functional Analysis of Goldfish (Carassius auratus L.) Tumor Necrosis Factor-Alpha. Dev. Comp. Immunol. 2008, 32, 532–543. [Google Scholar] [CrossRef]
  80. Grayfer, L.; Hodgkinson, J.W.; Hitchen, S.J.; Belosevic, M. Characterization and Functional Analysis of Goldfish (Carassius auratus L.) Interleukin-10. Mol. Immunol. 2010, 48, 563–571. [Google Scholar] [CrossRef] [PubMed]
  81. Haddad, G.; Hanington, P.C.; Wilson, E.C.; Grayfer, L.; Belosevic, M. Molecular and Functional Characterization of Goldfish (Carassius auratus L.) Transforming Growth Factor Beta. Dev. Comp. Immunol. 2008, 32, 654–663. [Google Scholar] [CrossRef] [PubMed]
  82. Nájera-Martínez, M.; López-Tapia, B.P.; Aguilera-Alvarado, G.P.; Madera-Sandoval, R.L.; Sánchez-Nieto, S.; Giron-Pérez, M.I.; Vega-López, A. Sub-Basal Increases of GABA Enhance the Synthesis of TNF-α, TGF-β, and IL-1β in the Immune System Organs of the Nile Tilapia. J. Neuroimmunol. 2020, 348, 577382. [Google Scholar] [CrossRef] [PubMed]
  83. Domenici, P.; Claireaux, G.; McKenzie, D.J. Environmental Constraints upon Locomotion and Predator-Prey Interactions in Aquatic Organisms: An Introduction. Philos. Trans. R. Soc. B Biol. Sci. 2007, 362, 1929–1936. [Google Scholar] [CrossRef]
  84. Guérit, S.; Allain, A.; Léon, C.; Cazenave, W.; Ferrara, N.; Branchereau, P.; Bikfalvi, A. VEGF Modulates Synaptic Activity in the Developing Spinal Cord. Dev. Neurobiol. 2014, 74, 1110–1122. [Google Scholar] [CrossRef] [PubMed]
  85. Negri, S.; Scolari, F.; Vismara, M.; Brunetti, V.; Faris, P.; Terribile, G.; Sancini, G.; Berra-Romani, R.; Moccia, F. GABAA and GABAB Receptors Mediate GABA-Induced Intracellular Ca2+ Signals in Human Brain Microvascular Endothe-lial Cells. Cells 2022, 11, 3860. [Google Scholar] [CrossRef] [PubMed]
  86. Vodovotz, Y.; Bogdan, C.; Paik, J.; Xie, Q.W.; Nathan, C. Mechanisms of Suppression of Macrophage Nitric Oxide Release by Transforming Growth Factor Beta. J. Exp. Med. 1993, 178, 605–613. [Google Scholar] [CrossRef]
Animals 15 00125 g001
Figure 1. Genes related to Nrf2 signaling pathway in Gibel carp. ab Different letters represent significant differences between groups and no letter represents no significant difference between groups. (A) nrf2; (B) sod; (C) cat; and (D) gpx.
Figure 1. Genes related to Nrf2 signaling pathway in Gibel carp. ab Different letters represent significant differences between groups and no letter represents no significant difference between groups. (A) nrf2; (B) sod; (C) cat; and (D) gpx.
Animals 15 00125 g001
Animals 15 00125 g002
Figure 2. Genes related to inflammatory factors in liver of Gibel carp. ab Different letters represent significant differences between groups and no letter represents no significant difference between groups. (A) il-1β; (B) tnf-α; (C) tgf-β; and (D) il-10.
Figure 2. Genes related to inflammatory factors in liver of Gibel carp. ab Different letters represent significant differences between groups and no letter represents no significant difference between groups. (A) il-1β; (B) tnf-α; (C) tgf-β; and (D) il-10.
Animals 15 00125 g002
Animals 15 00125 g003
Figure 3. Genes related to vascular regeneration-related genes in Gibel carp. ab Different letters represent significant differences between groups and no letter represents no significant difference between groups. (A) hif-1α; (B) nos; (C) et1, endothelin 1; (D) vegf; (E) angpt1; and (F) ho-1.
Figure 3. Genes related to vascular regeneration-related genes in Gibel carp. ab Different letters represent significant differences between groups and no letter represents no significant difference between groups. (A) hif-1α; (B) nos; (C) et1, endothelin 1; (D) vegf; (E) angpt1; and (F) ho-1.
Animals 15 00125 g003
Animals 15 00125 g004
Figure 4. Genes related to iron metabolism in Gibel carp. ab Different letters represent significant differences between groups and no letter represents no significant difference between groups. (A) epo; (B) tf; and (C) tfr1.
Figure 4. Genes related to iron metabolism in Gibel carp. ab Different letters represent significant differences between groups and no letter represents no significant difference between groups. (A) epo; (B) tf; and (C) tfr1.
Animals 15 00125 g004
Table 1. Ingredient and nutrient composition of the experimental feed (% air dry basis).
Table 1. Ingredient and nutrient composition of the experimental feed (% air dry basis).
Ingredients
Fish meal a14.00Calcium dihydrogen phosphate2.00
Poultry meal a4.00Vitamin premix b0.20
Soybean meal a22.00Mineral premix b2.00
Cottonseed meal a5.0098.5%L-Lysine c0.30
Rapeseed meal a22.00DL-Methionine c0.10
Wheat flour a14.15Vc Phospholipids0.05
Rice bran a10.00− d60%Choline chloride0.20
Soybean oil4.00γ-Aminobutyric acid (mg/kg)d
Analyzed proximate
composition
Crude protein (%) 40.25 ± 0.28
Crude lipid (%) 8.16 ± 0.11
a Fish meal, obtained from Wuxi Tongwei Feedstuffs Co., Ltd., Wuxi, China; soybean meal, crude protein 46.0%, crude lipid 4.3%, obtained from Wuxi Tongwei Feedstuffs Co., Ltd., Wuxi, China; cottonseed meal 53.7%, crude lipid 1.4%; rapeseed meal, crude protein 39.2%, crude lipid 6.1%, obtained from Wuxi Tongwei Feedstuffs Co., Ltd., Wuxi, China; wheat flour, crude protein 13.1%, crude lipid 4.0%, obtained from Wuxi Tongwei Feedstuffs Co., Ltd., Wuxi, China. b Vitamin premix (IU or mg/kg of premix). Mineral premix (g/kg of premix). Both of them were obtained from HANOVE Animal Health Products (Wuxi, China). c L-lysine and DL-Methionine obtained from Feeer Co., Ltd. (Shanghai, China). d Means additional GABA levels (0 mg/kg (G1), 90 mg/kg (G2), 180 mg/kg (G3), 270 mg/kg (G4), and 360 mg/kg (G5), respectively) of five diets.
Table 2. Primer sequences.
Table 2. Primer sequences.
Genes aForward Primer (5′-3′)Reverse Primer (5′-3′)Accession Number/Reference
β-actinTCCATTGTTGGACGACCCAGTGGGCCTCATCTCCCACATALC382464.1
gpxGAAGTGAACGGTGTGAACGCGATCCCCCATCAAGGACACGDQ983598.1
nrf2TACCAAAGACAAGCAGAAGAAACGGCCTCGTTGAGCTGGTGTTTGG[60]
catTGAAGTTCTACACCGATGAGCTGAGAGTGGACGAAGGAXM_026238665.1
sodTCGGAGACCTTGGTAATGTCGCCTTCTCATGGATCACJQ776518.1
il-10AGTGAGACTGAAGGAGCTCCGTGGCAGAATGGTGTCCAAGTA[61]
il-1βGCGCTGCTCAACTTCATCTTGGTGACACATTAAGCGGCTTCA C[62]
tgf-βGTTGGCGTAATAACCAGAAGGAACAGAACAAGTTTGTACCGATAAG[62]
tnf-αCATTCCTACGGATGGCATTTACTTCCTCAGGAATGTCAGTCTTGCAT[62]
hif-1αCTGCCGATCAGTCTGTCTCCTTTGTGGAGTCTGGACCACGDQ306727.1
vegfATCGAGCACACGTACATCCCCCTTTGGCCTGCATTCACACNM_131408.3
nosGGGGACCCTCCTGAAAATGGTTCTGTCCTCAACGCTGGTGAY644726.1
et1TAAAGCAGCGTCAGACAGGGCTGCCAGCTTGTGTTTGCATNM_131519.1
angpt1CCAAACCTCACCAAGCAAGCGGATTACAGTCCAGCCTCCGXM_059556208.1
ho-1GCAAACCAAGAGAAGCCACCGGAAGTAGACGGGCTGAACCKC758864
epoCGAAGTGTCAGCATACCGGAGCAGATGACGCACTTTTCCCKC460317.1
tfCCGAGAAGATGCACGCAAAGTGTGCATGCCTTGACCAGATAF518747.1
tfr1CTTTGTCAACGAAGTGGCTGAATTACCAAAGAAAATGTGGCGGAACXM_052542523.1
a β-actin, beta-actin; gpx, glutathione peroxidase; nrf2, nuclear factor erythroid 2-related factor 2; cat, catalase; sod, superoxide dismutase; il-10, interleukin-10; il-1β, interleukin-1β; tgf-β, transforming growth factor-β; tnf-α, tumor necrosis factor-α; hif-1α, hypoxia inducible factor-1α; vegf, vascular endothelial growth factor; nos, nitric oxide synthase; et1,endothelin-1; angpt1, angiopoietin-1; ho-1, heme oxygenase 1; epo, erythropoietin; tf, transferrin; tfr1, transferrin receptor protein 1.
Table 3. Growth performance.
Table 3. Growth performance.
IndicesG1G2G3G4G5
IBW (g)41.83 ± 0.0441.88 ± 0.0641.82 ± 0.0341.93 ± 0.0441.90 ± 0.05
FBW (g)100.68 ± 0.87 a103.33 ± 2.20 ab107.40 ± 1.23 b102.97 ± 2.42 ab98.67 ± 1.69 a
FCR1.30 ± 0.02 ab1.26 ± 0.05 ab1.18 ± 0.02 a1.27 ± 0.05 ab1.35 ± 0.04 b
WGR (%)140.68 ± 2.33 a146.73 ± 5.58 ab156.83 ± 2.86 b145.56 ± 5.97 ab135.49 ± 4.15 a
SGR (%/d)0.94 ± 0.01 a0.97 ± 0.02 ab1.01 ± 0.01 b0.97 ± 0.03 ab0.92 ± 0.02 a
Note: IBW (g)—sum of initial body weight of each cage/number of each cage in the beginning; FBW (g)—sum of final body weight of each cage/number of each cage at the end; FCR—weight of feed consumed during feeding/weight gain of fish (g); SGR (%/d)—(ln fish final average weight (g) − ln fish initial average weight (g))/(days of culture) × 100; WGR (%)—(final body average weight of fish (g) − initial body average weight (g))/initial body weight (g) × 100. Data are mean values of triplicate. ab Different superscripts mean significant difference (p < 0.05).
Table 4. Whole body composition.
Table 4. Whole body composition.
IndicesG1G2G3G4G5
Moisture (%)76.62 ± 0.1575.83 ± 0.5275.93 ± 0.3975.96 ± 0.5176.12 ± 0.51
Protein (%)15.38 ± 0.2715.89 ± 0.4816.28 ± 0.7016.29 ± 0.7216.36 ± 0.51
Lipid (%)2.19 ± 0.351.93 ± 0.522.12 ± 0.632.43 ± 0.371.81 ± 0.41
Ash (%)4.50 ± 0.134.64 ± 0.294.57 ± 0.124.52 ± 0.084.96 ± 0.24
Note: Data are mean values of triplicate measurements.
Table 5. Plasma biochemistry.
Table 5. Plasma biochemistry.
IndicesG1G2G3G4G5
ALB (g/L)9.19 ± 0.28 bc9.62 ± 0.37 c9.48 ± 0.32 bc7.71 ± 0.22 a8.64 ± 0.17 b
ALT (U/L)0.81 ± 0.16 a1.11 ± 0.13 ab1.58 ± 0.32 b1.48 ± 0.21 ab1.27 ± 0.19 ab
AST (U/L)134.54 ± 4.56 a149.75 ± 9.27 ab159.50 ± 8.54 b143.00 ± 9.55 ab 142.93 ± 4.61 ab
TC (mmol/L)5.76 ± 0.22 b6.34 ± 0.28 b6.02 ± 0.26 b4.99 ± 0.19 a5.93 ± 0.24 b
TG (mmol/L)1.21 ± 0.05 b1.47 ± 0.09 b1.28 ± 0.07 b1.14 ± 0.06 a1.43 ± 0.07 b
GLU (mmol/L)5.29 ± 0.47 a7.11 ± 0.36 b7.13 ± 0.33 b7.52 ± 0.38 b7.76 ± 0.22 b
TP (g/L)28.77 ± 0.82 b30.61 ± 1.32 b29.08 ± 1.11 b25.56 ± 0.32 a27.88 ± 0.76 b
Note: Data are mean values of triplicate measurements. abc Different superscripts mean significant difference (p < 0.05).
Table 6. Plasma antioxidant indices.
Table 6. Plasma antioxidant indices.
IndicesG1G2G3G4G5
SOD (U/mL)19.39 ± 0.3220.05 ± 0.5519.88 ± 0.5819.69 ± 0.8618.47 ± 0.75
MDA (nmol/mL)10.63 ± 1.0210.02 ± 0.719.04 ± 0.4810.04 ± 0.828.78 ± 0.63
CAT (U/mL)12.11 ± 3.0214.97 ± 2.5113.72 ± 3.149.02 ± 1.517.92 ± 1.32
T-AOC (mM)0.32 ± 0.007 a0.33 ± 0.005 a0.35 ± 0.004 b0.34 ± 0.003 b0.33 ± 0.005 ab
Note: Data are mean values of triplicate measurements. ab Different superscripts mean significant difference (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Bai, X.; Zhang, L.; Liang, H.; Huang, D.; Ren, M.; Mi, H. Dietary γ-Aminobutyric Acid Promotes Growth and Immune System Performance and Improves Erythropoiesis and Angiogenesis in Gibel Carp (Carassius auratus gibelio). Animals 2025, 15, 125. https://doi.org/10.3390/ani15020125

AMA Style

Bai X, Zhang L, Liang H, Huang D, Ren M, Mi H. Dietary γ-Aminobutyric Acid Promotes Growth and Immune System Performance and Improves Erythropoiesis and Angiogenesis in Gibel Carp (Carassius auratus gibelio). Animals. 2025; 15(2):125. https://doi.org/10.3390/ani15020125

Chicago/Turabian Style

Bai, Xinlan, Lu Zhang, Hualiang Liang, Dongyu Huang, Mingchun Ren, and Haifeng Mi. 2025. "Dietary γ-Aminobutyric Acid Promotes Growth and Immune System Performance and Improves Erythropoiesis and Angiogenesis in Gibel Carp (Carassius auratus gibelio)" Animals 15, no. 2: 125. https://doi.org/10.3390/ani15020125

APA Style

Bai, X., Zhang, L., Liang, H., Huang, D., Ren, M., & Mi, H. (2025). Dietary γ-Aminobutyric Acid Promotes Growth and Immune System Performance and Improves Erythropoiesis and Angiogenesis in Gibel Carp (Carassius auratus gibelio). Animals, 15(2), 125. https://doi.org/10.3390/ani15020125

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop