Isolation, Genetic Characterization, and Seroprevalence of Adana Virus, a Novel Phlebovirus Belonging to the Salehabad Virus Complex, in Turkey

Sand fly trapping.

Sand fly trapping campaigns were conducted from August 2012 to September 2012 in Adana (Mediterranean region, Turkey) using CDC miniature light traps as previously reported (29). Live sand flies were pooled based on sex, trapping site, and trapping day, with up to 30 individuals per pool, and placed in 1.5-ml tubes to be further stored at −80°C. No morphological identification of the captured sand flies was performed prior to viral testing. The rationale for this approach was to minimize manipulations to facilitate virus isolation. Adana is the 5th-most-densely populated province of Turkey, with a population of 2.1 million. It is located near the Seyhan River, 30 km inland from the Mediterranean Sea, in south-central Anatolia. Adana lies in the heart of Cukurova, a geographical, economical, cultural, and agricultural region that also covers the provinces of Mersin, Osmaniye, and Hatay. The region is agriculturally productive throughout the year.

Virus detection.

Pools of sand flies were ground in 600 μl of Eagle minimal essential medium (EMEM) (supplemented with 7% fetal bovine serum, 1% penicillin-streptomycin, and 1% [200 mM] l-glutamine) in the presence of a 3-mm tungsten bead using a Mixer Mill MM300 (Qiagen, Courtaboeuf, France) (30). A 200-μl aliquot was used for viral nucleic acid (NA) extraction with the BioRobot EZ1-XL Advanced (Qiagen) using the Virus Extraction minikit (Qiagen) and eluted in 90 μl. Five microliters of this solution was used for reverse transcription-PCR (RT-PCR) and nested-PCR assays with primers targeting the polymerase gene and the nucleoprotein gene using protocols previously described (31, 32). PCR products of the expected size were column purified (Amicon ultracentrifugal filters; Millipore) and directly sequenced. Two real-time RT-PCR assays were designed for specific detection of the newly isolated Adana virus in the polymerase (ADAV-L) and nucleoprotein (ADAV-N) genes, respectively. The primers for the ADAV-L assay consisted of ADAV-L-FW (CACAGATGTCTACTGAGCATGAG), ADAV-L-REV (ACTTATGAGAGGGTGAATATCTCT), and ADAV-L-Probe (6-carboxyfluorescein [6FAM]-TTAACTGGTCTGGATTATTCAACCC-6-carboxytetramethylrhodamine [TAMRA]). The primers for the ADAV-N assay consisted of ADAV-N-FW (GACCGATGATGCATCCTTGCTT), ADAV-N-REV (GCGGATTGATGGTCCTTGAGAA), and ADAV-N-Probe (6FAM-ATTGACAACACCCTTCCAGAGGA-TAMRA). The real-time RT-PCR was performed using the GoTaq probe 1-step quantitative RT-PCR (RT-qPCR) system (Promega) by following the manufacturer's protocol with the following incubation program on a CFX96 real-time system (Bio-Rad): (i) 50°C for 15 min, (ii) 95°C for 2 min; (iii) 40 cycles consisting of 95°C for 15 s and 60°C for 1 min.

Virus isolation and electron microscopy.

A 50-μl volume of ground sand fly pools was inoculated onto 12.5-cm² flasks of Vero cells together with EMEM, enriched with 1% penicillin-streptomycin, 1% [200 mM] l-glutamine, 1% kanamycin, and 3% amphotericin B (Fungizone). After incubation at room temperature for 1 h, 5 ml of fresh EMEM containing 5% fetal bovine serum (FBS) was added. The flasks were incubated at 37°C in a 5% CO₂ atmosphere and examined daily for cytopathic effect (CPE). After detection of CPE during passage 1, the virus was passaged 4 times, and passage 4 (P4) was used for electron-microscopic examination. Negative-stained electron-microscopic specimens were prepared using infected cell supernatant mixed 1:1 with 2.5% paraformaldehyde, fixed onto Formvar/carbon-coated grids, and stained with 2% methylamine tungstate.

Complete genome sequencing.

Adana virus (ADAV) passage 2 was used for complete genome characterization through next-generation sequencing (NGS). Briefly, 140 μl of cell culture supernatant was incubated at 37°C for 7 h with 30 U of Benzonase (Novagen; catalog no. 70664-3); then RNA was extracted using the Viral RNA minikit (Qiagen) onto the BioRobot EZ1-XL Advanced (Qiagen). Random amplification was performed using tagged random primers for reverse transcription (RT) and tag-specific and random primers for PCR amplification (Applied Biosystems). The PCR products were purified (Amicon ultracentrifugal filters; Millipore), and 200 ng was used for sequencing using the Ion PGM sequencer (Life Technologies SAS, Saint Aubin, France). Viral sequences were identified from the contigs based on the best BLAST similarity against reference databases. Sequence gaps were completed by PCR using primers based on NGS results and sequenced either by Sanger sequencing or by NGS. The 5′ and 3′ extremities of each segment were sequenced using a primer including the 8-nucleotide (nt) conserved sequence as previously described (33). For the confirmation of the final acquired sequences by NGS, specific primers were designed for Sanger sequencing of the complete genome.

Genetic distances and phylogenetic analysis.

The sequences of S, M, and L segments were aligned with homologous sequences of other phleboviruses retrieved from GenBank until September 2014 using the CLUSTAL algorithm of the MEGA 5 software (34). Nucleotide and amino acid distances were calculated by the p-distance method. Neighbor-joining analysis (Kimura 2-parameter model) was done with amino acid sequences using MEGA version 5, with 1,000 bootstrap pseudoreplications. Amino acid sequences in the polymerase, Gn, Gc, N, and Ns proteins from all respective complete coding sequences retrieved from the GenBank database were used to study the distribution of evolutionary distances by pairwise comparison, as previously described (30, 35).

Microneutralization-based seroprevalence study.

Human and domestic animal sera were collected in Adana and Mersin provinces after informed consent of the individuals and animal owners, according to the national regulations on the operation and procedure of animal experiment ethics committees (regulation no. 26220, date 7 September 2006). The study protocols were approved by the local ethics committees (MULEC/01.09.10 for human samples, AULEC/201-96-346 for animal samples) and by the Ege University Local Ethical Committee of Animal Experiment with the protocol number 2011-101. The virus microneutralization (MN) assay, previously described for phleboviruses (26, 35), was adapted with minor modifications using the ADAV strain. Briefly, 2-fold serial dilutions from 1:20 to 1:160 were prepared for each serum, and a volume of 50 μl of each dilution was transferred into 96-well plates. A volume of 50 μl containing 1,000 50% tissue culture infective doses (TCID₅₀) of virus was added to each well except for the controls, which contained phosphate-buffered saline (PBS). The plates were incubated at 37°C for 1 h. Then, a 100-μl suspension of Vero cells containing approximately 2 ×10⁵ cells/ml of EMEM enriched with 5% fetal bovine serum, 1% penicillin-streptomycin, 1% [200 mM] l-glutamine, 1% kanamycin, and 3% amphotericin B was added to each well and incubated at 37°C in the presence of 5% CO₂. The first row of each plate contained control sera diluted 1:10 and Vero cells without virus. After 6 days the microplates were read under an inverted microscope, and the presence (neutralization titer of 20, 40, 80, or 160) or absence (no neutralization) of cytopathic effect was noted. To exclude the possibility that MN results observed with ADAV were due to cross-neutralizing antibodies raised against Arbia virus (ARBV), all sera were tested in parallel with a strain of Arbia virus.

Genotyping of sand flies in the virus-positive pool.

To attempt identification of the sand fly species present in the Adana virus-positive pool, PCR was performed using 3-μl of nucleic acid extract of the pool to amplify the cytochrome c oxidase I (COI) gene, frequently used for biological bar coding (37). The PCR products were processed and sequenced through NGS as described above. NGS reads were compared with available sequences in GenBank using the CLC Genomic Workbench 6.5.

Nucleotide sequence accession numbers.

The complete genome of Adana virus has been submitted to GenBank and assigned accession no. KJ939330, KJ939331, and KJ939332.

Sand fly trapping and virus detection.

A total of 7,731 (3,524 females and 4,207 males) sand flies were collected in August and September 2012 from six villages (Fig. 1) located within the district of Adana province (Mediterranean Turkey). They were organized into 380 pools (including 179 female and 201 male pools). The numbers of sand flies and pools originating from individual villages are shown in Table 1. Pool 195, which consisted of 20 males trapped in Damyeri village (lat 36.50733357N, long 41.40570E; altitude, 194 m) was positive with primers N-phlebo1S and -1R (32). The resulting 505-nt sequence in the polymerase gene was most closely related to the Salehabad virus (GenBank accession no JX472403) sequence (86% and 77% identity at the amino acid and nucleotide levels, respectively). Using the two real-time RT-PCR assays specifically designed to detect ADAV, only pool 195 was found to be positive (threshold cycle [C_T] values <26). Fourfold dilutions of pool 195 were tested and found positive until 1:4,096 dilution, with C_T values ranging from 36.2 to 38.2 for the 1:4,096 dilution. This is a convincing argument for the excellent sensitivity of these ADAV-specific real-time RT-PCR tests.

Virus isolation and electron microscopy.

Vero cells that were inoculated with pool 195 showed a clear cytopathic effect after 4 days. Material corresponding to passage 3 was used for mass production and subsequent freeze-drying; these vials have been included in the collection of the European Virus Archive (www.european-virus-archive.com), where they are publicly available for academic research. The morphology of the virus was shown by electron-microscopic examination (Fig. 2). Electron-microcopic micrographs showed spherical or pleomorphic structures, with diameters of 80 to 120 nm and surface projections (5 to 10 nm long) that evenly covered the virions, and were compatible with images observed for other members of the Bunyaviridae family.

Complete genome sequencing.

The reads obtained through using next-generation sequencing were processed by CLC Genomics Workbench 7.0.4. Reads, of minimum length 30 nucleotides, were trimmed using CLC Genomic Workbench 6.5, with a minimum of 99% quality per base, and mapped to reference sequences (Arbia virus; GenBank accession no. JX472400, JX472401, and JX472402 for the L, M, and S segments, respectively). Parameters were set such that each accepted read had to map to the reference sequence for at least 50% of its length, with a minimum of 80% identity to the reference. The complete genome of Adana virus consists of 6,405 nt, 4,229 nt and 1,758 nt for the L, M, and S segments, respectively (GenBank accession no. KJ939330, KJ939331, and KJ939332). The polymerase gene contains a 6,288-nt open reading frame (ORF) (2,096 amino acids [aa]), whereas the glycoprotein gene contains a 4,005-nt ORF (1,335 aa). The small segment contains 744-nt and 819-nt ORFs, which are translated to a nucleocapsid protein (248 aa) and a nonstructural protein (273 aa), respectively. Sequences obtained using NGS were confirmed by direct sequencing performed on overlapping PCR products using Sanger sequencing.

Genetic distances.

Pairwise distances of the nucleotide and amino acid sequences among ADAV and viruses in the Salehabad virus complex as well as other phleboviruses are shown. in Table 2 Amino acid pairwise distances between ADAV and other Salehabad complex viruses were ≥21.4% (N), ≥25.3% (NS), ≥26.1% (Gn), ≥15.4% (Gc), and ≥11.5% (L), whereas, compared with other Old World phlebovirus species, they were ≥45.4% (N), 71.4% (NS), 57.7% (Gn), 51.1% (Gc), and 40.5% (L).

To determine if it was possible to distinguish the species using quantitative genetic data, the distribution of amino acid genetic distance was studied independently for each of the genes (L, Gn, Gc, N, and NS genes) (see Table S1 in the supplemental material) using only the complete sequences in the GenBank database. For each of the 9 species recognized by the ICTV, interspecies cutoff values and the highest distance observed between ADAV and other members of the Salehabad virus species were indicated on the histograms. The highest observed amino acid distances between ADAV and Salehabad virus species for the L, Gn, Gc, N, and NS genes are 15.3%, 35.6%, 28.3%, 21.8%, and 32.2%, respectively. Compared gene by gene, these distances are consistently lower than the lowest observed distances between ADAV and phleboviruses other than the Salehabad virus species, which are shown in Table S1 in the supplemental material as 40.0%, 58.1%, 50.6%, 44.4%, and 70.8% for the L, Gn, Gc, N, and NS genes, respectively. The lowest interspecific distances detected for the L, Gn, Gc, N, and NS genes, i.e., 40.0%, 46.2%, 33.6%, 35.8%, and 54.8%, respectively, among phlebovirus species groups were higher than the lowest distances observed between ADAV and Salehabad virus species compared gene by gene (species groups defined by the ICTV [1]). They are indicated in different colors in Table S1 in the supplemental material). This suggests that ADAV may be included in the Salehabad virus species group.

Phylogenetic analysis.

ADAV belongs to the cluster that comprises viruses belonging to the Salehabad virus species, regardless of the viral gene used for analysis. The monophylety of the 3 viruses (SALV, ARBV, and ADAV) is supported with bootstrap values ≥99% for the 4 ORFs (Fig. 3). In phylogenetic analysis (Fig. 3), the major nodes enable identification of the virus species and confirm previously reported topologies (30, 33, 38, 39). For comparison, we also performed maximum-likelihood analysis, which showed the same phlylogenetic relationships for all the gene segments (data not shown).

MN-based seroprevalence study.

Detailed results of an MN-based seroprevalence study are presented in Table 3 and Fig. 1. A total of 124 dog sera were collected from the Adana region, of which 17 (13.7%) contained neutralizing antibodies against ADAV. These 124 sera consisted of 2 batches of 35 and 89 sera, respectively. Detailed information (village, sex, age) and the nature of dog usage (hunting, guard, sheep dog, pet, and village dog) were available for the 89-serum batch only. There was no correlation between these parameters and the presence/absence of neutralizing antibodies against ADAV. They were all negative when tested with Arbia virus.

A total of 1,000 human sera were collected from individuals living in the Mersin region, as well as 51, 48, and 66 sera from goats, sheep, and dogs, respectively. Of the 1,000 human sera, only 7 had neutralizing antibodies against ADAV (0.7%). In contrast, 39 of 165 (23.6%) animal sera collected in Mersin were positive. All, except one human serum, were negative when tested with Arbia virus.

Genotyping of sand flies in the virus-positive pool.

The analysis of NGS reads indicated that pool 195 contained Phlebotomus tobbi (675 reads), Phlebotomus perfiliewi (65 reads), and Phlebotomus papatasi (58 reads) corresponding to the cytochrome c gene.